KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| β-Actin | Cell Signaling Technology | 4970 |
| USP9X | Proteintech | 55054–1-AP |
| RIT1 | Abcam | Ab53720 |
| Vinculin | Sigma-Aldrich | V9264 |
| Cyclophilin A | Bio-Rad | VMA00535 |
| Cas9 | Cell Signaling Technology | 14697 |
| CDC20 | Santa Cruz | 13162 |
| Tubulin | Sigma-Aldrich | T5168 |
| Flag | Sigma-Aldrich | F1804 |
| HA | Biolegend | 901503 |
| Rabbit IGG antibody | R&D Systems | AB-105-C |
| IRDye secondary antibodies | LiCOR | 922–322/680 |
| Bacterial and virus strains | ||
| One Shot TOP10 Chemically Competent E. coli | ThermoFisher Scientific | C404010 |
| Chemicals, peptides, and recombinant proteins | ||
| Erlotinib-OSI-774 | SelleckChem | S1023 |
| Osimertinib-AZD92921 | SelleckChem | S7297 |
| MG132 | Selleck Chemicals | Cat. No. S2619, CAS No. 1211877-36-9 |
| Cycloheximide | Tocris Bioscience | Cat. No. 0970, CAS No. 66-81-9 |
| Complete protease inhibitor cocktail tablets | ThermoFisher Scientific | A32955 |
| Phosphatase inhibitor tablets | ThermoFisher Scientific | A32957 |
| Trypsin | Corning | MT 25–053-CI |
| jetPRIME Reagent | Polyplus | 101000027 |
| Lipofectamine 3000 Reagent | ThermoFisher Scientific | L3000008 |
| RNAiMAX | ThermoFisher Scientific | 13778075 |
| ANTI-FLAG M2 Affinity Gel | Millipore Sigma | A2220 |
| EZview Red Anti-HA Affinity Gel | Millipore Sigma | E6779 |
| Protein A agarose beads | Cell Signaling | 9863S |
| Protein G Sepharose beads | GE Healthcare | 17-0618-01 |
| DMSO | Sigma-Aldrich | D2650 |
| Critical commercial assays | ||
| Pierce BCA Protein Assay Kit | ThermoFisher Scientific | 23225 |
| Bio-Rad Protein Assay Reagent | Biorad | 5000001 |
| CellTiter-Glo Luminescent Cell Viability Assay | Promega | G7572 |
| Lipofectamine CRISPRMAX | Invitrogen | CMAX00008 |
| SuperScript IV First-Strand Synthesis System | Invitrogen | 18091050 |
| Plasmid Plus Midi kit | Qiagen | 12941 |
| Trans-blot Turbo Transfer System | Biorad | 1704274 |
| Taqman Gene Expression Assay: RIT1 | ThermoFisher Scientific | Hs00608424 |
| Taqman Gene Expression Assay: 18S | ThermoFisher Scientific | Hs99999901_s1 |
| Deposited data | ||
| Proteomic data | ProteomeXchange Consortium PRIDE84 | PXD047228 |
| CRISPR screen | Published15 | |
| Experimental models: Cell lines | ||
| PC9 | Dr. Matthew Meyerson (Broad Institute) | |
| NIH3T3 | ATCC | CRL-1658 |
| NCI-H2110 | ATCC | CRL-5924 |
| HEK293T | ATCC | CRL-3216 |
| Oligonucleotides | ||
| sgUSP9X: TCATACTATACTCATCGACA | Synthego | |
| siUSP9X: Sense: 5’ A.C.A.C.G.A.U.G.C.U.U.U.A.G.A.A.U.U.U.U.U 3’ Antisense: 5’ 5’-P.A.A.A.U.U.C.U.A.A.A.G.C.A.U.C.G.U.G.U.U.U 3’ | Dharmacon | CTM-511558 |
| siCtrl: ON-TARGETplus Non-targeting siRNA #1 | Dharmacon | D-001810-01-05 |
| Software and algorithms | ||
| Prism | Graphpad | v10.1.0 |
| ImageJ | NIH | 1.53t |
| ImageStudio | Licor | v5.2.5 |
| Licor Acquisition Software | Licor | v1.1.0.61 |
| Other | ||
| DMEM | Genesee Scientific | 25–500 |
| RPMI 1640 | Gibco | 11875119 |
| Fetal Bovine Serum | Peak Serum | PS-FB2 |
| 96-well cell culture plate | Falcon | 353075 |
| 6-well cell culture plate | CytoOne | CC7682–7506 |
| 6-well non-treated plate | ThermoFisher Scientific | 150239 |
| 10cm cell culture dish | ThermoFisher Scientific | 12556002 |
| White-bottom 384-well cell culture plate | Falcon | 08-772-116 |
| PBS | Corning | 21–040-CV |
| Tris pH 7.5 | Invitrogen | 15-567-027 |
| Tris pH 8.0 | Lonza | 51238 |
| EDTA 0.5 M | Hoefer | GR123–100 |
| NaCl 5 M | Growcells | MRGF-1207 |
| IGEPAL CA-630 | Sigma-Aldrich | 18896 |
| NP-40 | GBiosciences | 072N-A |
| Glycerol | ThermoFisher Scientific | 3563501000M |
| Intercept PBS Blocking Buffer | LiCOR | 927–70003 |
| Select Agar | Sigma-Aldrich | A5054 |