Antibodies |
|
Rabbit monoclonal anti-AMPKα |
Cell Signaling Technology |
Cat#5831; RRID: AB_10622186
|
Rabbit monoclonal anti-phospho-AMPKα (Thr172) |
Cell Signaling Technology |
Cat#50081; RRID: AB_2799368
|
Rabbit monoclonal anti-GPX4 |
Abcam |
Cat# ab125066; RRID: AB_10973901
|
Rabbit monoclonal anti-FTH |
Abcam |
Cat# ab75972; RRID: AB_1310223
|
Mouse monoclonal anti-FPN |
Santa cruz |
Cat# sc-518125 |
Mouse monoclonal anti-β-actin |
Abcam |
Cat# ab6276; RRID: AB_2223210
|
Rabbit monoclonal anti-GAPDH |
Abcam |
Cat# ab181602; RRID: AB_2630358
|
Secondary antibody goat anti-mouse IgG |
Beverly |
Cat#7074 |
Rabbit polyclonal anti-Ubiquitin |
Cell Signaling Technology |
Cat#3933S; RRID: AB_2180538
|
|
Chemicals, peptides, and recombinant proteins |
|
minimum Eagle’s medium |
Thermo Fisher Scientific |
Cat#11095098 |
fetal bovine serum (FBS) |
Sigma |
Cat#12103C |
Palmitic acid |
Sigma |
Cat# P0500 |
metformin |
Sigma |
Cat# PHR1084 |
erastin |
Sigma |
Cat# E7781 |
Ferric ammonium citrate |
Sigma |
Cat# F5879 |
interleukin-6 |
Cusabio |
Cat# CSB-E04640r |
ferritin |
Cusabio |
Cat# CSB-E08826r |
protease inhibitors |
Thermo Fisher Scientific |
Cat# 36978 |
Bicinchoninic acid |
Thermo Fisher Scientific |
Cat# 23227 |
DAPI |
Sigma |
Cat# D9542 |
Lipofectamine 2000 |
Invitrogen |
Cat#11668-019 |
Ferrostatin-1 (Fer-1) |
Sigma |
Cat# SML0583 |
chloroquine |
Sigma |
Cat# C6628 |
AICAR |
Sigma |
Cat# A1393 |
MG132 |
Sigma |
Cat# M7449 |
|
Critical commercial assays |
|
UltraSYBR Mixture RT-PCR reagent |
CWBIO |
Cat# CW2569M |
Cell Counting Kit-8 |
Sigma |
Cat# 96992 |
triglyceride |
Nanjing Jiancheng Bioengineering Institute |
Cat# A110-1-1 |
total cholesterol |
Nanjing Jiancheng Bioengineering Institute |
Cat# F002-1-1 |
malondialdehyde |
Nanjing Jiancheng Bioengineering Institute |
Cat# A003-1-2 |
glutathione |
Nanjing Jiancheng Bioengineering Institute |
Cat# A006-2-1 |
total superoxide dismutase |
Nanjing Jiancheng Bioengineering Institute |
Cat# A001-1-2 |
iron assay kit |
Abcam |
Cat# ab83366 |
|
Experimental models: Cell lines |
|
WRL68 |
iCell Bioscience Inc |
Cat# CL-48 |
|
Experimental models: Organisms/strains |
|
Rats: Sprague-Dawley (SD) |
Hunan Slac-Jinda Animal Company |
N/A |
|
Oligonucleotides |
|
Primers for qRT-PCR, see Table S1
|
This paper |
N/A |
siRNA targeting sequence: FPN #1: GGATGGGTCTCCTACTACA |
RiboBio |
N/A |
siRNA targeting sequence: FPN #2: GGACAAGAATGCTAGACTT |
RiboBio |
N/A |
siRNA targeting sequence: FPN #3: GCACAGCTTTCCTGTTTGA |
RiboBio |
N/A |
shRNA targeting sequence: AMPKα #1: GCGGCTCTTTCAGCAGATTCT |
Honor Gene |
N/A |
shRNA targeting sequence: AMPKα #2: GCTGAAGTTTACCGAGCTATG |
Honor Gene |
N/A |
shRNA targeting sequence: AMPKα #3: GCTGTGAAAGAAGTGTGTGAA |
Honor Gene |
N/A |
|
Recombinant DNA |
|
Plasmid: GFP-FPN |
OriGene |
Cat# RG205219 |
|
Software and algorithms |
|
GraphPad prism 5 |
GraphPad |
https://www.graphpad.com/ |
|
Other |
|
Standard chow diet |
Hunan Slac-Jinda Animal Company |
N/A |
High-fat diet |
Hunan Slac-Jinda Animal Company |
N/A |