Abstract
Immune checkpoint inhibitors have revolutionized cancer therapy, yet the efficacy of these treatments is often limited by the heterogeneous and hypoxic tumor microenvironment (TME) of solid tumors. In the TME, programmed death-ligand 1 (PD-L1) expression on cancer cells is mainly regulated by Interferon-gamma (IFN-γ), which induces T cell exhaustion and enables tumor immune evasion. In this study, we demonstrate that acidosis, a common characteristic of solid tumors, significantly increases IFN-γ-induced PD-L1 expression on aggressive cancer cells, thus promoting immune escape. Using preclinical models, we found that acidosis enhances the genomic expression and phosphorylation of signal transducer and activator of transcription 1 (STAT1), and the translation of STAT1 mRNA by eukaryotic initiation factor 4F (elF4F), resulting in an increased PD-L1 expression. We observed this effect in murine and human anti-PD-L1-responsive tumor cell lines, but not in anti-PD-L1-nonresponsive tumor cell lines. In vivo studies fully validated our in vitro findings and revealed that neutralizing the acidic extracellular tumor pH by sodium bicarbonate treatment suppresses IFN-γ-induced PD-L1 expression and promotes immune cell infiltration in responsive tumors and thus reduces tumor growth. However, this effect was not observed in anti-PD-L1-nonresponsive tumors. In vivo experiments in tumor-bearing IFN-γ−/− mice validated the dependency on immune cell-derived IFN-γ for acidosis-mediated cancer cell PD-L1 induction and tumor immune escape. Thus, acidosis and IFN-γ-induced elevation of PD-L1 expression on cancer cells represent a previously unknown immune escape mechanism that may serve as a novel biomarker for anti-PD-L1/PD-1 treatment response. These findings have important implications for the development of new strategies to enhance the efficacy of immunotherapy in cancer patients.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12943-023-01900-0.
Keywords: Modulators of tumor microenvironment, Immune checkpoint inhibitors, Drug resistance mechanisms in immunotherapy, pH modulation of the tumor microenvironment, Immunotherapy, Oncology, T-cells, Checkpoint inhibitors, Immune response, Biomarkers, Combination therapy, Precision medicine
Background
Treatment with the programmed cell death-protein 1 (PD-1) immune checkpoint-targeting monoclonal antibodies (mAbs) pembrolizumab or nivolumab has significantly improved the overall survival of patients with various types of cancer. PD-1/PD-L1 blockade represents an approved standard-of-care treatment for patients with metastatic melanoma or non-small cell lung cancer [1, 2]. Most recently, further PD-1 blocking mAbs have been approved for treatment of patients with advanced squamous cell skin cancer and basal cell carcinomas as well as for patients with advanced or recurrent DNA mismatch repair deficient (dMMR) endometrial cancers [3–5].
Despite the impressive improvement in anti-PD-1 therapy for advanced melanoma, only 16% of patients achieve a complete response, and 25% achieve a partial response. Anti-PD-1 treatment results in an estimated 5-year overall survival of 34% in all patients [1], highlighting the importance of studying the mechanisms of treatment response and resistance.
Reliable and robust biomarkers to predict the response to checkpoint inhibitor therapy remain elusive. Key elements that influence the success of checkpoint inhibitor therapies are immune cell infiltration and the tumor mutational burden [6, 7]. A nonrandomized phase Ib clinical trial with pembrolizumab identified an activated T cell gene expression profile and PD-1 expression as a favorable prognostic biomarker [7]. Several studies suggest that patients with tumors overexpressing PD-L1 exhibit a better clinical outcome to anti-PD-L1 therapy [8]. PD-L1 expression on cancer cells can vary between different cancer types. Cell-intrinsic, genetic characteristics of the respective cancer cells, such as 9p24.1 amplification leading to increased Janus kinase 2 (JAK2) and PD-L1 expression [9] or oncogenic RAS stabilizing the Pdl1 mRNA [10], explain differences in PD-L1 expression among tumor types. Nevertheless, tumors lacking PD-L1 expression on cancer cells still respond to anti-PD-L1 therapy, indicating that the expression of PD-L1 on cancer cells and tumor-infiltrating immune cells might prevent an antitumor CD8+ T cell response [11–13]. In addition to cancer cell-intrinsic, genetic PD-L1 regulation, cancer cell-extrinsic factors regulate PD-L1 expression. These factors include IFN-γ secreted by tumor-infiltrating T lymphocytes [14] or hypoxia [15] within the tumor microenvironment (TME). Therefore, cancer cell-intrinsic PD-L1 expression alone might be a poor biomarker to predict the response to PD-1/PD-L1 blockade. Dynamic changes in PD-L1 expression patterns in the TME and infiltrating immune cells may be more relevant for immune escape and predicting the therapy response [13, 16].
Resistance to treatment caused by tumor heterogeneity, clonal cooperation [17], and immune inhibition [18] by elements such as acidosis within the TME [19] represent a major challenge in checkpoint inhibitor therapies. Various immune cells, such as T cells, natural killer cells, dendritic cells, and macrophages, show impaired effector functions in an acidic TME, representing a mechanism of tumor immune escape and checkpoint inhibitor resistance [20]. Furthermore, lactate produced by cancer cells has been reported to increase PD-L1 expression in human lung cancer cells [21]. Knockdown of lactate dehydrogenase-A by a small hairpin RNA increased the efficacy of anti-PD-1 therapy by inducing CD4+ or CD8+ T cell and NK cell recruitment to the tumor [22]. A recent study by Kwon et al. suggested that acidosis increases PD-L1 expression via STAT3 activation in MDA-MB-231 cells [23]. Further, tumor acidosis suppresses IFN-γ secretion by immune cells representing a separate mechanism of tumor immune escape [24]. Hypoxia is often associated with the rapid growth of solid tumors and, triggers the upregulation of hypoxia-inducible factor-1α (HIF-1α). This in turn leads to increased PD-L1 expression in tumor cells. Concurrently, hypoxia-induced acidosis activates multiple signaling pathways, further promoting PD-L1 expression and dampening antitumor immune responses [25–27]. Necrotic regions within the tumor microenvironment release proinflammatory mediators such as TNF and damage-associated molecular patterns (DAMPs), which in turn stimulate immune cells to upregulate PD-L1 to safeguard against excessive T cell activation [28–30]. The intricate connection between hypoxia, acidosis, necrosis, and PD-L1 expression fosters immune escape by hindering effector T cell function and promoting the expansion of regulatory T cells [31, 32].
The TME is heterogeneous in terms of spatial and temporal dynamic immune cell infiltration and distribution [17]. IFN-γ secretion by immune cells, including T cells, B cells, NK cells, and antigen-presenting cells, induces PD-L1 expression by binding to the interferon type II receptor, leading to JAK1, JAK2 and STAT1 activation by phosphorylation [14]. IFN-γ-induced PD-L1 expression on the cell membrane is mediated by transcriptional induction and subsequent translation of the Stat1 mRNA by the eukaryotic translation initiation complex eIF4F. Consequently, we hypothesize that immune cell-derived IFN-γ within a tumor region with a neutral tumor pHe affects the dynamics of PD-L1 expression in adjacent acidic tumor regions and thus might represent a novel immune escape mechanism.
To our knowledge, nothing is known so far concerning the effect of IFN-γ in combination with tumor acidosis on PD-L1 expression as an additional prognostic biomarker. In the present study, we show that acidosis increased IFN-γ-induced PD-L1 expression in cancer cells both in vitro and in vivo. Acidosis-induced PD-L1 expression was mediated by increased STAT1 activity, which relied on the efficient translation of the Stat1 mRNA by elF4F. Furthermore, neutralization of the acidic tumor pHe not only suppressed PD-L1 expression but also increased immune cell recruitment and focal tumor necrosis. Our results highlight a critical role for tumor acidosis in the IFN-γ-mediated induction of PD-L1 expression via enhanced STAT1 phosphorylation and subsequent immune escape of anti-PD-L1 responsive tumors.
Methods
Cell lines and reagents
The MC38wt, MC38PD−L1−/− (generated by CRISPR/Cas9 [12]) and human MCF-7, MIA-PaCa-2, SK-MEL-28 and U87 MG cell lines were maintained in DMEM (Biochrom, Berlin, Germany) with 3.7 g l−1 NaHCO3 supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich, St. Louis, MO, USA), 100 U ml−1 penicillin–streptomycin (Biochrom) and 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Biochrom). HCA-7 colony 29 cells (Werner Siemens Imaging Center (WSIC) originally from ATCC) were maintained in DMEM with 3.7 g l−1 NaHCO3 supplemented with 10% FBS, 100 U ml−1 penicillin–streptomycin and 1 mM sodium pyruvate (Biochrom). B16-F10wt (ATCC), MCF-7 (WSIC originally from ATCC) and U87 MG (kindly provided by Simone Fulda) cell lines were maintained in DMEM with 3.7 g l−1 NaHCO3 supplemented with 10% FBS and 100 U ml−1 penicillin–streptomycin. CT26wt and CT26PD−L1−/− (generated by CRISPR/Cas9 [12]) cell lines, as well as the 4T1wt cell line (WSIC originally from ATCC), were maintained in RPMI 1640 (Biochrom) with 2.0 g l−1 NaHCO3 supplemented with 10% FBS and 100 U ml−1 penicillin–streptomycin. For pHe-defined cell culture media, DMEM (Biochrom) with 3.7 g l−1 (44.05 mM, neutral) or 0.34 g l−1 (4 mM, acidic) NaHCO3 and RPMI 1640 (Sigma-Aldrich) with 3.7 g l−1 (44.05 mM, neutral) or 0.08 g l−1 (1 mM, acidic) NaHCO3 were used. Cells were maintained at 37 °C with 5% CO2 in a humidified incubator and tested for mycoplasma monthly.
Murine IFN-γ was purchased from Merck Millipore (Billerica, MA, USA), and human IFN-γ was purchased from R&D Systems (Minneapolis, MN, USA). Lipofectamine 2000 and Opti-MEM were obtained from Thermo Fisher Scientific (Waltham, MA, USA). Silvestrol was purchased from MedChemExpress (Monmouth Junction, NJ, USA), and phosphatase inhibitor cocktails 2 (P5726) and 3 (P0044) were purchased from Sigma-Aldrich. Protease inhibitor cocktail (04693159001) was purchased from Roche (Basel, Switzerland). Antibodies against STAT1 (9172), pSTAT1 (phospho Y701; 9167), KA-PD-L1 (13684), PD-L1 (13684), elF4A1 (2490), elF4E (2067) and β-actin (4970) were purchased from Cell Signaling Technology (Danvers, MA, USA). The anti-PD-L1 (AF1019) antibody was purchased from R&D Systems, anti-pSTAT1 (phospho Y701; 29045) was purchased from Abcam (Cambridge, UK), and anti-Ki67 (14–5698) was purchased from eBioscience (San Diego, CA, USA).
In vitro cell culture
For murine MC38wt and B16-F10wt cells unbuffered DMEM media was supplemented with 10% FBS, 100 U ml−1 penicillin–streptomycin and NaHCO3. An acidic pHe of 6.8 for the continuative in vitro experiments with murine MC38wt and B16-F10wt cells at a concentration of 4 mM NaHCO3 in DMEM cell culture media was chosen. The neutral cell culture media with a concentration of 44.05 mM NaHCO3 resulted in a pHe of 7.7. Next, for murine CT26wt and 4T1wt cells, RPMI-1640 cell culture media supplemented with 10% FBS, 100 U ml−1 penicillin–streptomycin and NaHCO3 was selected. The cell culture media pHe was again adjusted at 37 °C in a 5% CO2 atmosphere and determined after 5 h and 24 h. This resulted in a pHe of 6.8 when applying a NaHCO3 concentration of 1 mM. Respectively a concentration of 23.81 mM (pHe 7.5) or 1 mM NaHCO3 (pHe 6.8) in RPMI-1640 was applied for all in vitro experiments with murine CT26wt and 4T1wt cells. For all in vitro experiments, a consistent terminology was chosen, independent whether cells were maintained in DMEM or RPMI cell culture media.
In one individual experiment (Fig. S2) 5x106 MC38wt tumor cells were cultured at 37 °C in a 5% CO2 atmosphere in acidic (pH = 6.8), intermediate (pH = 7.4) and neutral (pH = 7.7) media. The pHe of the acidic cell media was adjusted by addition of HCl and the pHe of neutral cell media was adjusted by addition of NaHCO3.
Neutral cell culture conditions (pHe 7.7 for DMEM, pHe 7.5 for RPMI) are abbreviated with N, whereas acidic cell culture conditions (pHe 6.8) are abbreviated with A. In the presence of IFN-γ the abbreviations NIFN−γ and AIFN−γ were applied, respectively.
siRNA transfection
Cells were seeded 24 h prior to transfection with 50 nM siRNAs (GE Healthcare Dharmacon, Lafayette, CO, USA) targeting murine STAT1 (M-058881–02) and human STAT1 (M-003543–01) or with a nontargeting siRNA (D-001206–13-20) using Lipofectamine 2000 in Opti-MEM. Twenty-four hours after transfection, cells were treated with IFN-γ (10 ng ml−1) and/or acidic media and harvested for Western blot, qRT-PCR or flow cytometry analyses 24 h later.
RNA preparation, cDNA synthesis and quantitative real-time PCR (qRT-PCR)
Total RNA was isolated according to the manufacturer’s instructions (peqGOLD, VWR International, Radnor, PA, USA), including additional genomic DNA digestion with DNase I (peqGOLD, VWR International). The cDNA templates were synthesized using oligo(dT) primers (Eurofins, Ebersberg, Germany), nucleoside triphosphates (20 mM dNTPs, Amersham, UK), 5 × buffer (18064–014, Invitrogen, Carlsbad, CA, USA), SuperScript II Reverse Transcriptase (Invitrogen), β-mercaptoethanol (Carl Roth) and recombinant ribonuclease inhibitor (Promega, Madison, WI, USA). Target gene expression (primer list Table 1) was determined using SYBR® Green PCR Master Mix (Qiagen, Hilden, Germany) in a Light Cycler (Roche Diagnostics GmbH, Mannheim, Germany). The qRT-PCR conditions were as follows: initial activation at 95 °C for 15 s, followed by 40 amplification cycles at 95 °C for 15 s, 60 °C for 45 s and 72 °C for 30 s. Relative mRNA levels were normalized to the mean CT values of GAPDH, aldolase and β-actin.
Table 1.
Primer sequences for qRT-PCR
| Species | Primer | Sequence (5'- > 3') |
|---|---|---|
| murine | Aldolase | TGGGCCTTGACTTTCTCCTAT |
| TGTTGATGGAGCAGCCTTAGT | ||
| β-actin | CGGATGTCAACGTCACACTT | |
| GGCCAGGTCATCACTATTGG | ||
| Gapdh | ACACATTGGGGGTAGGAACA | |
| AACTTTGGCATTGTGGAAGG | ||
| Pd-l1 | CGCCTGCAGATAGTTCCCAA | |
| ATCGTGACGTTGCTGCCATA | ||
| Stat1 | TTGACGACCCTAAGCGAACT | |
| TCAAATTCGGGGCCCACTAT | ||
| Mmp-2 | CACACCAGGTGAAGGATGTG | |
| AGGGCTGCATTGCAAATATC | ||
| Mmp-9 | CGTCGTGATCCCCACTTACT | |
| AACACACAGGGTTTGCCTTC | ||
| human | Aldolase | AATGTTCTGGCCCGTTATGC |
| CCAGGTAGATGTGGTGGTCA | ||
| β-actin | ACTCTTCCAGCCTTCCTTCC | |
| TCTCCTTCTGCATCCTGTCG | ||
| Gapdh | CCAGAACATCATCCCTGCCT | |
| CCTGCTTCACCACCTTCTTG | ||
| Pd-l1 | GTGCCGACTACAAGCGAATT | |
| CTTGGAATTGGTGGTGGTGG | ||
| Stat1 | GTGGTACGAACTTCAGCAGC | |
| CATGAAAACGGATGGTGGCA |
Flow cytometry analysis
For the analysis of cell surface PD-L1 expression, cells were harvested after an incubation with trypsin, washed with PBS (Thermo Fisher Scientific) and passed through a 40 µm cell strainer with a snap cap (Corning, New York, United States). Single-cell suspensions were stained with a Zombie NIR™ Fixable Viability Kit (Biolegend, San Diego, CA, USA), BV605-CD274 (mouse, clone 10F.9G2, Biolegend) or BV605-CD274 (human, clone 29E.2A3, Biolegend) for 45 min at 4 °C, washed three times with PBS supplemented with 1% FCS and analyzed using a BD LSRFortessa flow cytometer and FlowJo Software (BD Bioscience, San Jose, CA, USA).
Western blot assays
For immunoblotting, cells were lysed with RIPA buffer containing phosphatase II and III (50 µl, Sigma-Aldrich) and protease inhibitors (10 mM EDTA, oComplete, Roche). Protein lysates were sonicated (5 min), centrifuged (15 min) and separated on 10% SDS-PAGE gels. After transfer onto polyvinylidene difluoride (PVDF) membranes, washing with 0.05% Tween 20 in PBS (PBS-T) and blocking with intercept blocking buffer (LI-COR Bioscience, Lincoln, NE, USA), membranes were incubated with the primary antibodies. The primary antibodies STAT1 (9172), pSTAT1 (phospho Y701; 9167), elF4A1 (2490), elF4E (2067) and β-actin (4970) were purchased from Cell Signaling Technology. The primary anti-PD-L1 (AF1019) antibody was purchased from R&D Systems and anti-pSTAT1 (phospho Y701; 29045) was purchased from Abcam (Cambridge, UK). After washes with PBS-T, the membranes were incubated with either donkey anti-mouse (926–68072, IRDye® 680RD), anti-rabbit (926–68073, IRDye® 680RD and 925–32213, IRDye® 800CW) or anti-goat (926–68074, IRDye® 680RD) antibodies from LI-COR Bioscience and detected using the OdysseySA Infrared Imaging System (LI-COR Bioscience). For densitometry, signals were quantified using Image Studio Light Ver 5.2 software (LI-COR Bioscience). For the Western blot (WB) shown in Fig. 3A cells were lysed with lysis buffer containing 20 mM TRIS–HCl pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mM Na2EDTA, 1 mM EGTA, 1 mM β-glycerophosphate, 2 M urea and 1 × protease inhibitor cocktail (Roche) for 10 min on ice. Next, protein lysates were sonicated for 10 min using a bioruptor (Sonifier B-12 A), Laemmli buffer (0.5 M Tris/HCl pH 6.8, Trizma Base, Sigma Aldrich, T1503; HCL, Carl Roth, 6331.4; Glycerol 3 mL, Carl Roth, 3783.1; SDS 1 g,Carl Roth, CN30.2; Bromophenol blue 1.2 mg, Sigma Aldrich, B8026) was added, and the samples were separated by SDS-PAGE and transferred to a nitrocellulose membrane (Merck Millipore, IPFL00010).
Fig. 3.
STAT1 is required for AIFN−γ-induced PD-L1 expression in cancer cells and elF4F inhibition blocks AIFN−γ-mediated PD-L1 expression in cancer cells. A Analysis of pSTAT1, STAT1 and β-actin protein levels in MC38wt cells treated with acidic media and/or IFN-γ (10 ng ml−1) for 12 h and 24 h as determined using Western blotting (B) Densitometry of pSTAT1/STAT1 Western blotting of A. C-F MC38wt cells were transfected with a control (siCTL) or Stat1-specific siRNA and treated for 24 h with acidic media ± IFN-γ (10 ng ml−1) before the assessment of relative (C) Stat1 and (D) Pdl1 mRNA expression normalized to Gapdh, Aldolase and β-actin (n = 3) and (E) cell surface PD-L1 expression (n = 3) using qRT-PCR and flow cytometry, respectively. (A, H) The two signals per condition represent two independent samples (n = 2); two independent experiments showed similar results. Statistics: Tukey’s multiple comparison test. F Western blot analyses of pSTAT1, STAT1, PD-L1 and β-actin levels were performed to determine the STAT1 knockdown efficiency (n = 2). Data are presented as the means ± SEM. N = neutral media, A = acidic media, NIFN−γ = neutral media plus IFN-γ, AIFN−γ = acidic media plus IFN-γ. G Schematic representation of the eukaryotic translation initiation complex elF4F composed of elF4G, elF4E and elF4A (inhibited by silvestrol) bound to the 5’UTR of the Stat1 mRNA. H Western blot analysis of elF4A1, elF4E and β-actin levels in MC38wt cells treated with acidic media and/or IFN-γ (10 ng ml−1) for 72 h (n = 2). Relative (I) Stat1 and (J) Pdl1 mRNA expression normalized to Gapdh, Aldolase and β-actin (n = 3) and (K) cell surface PD-L1 expression (n = 3) were determined in MC38wt cells treated with acidic media and/or IFN-γ (10 ng ml−1) in the presence of DMSO (control) or silvestrol (30 nM) for 24 h. Data are presented as the means ± SEM. Statistics: Tukey’s multiple comparison test. N = neutral media, A = acidic media, NIFN−γ = neutral media plus IFN-γ, AIFN−γ = acidic media plus IFN-γ
Experimental exogenous tumor models
Female C57BL/6 J, C57BL/6N (acidoCEST-MRI measurements) and BALB/c mice were purchased from Charles River Laboratories (Sulzfeld, Germany). B6.129S7-Ifngtm1Ts/J mice [33] were purchased from The Jackson Laboratory and bred in the animal facility in Tübingen. For direct comparison, C57BL/6 J mice bred in the same animal facility were used for the respective experiments. Animals were used at the age of 8 to 10 weeks and maintained in individually ventilated cages with standard rodent pellet food and water or 200 mM NaHCO3 water (3 days prior to cancer cell inoculation) [24] available ad libitum. Tumors were inoculated by subcutaneous injection (s.c.) of 500,000 MC38wt, 500,000 MC38PD−L1−/−, 100,000 CT26wt or 100,000 CT26PD−L1−/− cells in PBS into the right flank. B16-F10wt tumors were inoculated by an intracutaneous (i.c.) injection of 125,000 cells in PBS into the right flank. 4T1wt tumors were inoculated by an injection of 200,000 cells in PBS into the fourth mammary fat pad. Tumor outgrowth was measured in two dimensions, and the tumor volume was calculated using the formula (length*width*width)/2. Tumor-bearing mice were intraperitoneally (i.p.) injected with 200 µg of a PD-L1-blocking antibody (anti-PD-L1, clone 10F.9G2, Bio X Cell, West Lebanon, NH, USA) or IgG2b isotype control (clone LTF-2, Bio X Cell) every third day starting on day 4 (MC38wt, CT26wt, B16-F10wt) or day 5 (4T1wt) after the cancer cell inoculation. Mice were euthanized due to tumor burden (> 15 mm diameter, ulceration) and/or weight loss (> 20%), according to the local guidelines and regulations.
Histology and immunohistochemistry (IHC)
Human metastatic melanoma tissue was fixed with formalin and embedded in paraffin. Tissue samples were cut into 5 μm sections and processed with hematoxylin eosin staining for the histological evaluation. For IHC, sections were cut into 3 µm sections (Leica CM1950). Staining was performed on an immunostainer (BOND-MAX, Leica Biosystems, Wetzlar, Germany) with mAbs against SOX10 (Cell Marque, Rocklin, CA, USA), CD3 (Leica Biosystems, Wetzlar, Germany), Ki67 (Agilent Technologies, Santa Clara, CA, USA) and PD-L1 (Cell Signaling Technology). Negative and positive controls were included. Images were analyzed using a Nikon Eclipse 80i microscope and a Digital Sight DS-U3 camera with NIS-Elements D software.
Murine tumors were fixed with 4% formalin and embedded in paraffin. For histology, 3–5 µm-thick sections were cut and stained with hematoxylin and eosin (H&E). H&E stained tumors were scanned with the Ventana DP200 (Roche, Basel, Switzerland) and processed with the Image Viewer MFC Application. Necrosis was evaluated in the H&E tumor scans, and the percentage of necrotic area per total tumor section area is reported (necrosis with an area smaller than 0.01 mm2 was not considered). Final image preparation was performed with Adobe Photoshop CS6. IHC was performed on selected samples with an automated immunostainer (Ventana Medical Systems, Tucson, AZ, USA) according to the manufacturer’s instructions for open procedures with slight modifications. The antibody panel used here included CD3 (Clone SP7; DCS Innovative Diagnostik-Systeme, Hamburg, Germany) and PD-L1 (Cell Signaling Technology, Frankfurt am Main, Germany). Appropriate positive and negative controls were used to confirm the adequacy of the staining. All images were acquired with an Axioskop 2 plus Zeiss microscope equipped with a Jenoptik (Laser Optik System, Jena, Germany) ProgRes C10 plus camera. Image analysis was performed with IMS Client Software.
Fluorescence microscopy
For fluorescence microscopy, MC38wt cells were grown and treated in chamber slides (354108, Falcon) and fixed with periodate-lysine-paraformaldehyde. After permeabilization with 0.5% Triton X 100 (T8787, Sigma Aldrich), cells were blocked with donkey serum (D9663, Sigma Aldrich) and then incubated with the respective primary antibodies. Paraffin-embedded MC38wt tumor and human metastatic melanoma tissues were cut into 3–5 µm-thick sections, deparaffinized, unmasked with either citrate buffer (pH 6.0, Thermo Fisher Scientific) or EDTA buffer (pH 9.0, Thermo Fisher Scientific) and washed with distilled water, PBS (D8537, Sigma Aldrich) and PBS containing bovine serum albumin (900.009, Aurion) and Tween 20 (9127.1, Roth). Tissue sections were blocked with donkey serum, incubated with primary antibodies against PD-L1 (E1L3N, Cell Signaling Technology), Ki67 (SolA15, Thermo Fisher Scientific), Iba1 (EPR16588, Abcam), CD4 (4SM95, eBioscience), CD8a (4SM15, eBioscience), CD69 (GTX37447, GeneTex, Irvine, CA, USA), SOX10 (SOX10/1074, Abcam) and melanoma markers (HMB45 + M2-7C10 + M2-9E3 + T311, Abcam) and visualized by an incubation with Cy3 donkey anti-rabbit, Alexa Fluor 647 donkey anti-rat, Alexa Fluor 488 donkey anti-goat, Alexa Fluor 647 donkey anti-mouse or Alexa 488 donkey anti-mouse antibodies (all from Dianova, Hamburg, Germany). Nuclei were stained with DAPI (Sigma-Aldrich) or YO-PRO™-1 iodide (Molecular Probes, Inc., Eugene, OR, USA). Images were analyzed using a Zeiss LSM 800 and ZEN 2.3 software (blue edition). The PD-L1 fluorescence area and nuclei were quantified using ZEN Module Image Analysis.
In vivo acidoCEST MRI measurement
Tumor pHe was determined noninvasively in vivo by chemical exchange saturation transfer (CEST) MRI using iopamidol (Isovue®, Bracco Diagnostics, Milan, Italy) as an external contrast agent. In vivo MR imaging was performed on a preclinical 7 T BioSpec 70/30 MR scanner with a 1H volume coil (inner diameter: 86 mm; both Bruker BioSpin, Ettlingen, Germany). Experimental animals were anesthetized with 1.5% isoflurane in air (flow rate: 0.8 l/min). For contrast agent infusion, a catheter was placed into a lateral tail vein. Correct positioning of the animals was achieved with the aid of a short T1-weighted FLASH sequence (Table 2). MC38wt tumors were localized using a standard axial 2D T2-weighted TurboRARE protocol (Table 2). Body temperature was monitored with a rectal probe and maintained at 35.0–37.8 °C with water-heating systems (Medres, Cologne, Germany). While respiration was monitored and the breathing rate was maintained between 30–50 breaths per minute, respiratory gating was not performed. AcidoCEST MRI was performed using a previously established CEST FISP acquisition protocol [34]. A detailed description of the CEST FISP sequence is provided in Table 2.
Table 2.
Acquisition parameters for MR imaging
| T1 FLASH | T2 TurboRARE | cestFISP | |
|---|---|---|---|
| TE | 2.670 ms | 33.580 ms | 1.435 ms |
| TR | 100 ms | 5551.773 ms | 2.870 ms |
| Flip angle | 30.0° | - | 30.0° |
| Spatial resolution | 0.43 × 0.43 | 0.3 × 0.3 mm2 | 0.6 × 0.6 mm2 |
| Matrix size | 256 × 256 | 128 × 128 | 64 × 64 |
| FOV | 110 × 100 mm2 | 38.4 × 38.4 mm2 | 38.4 × 38.4 mm2 |
| Slice thickness | 1 mm | 1 mm | 1 mm |
| Slice orientation | Coronal | Axial | Axial |
| Number of averages | 1 | 1 | 1 |
| Number of repetitions | 1 | 1 | |
| Number of CEST spectra | - | - | 4 preinjection, 6 postinjection |
| Saturation power | - | - | 3 µT |
| Saturation pulses (pulse duration) | - | - | 60 (100 ms) |
| Number of saturation frequencies | - | - | 40 |
| Saturation frequency range (increments), Hz | - | - |
-30000 -4500 to -3600 (900) -3600 to 0 (600) 0 to 2100 (75) 2100 to 2700 (600) 2700 to 4500 (900) |
| Total acquisition time | 12 s 800 ms | 1 min 28 s 828 ms | 44 min 22 s |
The resulting spectra were fit using MATLAB (MATLAB R2017b, MathWorks, Inc., Natick, MA, USA) with a previously described Bloch fitting analysis method to generate pHe maps [35]. Briefly, the preinjection and postinjection images were averaged at each saturation frequency and smoothed with a Gaussian spatial smoothing algorithm. The resulting averaged and smoothed preinjection image was subtracted from the postinjection image at each saturation frequency to correct for endogenous CEST signals. CEST spectra for each pixel were fitted with the Bloch-McConnell equations for the CEST effects from iopamidol at 4.2 and 5.6 ppm, as well as the water peak; pixels with insufficient contrast (defined as std_noise*2√2/mean_signal) were excluded. Additionally, pixels with pHe values below pH 6.2 and above pH 7.4 were excluded from the analysis. The calculated pHe map was overlaid on the anatomical reference, and data are reported as the average pHe value derived from the sum of individual pixels.
Transcriptome correlation analysis of cutaneous melanoma samples of patients
Transcriptomic data were retrieved via the ‘RTCGA’ package in R version 3.5.0. The results are based on data generated by TCGA Research Network: https://www.cancer.gov/tcga. The ‘expressions TCGA’ function was used to retrieve the mRNA expression profile of 368 cutaneous melanoma samples. RSEM values were log-transformed and a correlation analysis using the Pearson method was employed for the selected genes. Numbers represent the Pearson coefficients, statistically significant results (p < 0.05) are indicated by the presence of a colored circle. Scatter plots represent expression data across all 368 samples.
Statistics
The experiments were not randomized. The investigators were not blinded to allocation during the experiments or outcome assessments. Statistical analysis and graph design were performed with GraphPad Prism (Version 7.03, GraphPad Software, Inc., USA). For the statistical analysis, Tukey’s multiple comparison test, Dunnett’s multiple comparison test, Sidak’s multiple comparison test, a two-tailed Student’s t-test or an unpaired, nonparametric Mann–Whitney test was applied. Statistically significant differences in the tumor pHe determined using acidoCEST MRI between the NaHCO3-treated neutralIFN−γ and untreated acidosisIFN−γ group were determined using a one-tailed Mann–Whitney test, as only the increase in tumor pHe upon NaHCO3 treatment was tested for statistical significance. P-values < 0.05 were considered significant (*).
Results
Acidosis promotes IFN-γ-induced PD-L1 expression by murine and human cancer cells
IFN-γ derived from activated immune cells (T cells, NK cells and macrophages) located close to acidic tumor regions may promote the expression of the PD-L1 gene in cancer cells in these regions. Consistent with these data, we observed the phenomenon of PD-L1 expression on cancer cells near the T cell-enriched tumor regions in human melanoma metastases (Fig. 1A-H). Histopathological analysis of viable tumor tissue (H&E staining and Ki67 IHC staining) revealed increased PD-L1 expression in SOX10-positive melanoma cells located exclusively near CD3+ T cell-enriched melanoma regions, close to necrotic tumor areas (Fig. 1A-H). Thus, we hypothesized that tumor-infiltrating, IFN-γ-secreting immune cells induce PD-L1 expression on cancer cells and thereby mediate immune escape.
Fig. 1.
PD-L1 is expressed on melanoma cells located close to T cell-enriched tumor regions. H&E-stained human metastatic melanoma tissues (A, B) with necrotic tissue regions (black asterisk + encircled with white dashed lines). B-F Shows the magnification of the identical region of the tumor as indicated by the black rectangle (dashed lines) in (A). B-F In the viable melanoma tumor tissue (black asterisk), C SOX-10-expressing melanoma cells were discriminated from the (D) CD3 + T cell infiltrate. In addition, viable tumor regions were discriminated from necrotic tumor regions based on (E) Ki67 expression patterns. IHC showed that tumor regions with pronounced (F) PD-L1 expression (black rectangle) were located near the tumor immune cell infiltrate that was identified based on the cell morphology. G At higher magnification (white rectangle) it is visible that PD-L1 positive cells also express SOX-10. The immunofluorescence double staining of PD-L1 and SOX10 (H) of the serial section (F) shows the same region of the tumor (black rectangle) with PD-L1 positive cells surrounding an immune cell infiltrate. Scale bars: 500 μm (A), 100 μm (B-F), 50 μm (H), 20 μm (G)
We used either neutral (N, pHe = 7.5 (RPMI), 7.7 (DMEM)) or acidic (A, pHe = 6.8 (RPMI and DMEM) culture conditions in the presence or absence of IFN-γ and studied PD-L1 expression in cancer cells to investigate the role of acidosis. Acidic conditions were confirmed by determining the mRNA levels of acidosis-associated surrogate markers such as MMP-2 and MMP-9 [36] and enhanced proliferation [37] of MC38wt cells (Fig. S2A and B). An acidic pHe was generated by lowering the NaHCO3 concentration in cell culture media. We first investigated anti-PD-L1-responsive MC38wt murine colon carcinoma cells to study the effect of basal and induced PD-L1 expression mediated by IFN-γ-secreting immune cells and the acidic TME. IFN-γ treatment under neutral conditions (NIFN−γ) induced Pdl1 mRNA expression, which was further increased under acidic and IFN-γ conditions (AIFN−γ). Elevated Pdl1 mRNA expression (Fig. 2A) caused a significant, more than two-fold increase in membrane (Fig. 2B) and total PD-L1 protein levels (Fig. 2C and D), which was also confirmed by fluorescence microscopy (Fig. S3).
Fig. 2.
AIFN−γ induces PD-L1 expression in anti-PD-L1 mAbs therapy-responsive murine cell lines while PD-L1 expression is not significantly enhanced in those that are non-responsive. A Relative Pdl1 mRNA expression normalized to Gapdh, Aldolase and β-actin (n = 3, statistics: Tukey’s multiple comparison test), B PD-L1 mean fluorescence intensity (MFI) measured using flow cytometry (pooled data from 3 experiments, n = 8, statistics: Tukey’s multiple comparison test) and (C, D) Western blot analysis and densitometry of PD-L1 and β-actin levels (pooled data from 2 experiments, n = 4, statistics: two-tailed Mann–Whitney test) in MC38wt cells treated with acidic media and/or IFN-γ (10 ng ml−1) for 72 h. Data are presented as the means ± SEM. N = neutral media, A = acidic media, NIFN−γ = neutral media plus IFN-γ, AIFN−γ = acidic media plus IFN-γ. E Relative Pdl1 mRNA expression normalized to Gapdh, Aldolase and β-actin (n = 3) and (F) PD-L1 MFI measured using flow cytometry (pooled data from 2 experiments, n = 6) in murine anti-PD-L1-responsive CT26wt cells following treatment with acidic media and/or IFN-γ (10 ng ml−1) for 72 h. PD-L1 MFI of the (G) nonresponsive murine B16-F10wt and (H) 4T1wt cell lines (n = 3) and (I) human HCA7 colony 29 cells (n = 3) treated with acidic media and/or IFN-γ (10 ng ml−1) for 72 h. Data are presented as the means ± SEM. Statistics: Tukey’s multiple comparison test. N = neutral media, A = acidic media, NIFN−γ = neutral media plus IFN-γ, AIFN−γ = acidic media plus IFN-γ
Similar to MC38wt cells, the addition of IFN-γ to acidic culture media increased Pdl1 mRNA (Fig. 2E) and PD-L1 cell surface expression (Fig. 2F) but not total protein expression in murine CT26wt colon carcinoma cells (Fig. S4B and C) with low basal PD-L1 expression (PD-L1low, Fig. S5A-C).
Next, we asked whether cancer cells that are nonresponsive to anti-PD-L1 therapy, such as B16-F10wt melanoma and 4T1wt mammary carcinoma cells [38], differ in their PD-L1 expression pattern. In sharp contrast to the responsive MC38wt and CT26wt cancer cells, no acidosis-induced increase in cell surface PD-L1 expression was observed upon IFN-γ treatment in B16-F10wt and 4T1wt cancer cells (Fig. 2G, H).
Moreover, we screened five human cancer cell lines, colon adenocarcinoma (HCA-7 colony 29), breast cancer (MCF-7), glioma (U-87 MG), malignant melanoma (SK-MEL-28), pancreatic adenocarcinoma (MIA PaCa-2) to explore whether the acidosis- and IFN-γ-induced increase in PD-L1 expression represents a conserved tumor immune escape mechanism (Fig. 2I, S6A). Thus, we observed a significant AIFN−γ-induced increase in PD-L1 expression in the HCA-7 colony 29 (Fig. 2I), MCF-7 and U-87 MG (Fig. S6A) cancer cell lines compared to neutral conditions. Moreover, the addition of IFN-γ to acidic cell culture media further increased PD-L1 mRNA (Fig. S6B) and total protein levels in HCA-7 colony 29 cells (Fig. S6C) suggesting responsiveness to therapeutic blockade of the PD-1/PD-L1 axis.
These results, therefore, indicate that the combination of IFN-γ and acidosis increases the expression of the PD-L1 mRNA, cell surface, and total proteins in various murine and human cancer cells.
Acidosis promotes IFN-γ-induced PD-L1 gene expression by increasing the phosphorylation of STAT1
IFN-γ increased STAT1 protein levels in MC38wt (Fig. 3A and B) and CT26wt cells (Fig. S4B and C) to the same degree under AIFN−γ and NIFN−γ conditions without altering Stat1 mRNA levels (Fig. 3C and S4A). Interestingly, acidosis strongly increased IFN-γ-induced STAT1 phosphorylation in MC38wt cells (Fig. 3A and B) but not in CT26wt cells (Fig. S4B). CT26wt cells revealed only a moderate induction of cell surface PD-L1 expression upon treatment with IFN-γ under acidic conditions (Fig. 2F). Similarly, in human HCA-7 colony 29 cells, the IFN-γ-induced increase in PD-L1 expression under acidic culture conditions (Fig. 2I and S6C) was associated with increased phosphorylation but not the expression of STAT1 (Fig. S6C). Thus, our data indicate that acidosis increases IFN-γ-mediated STAT1 phosphorylation and PD-L1 expression.
We next conducted siRNA-mediated STAT1 knockdown experiments in murine MC38wt and human HCA-7 colony 29 cancer cells to further elucidate the mechanism of AIFN−γ-induced PD-L1 expression. Knockdown of STAT1 in MC38wt cells prevented the inducibility of the STAT1 and PD-L1 mRNAs (Fig. 3C and D), as well as membranous (Fig. 3E) and total PD-L1 protein expression (Fig. 3F). In a similar manner knockdown of STAT1 in HCA-7 colony 29 cancer cells prevented from PD-L1 protein synthesis (Fig. S6D).
Acidosis- and IFN-γ-induced PD-L1 expression depends on elF4F
We investigated the role of translational regulation in IFN-γ-induced STAT1 and PD-L1 expression under acidic conditions. According to recent studies, silvestrol, an inhibitor of the helicase activity of eukaryotic initiation factor 4A, prevents translation of the Stat1 mRNA [39] (Fig. 3G) and might therefore represent a potential therapeutic option to avoid tumor immune escape via the STAT1-PD-L1 axis. In our experimental setting, acidosis showed no effect on the expression of the elF4F complex components elFA1 and elF4E in MC38wt cancer cells (Fig. 3H).
Silvestrol upregulated Stat1 mRNA expression under AIFN−γ conditions (Fig. 3I). This is consistent with the results reported by Cerezo et al. that showed enhanced Stat1 mRNA levels after exposure to IFN-γ and silvestrol [40]. The increase in Stat1 mRNA levels after stimulation by AIFN−γ and inhibition by silvestrol results from the accumulation of non-translated Stat1 mRNA [41]. As shown in Fig. 3D and E, AIFN−γ -induced PD-L1 mRNA and cell surface expression in MC38wt cells.
Importantly, silvestrol treatment inhibited AIFN−γ-induced PD-L1 mRNA and cell surface upregulation in MC38wt cells (Fig. 3J and K). The PD-L1 mRNA and cell surface expression were similar to normal pH condition (Fig. 3J and K). Thus, our results support the key role of STAT-1 activation for AIFN−γ -mediated PD-L1 expression.
Following these studies, we asked whether our in vitro findings were also valid in vivo. Thus, the cancer cell lines with different basal, non-stimulated PD-L1 expression patterns studied in vitro (Fig. S5A) were examined in vivo. MC38wt (PD-L1high) and CT26wt (PD-L1low) carcinomas are responsive to anti-PD-L1 mAb therapy, whereas B16-F10wt (PD-L1high) and 4T1wt (PD-L1low) carcinomas show low-/nonresponsive behavior (Fig. S5A) [42], suggesting that the anti-PD-L1 mAb therapy response is independent of basal PD-L1 expression on cancer cells.
NaHCO3-treatment neutralizes the extracellular tumor pHe
We used NaHCO3 to neutralize the tumor pHe (NaHCO3) in vivo to study the effect of the tumor pHe on cancer PD-L1 expression and immune cell recruitment in mice with intact IFN-γ secretion (Control) [24]. Noninvasive in vivo acidoCEST MRI measurements confirmed a significant increase in the MC38wt tumor pHe upon NaHCO3 treatment (avg. pHe 7.15) compared to MC38wt tumors from mice receiving regular drinking water (avg. pHe 6.52, control, *P < 0.05; Fig. 4A, B and S7). Furthermore, we identified acidic clusters within MC38wt tumors, indicating intratumor heterogeneity (Fig. 4A and S7).
Fig. 4.
Tumor acidosis increases PD-L1 expression on cancer cells and alleviates the immigration of CD3+ T cells. A Representative pHe maps overlaid on T2-weighted axial MRI images of MC38wt tumor-bearing mice injected with iopamidol (i.v.) at day 10 after the cancer cell injection. Mice with intact IFN-γ signaling received either NaHCO3-enriched water three days prior to cancer cell injection or regular drinking water (Control). Individual images of the tumors are shown in Fig. S7. B Average pHe across the whole tumor. The NaHCO3 treatment significantly increased the tumor pHe measured using acidoCEST MRI (n = 3–4 animals per group; 2 mice were excluded from the quantitative analysis because the measured pHe-values were out of the calibration range, see Fig. S7, statistics: one-tailed Mann–Whitney test). C The percentage of necrosis in MC38wt tumors from the NaHCO3 and Control groups was quantified using H&E staining, as shown in Fig. S8. D Representative H&E staining of MC38wt tumors isolated from experimental mice on day 18 after control or NaHCO3 treatment. H&E staining show the well-delimited necrotic area in the MC38wt tumor of a control treated mouse (center, pink area). In contrast, within the MC38wt tumor of a NaHCO3 treated mouse the necrosis is diffuse surrounded by areas of hypoxia reflected by abundant pyknotic cells (hyperchromatic; magnitude: 10x; scalebar: 100 µm). E Representative PD-L1 IHC of a MC38wt tumor isolated from experimental mice on day 18 after control treatment. (magnitude: 12.5x, scalebar 2 mm; insert: 50x; scalebar 500 µm). F Representative fluorescence microscopy images of PD-L1, the proliferation marker Ki67 in MC38wt tumors isolated on day 18 after treatment with NaHCO3 and control groups. G PD-L1 expression was quantified in proliferating and non-proliferating cells from MC38wt tumor regions. Statistics: two-tailed Mann–Whitney test. H Representative CD3 immunohistochemistry of s.c. MC38wt tumors derived from wild-type C57BL/6 J (day 18) or IFN-γ−/− mice (day 17) after the four different treatment conditions. Animals received regular drinking water (control), NaHCO3 in water (NaHCO3), anti-PD-L1 mAb or NaHCO3 & anti-PD-L1 mAb. N = 3 – 4 representative tumors of each experimental group were subjected to CD3 staining. (magnitude: 400x; scalebar: 100 µm)
Tumor acidosis increases PD-L1 expression in cancer cells
Here we aimed to analyze, whether acidosis-induced PD-L1 expression on cancer cells might represent an immune escape mechanism associated with tumor progression in vivo. MC38wt tumors from untreated control mice exhibited significantly less necrosis than tumors from the NaHCO3 solo treatment (Fig. 4C and S8). The NaHCO3 solo treatment led to an increased percentage of necrotic surface, and this was positively correlated with the rise in pHe, as determined by acidoCEST-MRI (Fig. 4A-C).
In Fig. 4D, H&E staining of an MC38wt tumor is represented, comparing control-treated and NaHCO3-treated experimental mice. Control treatment resulted in a well-defined necrotic area at the center of the MC38wt tumor (highlighted in pink). In contrast, NaHCO3 treatment induced more extensive and diffuse necrosis within the MC38wt tumor, which was surrounded by regions of hypoxia, evident from the presence of numerous pyknotic cells (Fig. 4D). The representative PD-L1 IHC image in Fig. 4E reveals that nearly all MC38wt tumor cells displayed positive staining for PD-L1. Notably, PD-L1 expression was heterogeneous, with some cells showing weak expression while clusters of others exhibited intense PD-L1 expression. The regions with the highest PD-L1 expression were primarily located within the necrotic areas (Fig. 4E).
Within MC38wt tumors of untreated mice we determined an increased PD-L1 expression on proliferating Ki67+ cells compared to MC38wt tumors of NaHCO3-treated mice (Fig. 4F and G). In contrast, MC38wt tumors derived from NaHCO3-treated mice exhibited increased PD-L1 expression on non-proliferating Ki67− cells (Fig. 4F and G).
Treatment of MC38wt tumor-bearing mice which underwent NaHCO3 and anti-PD-L1 (NaHCO3 + anti-PD-L1) treatment revealed an increased CD3+ T cell infiltration in the tumor periphery with few scattered CD3+ T cells within the TME (Fig. 4H). Pronounced CD3+ T cell infiltration was also observed in CT26wt and 4T1wt tumors from the NaHCO3 + anti-PD-L1-treated group (Fig. S9). In B16-F10wt tumors of NaHCO3-treated experimental mice, we determined a pronounced infiltrate of tumor-adjacent CD3+ T cells but not in the combined NaHCO3- and anti-PD-L1-treatment group (Fig. S9). In 4T1wt tumors of NaHCO3-treated experimental mice we observed a CD3+ T cell infiltrate at the tumor margins of all experimental groups. Nevertheless, the strongest accumulation of CD3+ T cells was found in 4T1wt tumors of experimental mice upon combined treatment with NaHCO3 and anti-PD-L1 (Fig. S9). As expected MC38wt tumors of tumor-bearing IFN-γ−/− mice exhibited no enhancement of CD3+ T cell accumulation as a consequence of NaHCO3 or anti-PD-L1 treatment (Fig. 4H).
We used IFN-γ−/− mice to study whether IFN-γ secretion by activated tumor-infiltrating immune cells promotes PD-L1 expression on the membrane of MC38wt cells in the untreated experimental group in vivo [24]. In contrast to wild-type mice (Fig. 5A), tumor pHe neutralization in IFN-γ−/− mice (NaHCO3) failed to slow tumor growth (Fig. 5C). MC38wt tumors growing in IFN-γ−/− mice exhibited only a moderate anti-PD-L1 response (Fig. 5C).
Fig. 5.
Tumor growth upon a combinatory or mono-treatment with NaHCO3 and anti-PD-L1 in anti-PD-L1 responsive and nonresponsive tumor models. A Tumor volumes of MC38wt (n = 8 animals per group), B MC38PD−L1−/− (n = 4–5 animals per group), C IFN-γ knockout mice (neutral and acidosis, n = 7–8 animals per group). D CT26wt (n = 7–8 animals per group), and E CT26PD−L1−/− (n = 8 animals per group) tumor volumes of mice treated with NaHCO3 and/or anti-PD-L1 mAb. F Tumor volumes of B16-F10wt (n = 5–8 animals per group) and (G) 4T1wt tumors (n = 5–8 animals per group) growing in mice treated with NaHCO3 and/or anti-PD-L1 mAb. Treatment with NaHCO3-enriched water (200 mM, NaHCO3) started three days prior to cancer cell inoculation; anti-PD-L1 mAb (200 µg per mouse) was administered every third day starting on day 4 (MC38wt, CT26wt, B16-F10wt) or day 5 (4T1wt) after the cancer cell inoculation. Tumors from mice with intact IFN-γ signaling that received regular drinking water developed an acidic tumor pHe (Control). Data are presented as the means ± SEM. Statistics: Tukey’s multiple comparison test (A, C, D, and F) and Sidak’s multiple comparison test (B and E)
Thus, these results support the hypothesis that acidosis-induced PD-L1 expression on cancer cells represents an unknown mechanism of immune evasion, which anti-PD-L1 antibodies might effectively target.
In vivo consequences of acidosisIFN−γ-mediated PD-L1 expression on cancer cells
In addition, we analyzed the effect of acidosis and IFN-γ induced PD-L1 expression on the in vivo growth of different cancer cell types. MC38wt and CT26wt tumors displayed decreased tumor growth in vivo upon NaHCO3 treatment compared to the control (Fig. 5A and D). In addition, the reduction in tumor volume was more pronounced in CT26wt tumors with low basal (PD-L1low) and only weakly inducible PD-L1 expression (Fig. 5D) than in MC38wt tumors with high basal (PD-L1high) and more pronounced inducible PD-L1 expression (Fig. 5A). As expected, both MC38wt and CT26wt tumors responded to anti-PD-L1 treatment. They showed a significant reduction in tumor volume [12]. Neither MC38wt nor CT26wt tumors in the NaHCO3 + anti-PD-L1 treatment group exhibited an additive therapeutic effect (Fig. 5A and D).
PD-L1-deficient MC38PD−L1−/− and CT26PD−L1−/− (Fig. 5B and E) tumor-bearing mice were treated with NaHCO3 or received regular drinking water (control) to prove that acidosis-induced PD-L1 expression on cancer cells mediates immune escape. Compared to MC38wt and CT26wt tumors, PD-L1-deficient tumors from the untreated control group exhibited lower tumor volumes (Fig. 5B and E). Furthermore, regardless of the tumor pHe, PD-L1-deficient MC38PD−L1−/− and CT26PD−L1−/− tumors exhibited similar tumor growth in mice (NaHCO3 vs. control, Fig. 5B and E). Thus, inducible cancer cell PD-L1 expression represents an essential feature associated with immune escape.
B16-F10wt and 4T1wt tumors, which were not susceptible to AIFN−γ-mediated PD-L1 induction in vitro (Fig. 2G and H), did not show a significant reduction in tumor volume in the NaHCO3 -treated experimental group compared to the untreated control group (Fig. 5F and G). As expected, B16-F10wt and 4T1wt tumors showed no or only a slight reduction in tumor volume upon anti-PD-L1 treatment (Fig. 5F and G).
Correlation analysis of cutaneous melanoma samples of patients
Finally, we have conducted correlation analysis of the transcriptomic data of 368 cutaneous melanoma samples from patients and found a significant positive correlation of PD-L1 and IFN-γ (r = 0.737; p < 0.001), PD-L1 and STAT-1 (r = 0.778; p < 0.001), PD-L1 and IFN-γ driven CXCL10 (r = 0.721; p < 0.001), PD-L1 and the IFN-γ driven CXCL9 (r = 0.733; p < 0.001) and PD-L1 and acidosis driven MMP9 (r = 0.338; p < 0.001; Fig. S10).
In summary, our results indicate that acidosis and IFN-γ-mediated PD-L1 expression on cancer cells represents a previously undescribed novel immune escape mechanism that can be targeted by therapeutic blockade of the PD-L1/PD-1 axis. Thus, we propose that acidosis and IFN-γ-inducible PD-L1 expression represents an additional biomarker for the therapeutic response than tumor PD-L1 expression or T cell homing patterns.
Discussion
The present study explored whether extracellular tumor acidosis and IFN-γ-inducible PD-L1 expression represent a mechanism of immune escape and, therefore, a novel biomarker for the therapeutic response.
We show that acidosis further increases IFN-γ-mediated PD-L1 expression on the surface of various human and murine cancer cell lines. The increase in IFN-γ-mediated PD-L1 expression by acidosis relies on STAT1 gene expression and translation of Stat1 mRNA by the eukaryotic translation initiation factor elF4F, whose subunit, the RNA helicase eIF4A, binds and unwinds a selective subset of mRNAs, including Stat1 [40]. Therefore, acidosis enhanced IFN-γ-induced STAT1 activation via phosphorylation, implying a feed-forward mechanism of acidosis in IFN-γ-induced PD-L1 expression and immune escape.
Notably, STAT1 knockdown and the use of the eIF4A subunit inhibitor silvestrol revealed a predominant role of STAT1 translation and phosphorylation in the acidosis-mediated increase in IFN-γ-induced PD-L1 expression. Our findings suggest a hitherto unknown link between acidosis- and IFN-γ-mediated PD-L1 expression that might represent a mechanism of immune escape. The proposed mechanism mediated by elF4A, an essential regulator of STAT1 and therefore PD-L1 expression [40, 43, 44], upon IFN-γ stimulation and increased STAT1 phosphorylation under acidic conditions opens a window for therapeutic interventions to alleviate immune escape of cancer cells by targeting PD-1/PD-L1 signaling. There is some evidence that PD-L1 expression is mainly regulated by activated STAT1 [45]. However, we cannot exclude the possibility that other STAT members including STAT3 may impact membranous PD-L1 expression upon dual stimulation with acidosis and IFN-γ. Kwon et al. reported an increased STAT3 phosphorylation under acidic media conditions, which was associated with elevated PD-L1 expression in MDA-MB-231 breast cancer cells. However, it is worth noting that in the referred study co-stimulation with acidic media and IFN-γ has not been investigated.
Tumor acidosis has been targeted preclinically by a NaHCO3 treatment, which increases the tumor pHe, and can be measured with microelectrodes [24] or noninvasively using 31P magnetic resonance spectroscopy (MRS) [46] and acidoCEST MRI [24, 46, 47].
The relevance of acidification of the TME has been recently reported by Cappellesso et al. which have experimentally proven that inhibition of the bicarbonate transporter SLC4A4 in pancreatic adenocarcinoma cells mitigated acidosis within the TME due to bicarbonate accumulation in the extracellular space. Inhibition of SLC4A4 in combination with immune checkpoint inhibitor treatment was applicable to overcome immunotherapy resistance and to prolong the survival of pancreatic adenocarcinoma bearing mice [48].
Counteracting the acidification of the TME reduced MC38wt colon adenocarcinoma tumor volumes and increased necrotic regions. Consistent with our findings, Faes et al. reported a significant reduction in the MC38wt tumor volume and increased necrosis upon NaHCO3 treatment [49]. Interestingly, in lung adenocarcinoma, necrosis significantly correlated with PD-L1 expression [50]. Tumor acidosis has been reported to impair IFN-γ secretion by activated cytotoxic CD8+ T cells [24] and NK cells [51]. Moreover, acidosis suppresses the release of TNF from macrophages [52] and monocytes [44]. Thus, the NaHCO3 treatment restores the secretion of cytokines [51], leading to increased PD-L1 expression in immune cells [53]. Since NaHCO3 proved intolerable for patients, several other pharmaceutical compounds targeting TME acidification are currently being tested in clinical trials. These compounds target members of the monocarboxylate transporter [54], sodium hydrogen antiporter [55], and carbonic anhydrase families [56]. Counteracting the acidification of the TME or selective inhibition of elF4A might open a new window for therapeutic intervention. Notably, since the translation of several oncogenes is also eIF4A-dependent, eiF4A inhibitors, such as silvestrol and rocaglaol, have been proposed as promising anticancer agents [57].
We show that the efficacy of NaHCO3 and anti-PD-L1 treatment is independent of basal tumor PD-L1 expression and that the induction of PD-L1 expression in response to tumor acidosis or IFN-γ secretion in the TME might represent an additional biomarker for prediction of a potential therapeutic response. Interestingly, CT26wt tumors with a modest increase in PD-L1 expression upon stimulation with the combination of IFN-γ and acidosis responded better to NaHCO3-mediated pHe neutralization than MC38wt tumors. According to several studies, PD-L1 expression, either on tumor or immune cells, mediates tumor immune escape, rendering total tumor PD-L1 expression more reliable biomarker for predicting the response to anti-PD-L1 therapy [11–13, 58]. Our results suggest that the induction of PD-L1 expression by tumor acidosis and IFN-γ secretion within the TME represents a targetable mechanism of immune escape and determines the response. The two tumor models that did not respond to anti-PD-L1 therapy, B16-F10wt and 4T1wt, did not respond to NaHCO3-mediated pHe neutralization. Our observation concurs with a study by Pilon-Thomas et al. showing the lack of therapeutic response in NaHCO3-treated B16 tumor-bearing mice [24]. Our results also strongly correlate with recent literature demonstrating that blocking the PD-1/PD-L1 axis with an anti-PD-1 antibody leads to a substantial reduction in tumor growth of MC38 or CT26 tumor bearing mice [59–61]. In contrast to our results, Williams et al. have shown that CD8+ T cells efficiently inhibit the growth of IFN-γ receptor 2- or JAK1-deficient B16-F10 tumors which are not sensitive to IFN-γ signaling and subsequent PD-L1 upregulation [17].
Several studies suggest a combined immunohistological assessment of PD-L1 expression and tumor-infiltrating lymphocytes to determine IFN-γ-induced PD-L1 expression in the tumor immune microenvironment [62–64]. This strategy is promising, as it considers immune cell activity, shaped by tumor acidosis. The TME, the infiltration and activation of T cells [24, 65, 66] and macrophage polarization [67] are altered by tumor acidosis. In prostate cancer, tumor acidosis drives macrophages into a protumor phenotype [67]. Furthermore, a low tumor pHe drives immune cells such as CD8+ T cells into an anergic state characterized by reduced cytolytic activity and cytokine secretion [66]. In contrast, tumor pHe neutralization improves the response to anti-CTLA-4 and anti-PD-1 mAb immunotherapies [24].
Our correlation analysis of the transcriptomic data of 368 cutaneous melanoma samples revealed a positive correlation of PD-L1 to IFN-γ, STAT-1, IFN-γ driven CXCL10 and CXCL9 as well as to acidosis driven MMP9.
For validation of our proposed novel PD-L1 biomarker approach in a human cohort, we aim to take tumor biopsies to generate tumor cell suspensions. These tumor cells will be stimulated with IFN-gamma upon acidic and neutral culture conditions and changes in membranous PD-L1 expression analyzed via flow cytometry analysis (before and after stimulation). An additional acidosis related increase in PD-L1 expression upon stimulation with IFN-gamma would predict sensitivity to therapeutic blockade of the PD-1/PD-L1 axis.
Conclusions
In conclusion, our data indicate that combining IFN-γ and acidosis-inducible PD-L1 expression on cancer cells represents a tumor immune escape mechanism. To our knowledge, we are the first to report that the phenomenon and mechanism of joint IFN-γ and acidosis-inducible PD-L1 expression, representing a novel and targetable biomarker for identifying immune therapy responders.
Supplementary Information
Additional file 1: Fig. S1. Induction of surrogate acidosis markers in MC38wt cells treated with acidic cell culture media in vitro. Fig. S2. MC38wt tumor cell proliferation after 72h incubation in acidic and neutral media. Fig. S3. AIFN-γ induces PD-L1 expression on cancer cells. Fig. S4. IFN-γ induces Stat1 and PD-L1 expression in CT26wt cells. Fig. S5. Basal and IFN-γ-induced PD-L1 expression in murine wild-type cell lines and CRISPR/Cas9-generated PD-L1 knockout cells. Fig. S6. AIFN-γ induces total and cell surface PD-L1 expression in different human cancer cell lines. Fig. S7. Imaging of tumor pHe neutralization by NaHCO3 treatment using noninvasive in vivo acidoCEST MRI. Fig. S8. Histopathology of murine MC38wt, CT26wt, B16F10wt, 4T1wt tumors. Fig. S9. CD3 Immunohistochemistry of murine CT26wt, B16F10wt and 4T1wt tumors. Fig. S10. Transcriptome correlation analysis of cutaneous melanoma samples of patients.
Acknowledgements
This work was supported by the Cluster of Excellence iFIT (EXC 2180) “Image Guided and Functionally Instructed Tumor Therapies”, University of Tuebingen, Germany, the Werner Siemens Foundation, the Alexander von Humboldt Foundation within the framework of the Sofja Kovalevskaja Award (to AFM), the Wilhelm-Sander-Stiftung (2020.100.1 to MR), and the Open Access Publication Fund of the University of Tübingen. The authors thank Maren Harant and Dennis Haupt for their excellent technical support.
Abbreviations
- acidoCEST MRI
Acido-chemical exchange saturation transfer magnetic resonance imaging
- eIF4F
Eukaryotic initiation factor 4F
- FPKM
Fragments Per Kilobase of exon per Million reads
- GAPDH
Glyceraldehyde 3-phosphate dehydrogenase
- i.c.
Intracutaneous
- IFN-γ
Interferon-gamma
- IHC
Immunohistochemistry
- JAK1/2
Janus kinase 1/2
- MFI
Mean fluorescence intensity
- PD-1
Programmed death-1
- PD-L1
Programmed death ligand-1
- s.c.
Subcutaneous
- siRNA
Small interfering RNA
- STAT1/2
Signal transducer and activator of transcription 1/2
- MMP-2/-9
Matrix metalloproteinase-2
- MRS
Magnetic resonance spectroscopy
Authors’ contributions
P.K. designed the research project, conducted experiments, acquired data, analyzed data, and wrote the manuscript. S.H.L.H., I.G.M., and L.Q.M. designed some experiments, conducted experiments, acquired data, analyzed data, and wrote parts of the manuscript. V.B., B.F., D.K., F.R., and S.F. conducted experiments and acquired and analyzed data. S.S., M.D.P., A.F.M., A.M., B.K., Z.M.B., D.S., K.S.O., L.F., D.B. and M.F.F. analyzed data. N.H., M.P., B.T., and D.S. conducted experiments and acquired data. M.S. and M.R. designed some experiments, provided reagents, and research facilities, and analyzed data. A.F.M., B.J.P., K.G., D.S. and M.K. designed the research project, analyzed data, and wrote the manuscript P.K. is now an employee of Boehringer-Ingelheim Pharma GmbH & Co. KG, the work was part of his PhD thesis at the University of Tübingen.
Funding
Open Access funding enabled and organized by Projekt DEAL. This work was supported by the Cluster of Excellence iFIT (EXC 2180) “Image Guided and Functionally Instructed Tumor Therapies”, University of Tuebingen, Germany, Wilhelm Sander Foundation (2020.100.1), and the Werner Siemens Foundation.
Availability of data and materials
The datasets analyzed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
Study approval
All animal experiments were approved by the Regierungspräsidium Tübingen and were in concordance with German federal regulations. The veterinarians at the University of Tübingen were consulted for conducting in vivo animal experiments.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Hamid O, et al. Five-year survival outcomes for patients with advanced melanoma treated with pembrolizumab in KEYNOTE-001. Ann Oncol. 2019;30(4):582–588. doi: 10.1093/annonc/mdz011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Grossman JE, et al. Is PD-L1 a consistent biomarker for anti-PD-1 therapy? The model of balstilimab in a virally-driven tumor. Oncogene. 2021;40(8):1393–1395. doi: 10.1038/s41388-020-01611-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Tewari KS, et al. Survival with cemiplimab in recurrent cervical cancer. N Engl J Med. 2022;386(6):544–555. doi: 10.1056/NEJMoa2112187. [DOI] [PubMed] [Google Scholar]
- 4.Gross ND, et al. Neoadjuvant cemiplimab for stage II to IV cutaneous squamous-cell carcinoma. N Engl J Med. 2022;387(17):1557–1568. doi: 10.1056/NEJMoa2209813. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Mirza MR, et al. Dostarlimab for primary advanced or recurrent endometrial cancer. N Engl J Med. 2023;388(23):2145–2158. doi: 10.1056/NEJMoa2216334. [DOI] [PubMed] [Google Scholar]
- 6.Ribas A, Wolchok JD. Cancer immunotherapy using checkpoint blockade. Science. 2018;359(6382):1350–1355. doi: 10.1126/science.aar4060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Ott PA, et al. T-Cell-Inflamed gene-expression profile, programmed death ligand 1 expression, and tumor mutational burden predict efficacy in patients treated with pembrolizumab across 20 cancers: KEYNOTE-028. J Clin Oncol. 2019;37(4):318–327. doi: 10.1200/JCO.2018.78.2276. [DOI] [PubMed] [Google Scholar]
- 8.Patel SP, Kurzrock R. PD-L1 expression as a predictive biomarker in cancer immunotherapy. Mol Cancer Ther. 2015;14(4):847–856. doi: 10.1158/1535-7163.MCT-14-0983. [DOI] [PubMed] [Google Scholar]
- 9.Green MR, et al. Integrative analysis reveals selective 9p24.1 amplification, increased PD-1 ligand expression, and further induction via JAK2 in nodular sclerosing Hodgkin lymphoma and primary mediastinal large B-cell lymphoma. Blood. 2010;116(17):3268–77. doi: 10.1182/blood-2010-05-282780. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Coelho MA, et al. Oncogenic RAS signaling promotes tumor immunoresistance by stabilizing PD-L1 mRNA. Immunity. 2017;47(6):1083–1099.e6. doi: 10.1016/j.immuni.2017.11.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Lau J, et al. Tumour and host cell PD-L1 is required to mediate suppression of anti-tumour immunity in mice. Nat Commun. 2017;8(1):14572. doi: 10.1038/ncomms14572. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kleinovink JW, et al. PD-L1 expression on malignant cells is no prerequisite for checkpoint therapy. Oncoimmunology. 2017;6(4):e1294299. doi: 10.1080/2162402X.2017.1294299. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Noguchi T, et al. Temporally distinct PD-L1 expression by tumor and host cells contributes to immune escape. Cancer Immunol Res. 2017;5(2):106–117. doi: 10.1158/2326-6066.CIR-16-0391. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Garcia-Diaz A, et al. Interferon receptor signaling pathways regulating PD-L1 and PD-L2 expression. Cell Rep. 2017;19(6):1189–1201. doi: 10.1016/j.celrep.2017.04.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Noman MZ, et al. PD-L1 is a novel direct target of HIF-1α, and its blockade under hypoxia enhanced MDSC-mediated T cell activation. J Exp Med. 2014;211(5):781–790. doi: 10.1084/jem.20131916. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Ribas A, Hu-Lieskovan S. What does PD-L1 positive or negative mean? J Exp Med. 2016;213(13):2835–2840. doi: 10.1084/jem.20161462. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Williams JB, et al. Tumor heterogeneity and clonal cooperation influence the immune selection of IFN-γ-signaling mutant cancer cells. Nat Commun. 2020;11(1):602. doi: 10.1038/s41467-020-14290-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Tumeh PC, et al. PD-1 blockade induces responses by inhibiting adaptive immune resistance. Nature. 2014;515(7528):568–571. doi: 10.1038/nature13954. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Corbet C, Feron O. Tumour acidosis: from the passenger to the driver's seat. Nat Rev Cancer. 2017;17(10):577–593. doi: 10.1038/nrc.2017.77. [DOI] [PubMed] [Google Scholar]
- 20.Huber V, et al. Cancer acidity: an ultimate frontier of tumor immune escape and a novel target of immunomodulation. Semin Cancer Biol. 2017;43:74–89. doi: 10.1016/j.semcancer.2017.03.001. [DOI] [PubMed] [Google Scholar]
- 21.Feng J, et al. Tumor cell-derived lactate induces TAZ-dependent upregulation of PD-L1 through GPR81 in human lung cancer cells. Oncogene. 2017;36(42):5829–5839. doi: 10.1038/onc.2017.188. [DOI] [PubMed] [Google Scholar]
- 22.Daneshmandi S, Wegiel B, Seth P. Blockade of Lactate Dehydrogenase-A (LDH-A) improves efficacy of anti-programmed cell death-1 (PD-1) therapy in melanoma. Cancers (Basel) 2019;11(4):450. doi: 10.3390/cancers11040450. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kwon Y-J, et al. The acidic tumor microenvironment enhances PD-L1 expression via activation of STAT3 in MDA-MB-231 breast cancer cells. BMC Cancer. 2022;22(1):852. doi: 10.1186/s12885-022-09956-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Pilon-Thomas S, et al. Neutralization of tumor acidity improves antitumor responses to immunotherapy. Cancer Res. 2016;76(6):1381–1390. doi: 10.1158/0008-5472.CAN-15-1743. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Damgaci S, et al. Hypoxia and acidosis: immune suppressors and therapeutic targets. Immunology. 2018;154(3):354–362. doi: 10.1111/imm.12917. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Giatromanolaki A, et al. Programmed death-1 receptor (PD-1) and PD-ligand-1 (PD-L1) expression in non-small cell lung cancer and the immune-suppressive effect of anaerobic glycolysis. Med Oncol. 2019;36(9):76. doi: 10.1007/s12032-019-1299-4. [DOI] [PubMed] [Google Scholar]
- 27.Estrella V, et al. Acidity generated by the tumor microenvironment drives local invasion. Can Res. 2013;73(5):1524–1535. doi: 10.1158/0008-5472.CAN-12-2796. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wu M, et al. Improvement of the anticancer efficacy of PD-1/PD-L1 blockade via combination therapy and PD-L1 regulation. J Hematol Oncol. 2022;15(1):24. doi: 10.1186/s13045-022-01242-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Sun C, Mezzadra R, Schumacher TN. Regulation and function of the PD-L1 checkpoint. Immunity. 2018;48(3):434–452. doi: 10.1016/j.immuni.2018.03.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Peng Q, et al. PD-L1 on dendritic cells attenuates T cell activation and regulates response to immune checkpoint blockade. Nat Commun. 2020;11(1):4835. doi: 10.1038/s41467-020-18570-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Ding L, et al. PD-1/PD-L1 inhibitors-based treatment for advanced renal cell carcinoma: mechanisms affecting efficacy and combination therapies. Cancer Med. 2021;10(18):6384–6401. doi: 10.1002/cam4.4190. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Mortezaee K, Majidpoor J, Kharazinejad E. The impact of hypoxia on tumor-mediated bypassing anti-PD-(L)1 therapy. Biomed Pharmacother. 2023;162:114646. doi: 10.1016/j.biopha.2023.114646. [DOI] [PubMed] [Google Scholar]
- 33.Dalton DK, et al. Multiple defects of immune cell function in mice with disrupted interferon-gamma genes. Science. 1993;259(5102):1739–1742. doi: 10.1126/science.8456300. [DOI] [PubMed] [Google Scholar]
- 34.Shah T, et al. CEST-FISP: a novel technique for rapid chemical exchange saturation transfer MRI at 7 T. Magn Reson Med. 2011;65(2):432–437. doi: 10.1002/mrm.22637. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Jones KM, et al. Respiration gating and Bloch fitting improve pH measurements with acidoCEST MRI in an ovarian orthotopic tumor model. Proc SPIE Int Soc Opt Eng. 2016;9788:97855154. doi: 10.1117/12.2216418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Nishisho T, et al. The a3 isoform vacuolar type H+-ATPase promotes distant metastasis in the mouse B16 melanoma cells. Mol Cancer Res. 2011;9(7):845–855. doi: 10.1158/1541-7786.MCR-10-0449. [DOI] [PubMed] [Google Scholar]
- 37.Zhang X, Lin Y, Gillies RJ. Tumor pH and its measurement. J Nucl Med. 2010;51(8):1167–1170. doi: 10.2967/jnumed.109.068981. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Mosely SI, et al. Rational selection of syngeneic preclinical tumor models for immunotherapeutic drug discovery. Cancer Immunol Res. 2017;5(1):29–41. doi: 10.1158/2326-6066.CIR-16-0114. [DOI] [PubMed] [Google Scholar]
- 39.Wolfe AL, et al. RNA G-quadruplexes cause eIF4A-dependent oncogene translation in cancer. Nature. 2014;513(7516):65–70. doi: 10.1038/nature13485. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Cerezo M, et al. Translational control of tumor immune escape via the eIF4F-STAT1-PD-L1 axis in melanoma. Nat Med. 2018;24(12):1877–1886. doi: 10.1038/s41591-018-0217-1. [DOI] [PubMed] [Google Scholar]
- 41.Lopez PJ, et al. Translation inhibitors stabilize Escherichia coli mRNAs independently of ribosome protection. Proc Natl Acad Sci U S A. 1998;95(11):6067–72. doi: 10.1073/pnas.95.11.6067. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Seidel JA, Otsuka A, Kabashima K. Anti-PD-1 and Anti-CTLA-4 therapies in cancer: mechanisms of action, efficacy, and limitations. Front Oncol. 2018;8:86. doi: 10.3389/fonc.2018.00086. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Fischer K, et al. Inhibitory effect of tumor cell-derived lactic acid on human T cells. Blood. 2007;109(9):3812–3819. doi: 10.1182/blood-2006-07-035972. [DOI] [PubMed] [Google Scholar]
- 44.Dietl K, et al. Lactic acid and acidification inhibit TNF secretion and glycolysis of human monocytes. J Immunol. 2010;184(3):1200–1209. doi: 10.4049/jimmunol.0902584. [DOI] [PubMed] [Google Scholar]
- 45.Hirahara K, et al. Interleukin-27 priming of T cells controls IL-17 production in trans via induction of the ligand PD-L1. Immunity. 2012;36(6):1017–1030. doi: 10.1016/j.immuni.2012.03.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Robey IF, et al. Bicarbonate increases tumor pH and inhibits spontaneous metastases. Cancer Res. 2009;69(6):2260–2268. doi: 10.1158/0008-5472.CAN-07-5575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Chen LQ, et al. Evaluations of extracellular pH within in vivo tumors using acidoCEST MRI. Magn Reson Med. 2014;72(5):1408–1417. doi: 10.1002/mrm.25053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Cappellesso F, et al. Targeting the bicarbonate transporter SLC4A4 overcomes immunosuppression and immunotherapy resistance in pancreatic cancer. Nat Cancer. 2022;3(12):1464–1483. doi: 10.1038/s43018-022-00470-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Faes S, et al. Acidic tumor microenvironment abrogates the efficacy of mTORC1 inhibitors. Mol Cancer. 2016;15(1):78. doi: 10.1186/s12943-016-0562-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Reiniger L, et al. Tumor necrosis correlates with PD-L1 and PD-1 expression in lung adenocarcinoma. Acta Oncol. 2019;58(8):1087–1094. doi: 10.1080/0284186X.2019.1598575. [DOI] [PubMed] [Google Scholar]
- 51.Pötzl J, et al. Reversal of tumor acidosis by systemic buffering reactivates NK cells to express IFN-γ and induces NK cell-dependent lymphoma control without other immunotherapies. Int J Cancer. 2017;140(9):2125–2133. doi: 10.1002/ijc.30646. [DOI] [PubMed] [Google Scholar]
- 52.Bidani A, et al. Evidence for pH sensitivity of tumor necrosis factor-alpha release by alveolar macrophages. Lung. 1998;176(2):111–121. doi: 10.1007/PL00007593. [DOI] [PubMed] [Google Scholar]
- 53.Hartley G, et al. Regulation of PD-L1 expression on murine tumor-associated monocytes and macrophages by locally produced TNF-α. Cancer Immunol Immunother. 2017;66(4):523–535. doi: 10.1007/s00262-017-1955-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Payen VL, et al. Monocarboxylate transporters in cancer. Mol Metab. 2020;33:48–66. doi: 10.1016/j.molmet.2019.07.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Hosogi S, et al. An inhibitor of Na(+)/H(+) exchanger (NHE), ethyl-isopropyl amiloride (EIPA), diminishes proliferation of MKN28 human gastric cancer cells by decreasing the cytosolic Cl(-) concentration via DIDS-sensitive pathways. Cell Physiol Biochem. 2012;30(5):1241–1253. doi: 10.1159/000343315. [DOI] [PubMed] [Google Scholar]
- 56.Mahon BP, Pinard MA, McKenna R. Targeting carbonic anhydrase IX activity and expression. Molecules. 2015;20(2):2323–2348. doi: 10.3390/molecules20022323. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Pan L, et al. Rocaglamide, silvestrol and structurally related bioactive compounds from Aglaia species. Nat Prod Rep. 2014;31(7):924–939. doi: 10.1039/C4NP00006D. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Juneja VR, et al. PD-L1 on tumor cells is sufficient for immune evasion in immunogenic tumors and inhibits CD8 T cell cytotoxicity. J Exp Med. 2017;214(4):895–904. doi: 10.1084/jem.20160801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Jin Y, et al. Different syngeneic tumors show distinctive intrinsic tumor-immunity and mechanisms of actions (MOA) of anti-PD-1 treatment. Sci Rep. 2022;12(1):3278. doi: 10.1038/s41598-022-07153-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Tomita M, et al. Anti PD-1 treatment increases [18F]FDG uptake by cancer cells in a mouse B16F10 melanoma model. EJNMMI Res. 2018;8(1):82. doi: 10.1186/s13550-018-0433-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Zheng X, et al. Disulfiram improves the Anti-PD-1 therapy efficacy by regulating PD-L1 expression via epigenetically reactivation of IRF7 in triple negative breast cancer. Front Oncol. 2021;11(734853):11. doi: 10.3389/fonc.2021.734853. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Chen DS, Mellman I. Elements of cancer immunity and the cancer–immune set point. Nature. 2017;541(7637):321–330. doi: 10.1038/nature21349. [DOI] [PubMed] [Google Scholar]
- 63.Higgs BW, et al. Interferon gamma messenger RNA signature in tumor biopsies predicts outcomes in patients with non-small cell lung carcinoma or urothelial cancer treated with durvalumab. Clin Cancer Res. 2018;24(16):3857–3866. doi: 10.1158/1078-0432.CCR-17-3451. [DOI] [PubMed] [Google Scholar]
- 64.Johnson DB, et al. Quantitative spatial profiling of PD-1/PD-L1 Interaction and HLA-DR/IDO-1 predicts improved outcomes of anti-PD-1 therapies in metastatic melanoma. Clin Cancer Res. 2018;24(21):5250–5260. doi: 10.1158/1078-0432.CCR-18-0309. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Bosticardo M, et al. Biased activation of human T lymphocytes due to low extracellular pH is antagonized by B7/CD28 costimulation. Eur J Immunol. 2001;31(9):2829–2838. doi: 10.1002/1521-4141(200109)31:9<2829::AID-IMMU2829>3.0.CO;2-U. [DOI] [PubMed] [Google Scholar]
- 66.Calcinotto A, et al. Modulation of microenvironment acidity reverses anergy in human and murine tumor-infiltrating T lymphocytes. Cancer Res. 2012;72(11):2746–2756. doi: 10.1158/0008-5472.CAN-11-1272. [DOI] [PubMed] [Google Scholar]
- 67.El-Kenawi A, et al. Acidity promotes tumour progression by altering macrophage phenotype in prostate cancer. Br J Cancer. 2019;121(7):556–566. doi: 10.1038/s41416-019-0542-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional file 1: Fig. S1. Induction of surrogate acidosis markers in MC38wt cells treated with acidic cell culture media in vitro. Fig. S2. MC38wt tumor cell proliferation after 72h incubation in acidic and neutral media. Fig. S3. AIFN-γ induces PD-L1 expression on cancer cells. Fig. S4. IFN-γ induces Stat1 and PD-L1 expression in CT26wt cells. Fig. S5. Basal and IFN-γ-induced PD-L1 expression in murine wild-type cell lines and CRISPR/Cas9-generated PD-L1 knockout cells. Fig. S6. AIFN-γ induces total and cell surface PD-L1 expression in different human cancer cell lines. Fig. S7. Imaging of tumor pHe neutralization by NaHCO3 treatment using noninvasive in vivo acidoCEST MRI. Fig. S8. Histopathology of murine MC38wt, CT26wt, B16F10wt, 4T1wt tumors. Fig. S9. CD3 Immunohistochemistry of murine CT26wt, B16F10wt and 4T1wt tumors. Fig. S10. Transcriptome correlation analysis of cutaneous melanoma samples of patients.
Data Availability Statement
The datasets analyzed during the current study are available from the corresponding author on reasonable request.





