FIG. 6.
Primer extension identification of menA transcriptional initiation. Equivalent amounts of spectrophotometrically determined RNA from aerobically (+O2) and anaerobically (−O2) grown PL2024 cells were extended with the oligonucleotide GAGGGTTTTAGGTCGTAAACTTTCC derived from the menA sequence 3′ to the translational initiation codon. DNA sequence ladders (lanes G, A, T, and C) are extensions of pMK2 DNA with the same primer. ∗, transcriptional initiation origin. A second primer, located 25 bp upstream from the first and having the sequence GTTGTTCAGTCATAATACGCGCCAATAA, gave similar results.