Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 1998 Jun;180(11):2943–2949. doi: 10.1128/jb.180.11.2943-2949.1998

Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

Lewis V Wray Jr 1, Jill M Zalieckas 1, Amy E Ferson 1, Susan H Fisher 1,*
PMCID: PMC107263  PMID: 9603886

Abstract

Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium.


Changes in the availability of nitrogen result in altered gene expression in microorganisms. When bacterial growth is limited by the supply of nitrogen, the expression of genes required for the transport and catabolism of nitrogen-containing compounds is elevated. This altered gene expression, referred to as nitrogen regulation, increases the degradation of nitrogen-containing compounds and results in the production of glutamate and glutamine, the major nitrogen donors in cellular biosynthesis (19).

In enteric bacteria, the activation of gene expression during nitrogen restriction is mediated by the two-component Ntr regulatory system (18). A nitrogen regulatory system analogous to the enteric Ntr system is not present in the gram-positive sporulating soil bacterium Bacillus subtilis (31); instead, the TnrA regulatory protein activates the expression of many genes during nitrogen-limited growth in B. subtilis (38). These nitrogen-regulated gene products include a putative ammonium permease located in the nrgAB operon, the γ-aminobutyrate permease (gabP), the nitrate assimilatory proteins (nasA, nasBCDEFG), urease (ureABC), and Kipl, an inhibitor of kinase A that lies within the ycsFGI-kipIAR-ycsK operon (36–38). In addition, TnrA represses expression of the glnA gene, which encodes glutamine synthetase, during nitrogen-limited growth (38).

The TnrA-regulated nrgAB, gabP P2, and nas promoters all contain a common inverted repeat (TGTNAN7TNACA; TnrA site) centered 49 to 51 bp upstream of their transcriptional start sites (Fig. 1) (7, 22, 38, 39). This same palindromic DNA sequence is centered 90 bp upstream of the nitrogen-regulated ureABC P3 promoter (37). Mutational analysis indicates that this conserved sequence is required for TnrA-dependent activation of the gabP and nas genes. Deletion of the TnrA site upstream of the gabP P2 promoter region prevents high-level gabP expression during nitrogen-limited growth (7). Replacement of two of the conserved nucleotides in the TnrA site of the divergently transcribed nas promoter region abolishes nitrogen regulation of the nasA and nasBC genes (22).

FIG. 1.

FIG. 1

Alignment of nitrogen-regulated promoters. Nucleotides corresponding to the conserved upstream inverted repeat are boxed. The −35 region of the nrgAB promoter is overlined.

A second regulatory protein, GlnR, also contributes to nitrogen regulation in B. subtilis. During growth in the presence of excess nitrogen, GlnR represses the expression of the glnRA and ureABC operons (32, 37). The TnrA and GlnR proteins are homologs that have extensive sequence similarity within their proposed DNA-binding domains (38). Moreover, the two GlnR operators in the glnRA promoter contain the conserved TnrA-binding-site sequence (38). Expression of glnRA is negatively regulated by TnrA (38). These observations suggest that TnrA and GlnR bind to DNA sites with similar sequences. GlnR does not regulate expression of the nrgAB, gabP, or nas genes (3, 22).

In Salmonella typhimurium, the first signal of nitrogen limitation is a drop in the internal glutamine pool (13). The signals regulating the activity of the TnrA and GlnR proteins have not been identified. Several experimental observations argue that this signal does not involve the intracellular levels of glutamine. First, the B. subtilis glnA22 mutant, which expresses the glnRA operon and all other known nitrogen-regulated genes constitutively during growth on excess nitrogen (3, 8), has intracellular glutamine pools which are sixfold higher than those of wild-type cells (8). In addition, glutamine does not affect the in vitro binding of GlnR to its operators (5). Because constitutive expression of TnrA- and GlnR-regulated genes occurs in glnA mutants (3, 22, 33, 37, 38), glutamine synthetase is required for the synthesis and/or transduction of the nitrogen regulatory signal(s) to the TnrA and GlnR proteins.

In this study, mutational analysis and gel mobility shift DNA-binding assays were used to demonstrate that the conserved inverted repeats located upstream of the nrgAB and gabP P2 promoters function as TnrA-binding sites.

MATERIALS AND METHODS

Bacterial strains and plasmids.

The B. subtilis strains used in this study are all derivatives of strain 168 (trpC2). Strain SF15W contains a chloramphenicol-resistant mini-Tn10 insertion in the B. subtilis ptsI gene. This insertion was isolated during a search for mutations that prevented the high-level expression of nrgAB during nitrogen-limited growth. This mutant was isolated by the same procedure used to isolate the tnrA62::Tn917 mutation (38) except that Tn10 insertion libraries constructed with plasmid pHV1249 (28) were used in place of Tn917 libraries. DNA adjacent to the Tn10 insertion was cloned by plasmid rescue (35) and sequenced by using an oligonucleotide primer complementary to the ends of the Tn10 transposon.

The lacZ α-complementation Escherichia coli strain DH12S (Life Technologies, Inc.) was used as the host for DNA cloning experiments with plasmid pMTL21P. E. coli MC1061 contains a deletion of the chromosomal lac genes and was used for the construction of lacZ fusions. E. coli SFE80, a derivative of MC1061 that contains the plasmid copy number mutation pcnB80 (17), was used for cloning B. subtilis chromosomal DNA by plasmid rescue.

Plasmid pNRG401 was constructed by cloning a 125-bp TaqI-NspI DNA fragment of the nrgAB promoter between the AccI and SphI sites of pMTL21P (6). pSFL6 and pSFL7 are neomycin-resistant lacZ transcriptional fusion vectors that integrate into the amyE locus and contain promoterless trpA-lacZ and spoVG-lacZ genes, respectively (7, 37). The (nrgA-lacZ)407 and (nrgA-lacZ)416 fusions contain the EcoRI-HindIII nrgAB promoter fragment from pNRG401 cloned into pSFL7 and pSFL6, respectively. The (nrgA-lacZ)407 fusion was used to examine nrgAB expression in cells grown in nutrient sporulation medium (NSM) because the spoVG-lacZ gene fusion produced higher levels of β-galactosidase than did the trpA-lacZ gene fusion in this medium. Plasmid pNRG704 contains a 288-bp StyI-NdeI gabP promoter DNA fragment inserted into the StuI site of pMTL21P (7). The (gabP-lacZ)706 transcriptional fusion contains the EcoRI-HindIII gabP promoter fragment from pNRG704 cloned into pSFL6 (7).

All transcriptional fusions were transformed into strain 168 by using plasmid DNA as previously described (34). The tnrA62::Tn917 and ptsl15::Tn10 insertions were transferred by transformation with selection for the respective transposon-encoded erythromycin or chloramphenicol resistance.

Cell growth, media, and enzyme assays.

The methods used for bacterial cultivation in minimal medium and NSM (25) have been previously described (4). Overnight NSM cultures were always grown for four generations in fresh medium, and the resulting logarithmic NSM culture was used to inoculate NSM cultures harvested for enzyme assays. Liquid minimal cultures were grown in the morpholinepropanesulfonic acid (MOPS) minimal medium of Neidhardt et al. (23). Glucose was added at 0.5% to MOPS minimal medium and 1% to NSM medium. All nitrogen sources were added at 0.2% to MOPS minimal medium. The production of heat-resistant spores was examined as previously described (25).

Extracts for enzyme assays were prepared as previously described (4). Cells grown in minimal medium were harvested during exponential growth (70 to 90 Klett units). β-Galactosidase was assayed in crude extracts as described previously (4). One unit of β-galactosidase activity produced 1 nmol of o-nitrophenol per min. β-Galactosidase activity was always corrected for endogenous β-galactosidase activity present in B. subtilis 168 cells containing the promoterless lacZ gene from pSFL6 or pSFL7 integrated at the amyE site.

Oligonucleotide mutagenesis.

Plasmid pNRG406 contains the EcoRI-HindIII nrgAB promoter fragment from pNRG401 cloned into the oligonucleotide mutagenesis vector pALTER-1 (Promega Corp.). The EcoRI-HindIII gabP promoter fragment from pNRG704 was inserted into pALTER-1 to give plasmid pNRG710 (7). Oligonucleotide mutagenesis of pNRG406 and pNRG710 was conducted by using a protocol designed by the supplier of pALTER-1 (Promega Corp.). EcoRI-HindIII DNA fragments of the mutated promoters were cloned into pSFL6 for functional analysis.

Overexpression of TnrA.

Plasmid pTNR14 was constructed by cloning the BsaJI-AseI DNA fragment from pJVK75 (14) containing the tnrA coding sequence into the EcoRV site of pBluescriptSK− (Stratagene). The EcoRI-HindIII tnrA DNA fragment from pTNR14 was cloned into pET23+ (Novagen, Inc.) to give plasmid pTNR16. E. coli BL21(DE3) containing pTNR16 was grown in Luria-Bertani broth at 30°C to mid-log phase, where the expression of TnrA was induced by the addition of isopropyl-β-d-thiogalactopyranoside to 0.4 mM. Cells were harvested by centrifugation 3 h after induction, washed with TKE buffer (50 mM Tris [pH 7.5], 50 mM KCl, 1 mM EDTA), and stored frozen at −70°C. To prepare extracts, the frozen cells were thawed and resuspended in TKE buffer containing 1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, and 10% glycerol. Cells were lysed by sonication, and a clarified extract was obtained by centrifugation at 16,000 × g for 15 min. Aliquots of the supernatant were frozen with liquid nitrogen and stored at −70°C. The same procedure with BL21(DE3) cells containing plasmid pET23+ was used to prepare an E. coli extract lacking TnrA.

Gel mobility shift DNA-binding assays.

The DNA probe for DNA-binding assays was the 164-bp EcoRI-HindIII fragment from pNRG401 (containing the wild-type nrgAB promoter) or pNRG406G42 (containing the nrgAB promoter −42G mutation). The gel-purified DNA fragments were end labeled by filling in the sticky ends with the Klenow fragment of DNA polymerase I in the presence of [α-32P]dATP. The binding reaction volume of 20 μl contained 0.1 nM DNA probe, 50 mM HEPES (pH 7.5), 50 mM sodium acetate, 1 mM dithiothreitol, 1 mM EDTA, 100 ng of poly(dI-dC) · poly(dI-dC), 100 μg of bovine serum albumin per ml, 0.025% Triton X-100, 5% glycerol, and the indicated amount of protein from the TnrA overexpression extract. The binding reaction mixtures were incubated at 30°C for 20 min and loaded onto an 8% polyacrylamide gel (50 mM Tris [pH 8.9], 50 mM glycine, 1 mM EDTA). The gel was subjected to electrophoresis at 110 V for 2.5 h and dried, and bands were visualized by autoradiography.

RESULTS

Mutational analysis of the nrgAB inverted repeat.

β-Galactosidase expression from the single-copy chromosomal (nrgA-lacZ)416 transcriptional fusion increases over 2,000-fold during nitrogen-restricted growth (Table 1). In the presence of excess nitrogen, only background levels of β-galactosidase expression occur. Nutritional regulation of nrgAB expression requires only the tnrA gene product (38). A large inverted repeat is located upstream of the nrgAB promoter between positions −59 and −39 (Table 1). Embedded within this upstream inverted repeat is the dyad symmetry element (TGTNAN7TNACA) found upstream of other TnrA-regulated promoters (Fig. 1). The symmetric half-sites of these TnrA sites are interrupted by a 7-bp A+T-rich sequence. In addition, a 5- to 6-bp A+T-rich nucleotide tract lies upstream of these sites.

TABLE 1.

Mutational analysis of the inverted repeat sequence upstream of the nrgAB promoter

lacZ fusion DNA sequencea β-Galactosidase sp act (U/mg of protein) in cells grown onb:
Excess nitrogen Limiting nitrogen
     TGT-A ------- T-ACA
NRG416 ACCA TGTCA GGAAATC TTACA TGAA 0.05 121
NRG416-57A .... A.... ....... ..... .... 0.06 93
NRG416-57C .... C.... ....... ..... .... 0.06 104
NRG416-57G .... G.... ....... ..... .... 0.08 78
NRG416-41C .... ..... ....... ....C .... 0.09 100
NRG431 .... G.... ....... ....C .... 0.11 75
NRG416-56A .... .A... ....... ..... .... 0.13 42
NRG416-42A .... ..... ....... ...A. .... 0.22 1.2
NRG416-42G .... ..... ....... ...G. .... 0.19 3.1
NRG416-42T .... ..... ....... ...T. .... 0.09 14
NRG432 .... .A... ....... ...T. .... 0.13 0.36
NRG416-55A .... ..A.. ....... ..... .... 0.06 132
NRG416-55C .... ..C.. ....... ..... .... 0.12 82
NRG416-55G .... ..G.. ....... ..... .... 0.09 130
NRG416-43C .... ..... ....... ..C.. .... 0.06 126
NRG433 .... ..G.. ....... ..C.. .... 0.10 130
NRG416-53G .... ....G ....... ..... .... 0.09 98
NRG416-53T .... ....T ....... ..... .... 0.12 82
NRG416-53C .... ....C ....... ..... .... 0.08 109
NRG416-45G .... ..... ....... G.... .... 0.09 114
NRG435 .... ....C ....... G.... .... 0.10 13
NRG416-60T .T.. ..... ....... ..... .... 0.08 89
NRG416-52A .... ..... A...... ..... .... 0.02 93
NRG416-52T .... ..... T...... ..... .... 0.03 95
NRG416-44A .... ..... ....... .A... .... 0.03 100
NRG416-44G .... ..... ....... .G... .... 0.04 111
NRG416-40A .... ..... ....... ..... A... 0.27 160
NRG416-40C .... ..... ....... ..... C... 0.07 116
NRG416-40G .... ..... ....... ..... G... 0.31 148
NRG416-39T .... ..... ....... ..... .T.. 0.06 83
a

The nrgAB nucleotide sequence extending from −61 to −37 is shown. The complete upstream nrgAB inverted repeat is underlined. The TnrA-binding-site consensus sequence is aligned above the sequence. The nucleotide substitutions in the nrgAB mutant derivatives are indicated. 

b

Cells containing the various nrgA-lacZ fusions were grown with either excess nitrogen (glutamate plus ammonium) or limiting nitrogen (glutamate) and harvested during exponential growth phase. Each value is the average of two or more determinations. The standard error did not exceed 15% for any of the values. 

To analyze the importance of various nucleotides within the nrgAB TnrA site to the expression of nrgAB, mutations in the inverted repeat were generated by oligonucleotide-directed mutagenesis, the mutant nrgAB promoter regions were transcriptionally fused with lacZ, and β-galactosidase expression from the mutant fusions was examined in cells grown with excess nitrogen (ammonium plus glutamate) and limited nitrogen (glutamate). Both single and double symmetric mutations were introduced into the conserved nucleotides of both half-sites in the TnrA site. Single or double nucleotide replacements within the TnrA site either at the corresponding positions −57 and −41 (NRG416-57A, NRG416-57C, NRG416-57G, NRG416-41C, and NRG431) or at positions −55 and −43 (NRG416-55A, NRG416-55C, NRG416-55G, NRG416-43C, and NRG433) had little or no effect on nitrogen regulation of nrgAB expression (Table 1). Single nucleotide substitutions at positions −53 and −45 (NRG416-53G, NRG416-53T, NRG416-53C, and NRG416-45G) did not significantly alter nrgAB nitrogen regulation, although a double symmetric mutation at these positions (NRG435) reduced the level of nrgAB activation during nitrogen limitation ninefold (Table 1). Mutations at positions −56 and −42 had the most dramatic effect on nrgAB regulation. Single nucleotide substitutions at these positions reduced the level of nrgAB activation during nitrogen-limited growth 3- to 100-fold (NRG416-56A, NRG416-42A, NRG416-42G, and NRG416-42T) (Table 1). No nitrogen regulation of nrgAB expression was seen when the nucleotides at positions −56 and −42 (NRG432) were both mutated (Table 1). Nucleotide substitutions at other positions within the large inverted repeat, but not located within the conserved nucleotides of the TnrA consensus sequence, had little or no effect on nitrogen regulation of nrgAB expression (NRG416-60T, NRG416-52T, NRG416-52A, NRG416-44A, NRG416-44G, NRG416-40A, NRG416-40C, NRG416-40G, and NRG416-39T) (Table 1).

To determine whether the A+T-rich spacer region between the two half-sites of the TnrA site is important for nitrogen regulation, the AAAT sequence between positions −47 and −50 was replaced with the sequence GGCC (NRG443). These nucleotide substitutions reduced the level of nrgAB activation during nitrogen restriction 20-fold (Table 2).

TABLE 2.

Mutational analysis of the nrgAB promoter region

lacZ fusion DNA sequencea β-Galactosidase sp act (U/mg of protein) in cells grown onb:
Mutational alterationc
Excess nitrogen Limiting nitrogen
              TGT-A-------T-ACA      −35 
NRG416 TTTCTCAAAAACCATGTCAGGAAATCTTACATGAAAATGTTT 0.05 121 Wild type (−49 position)
NRG441 ATTTCTCAAAAACCATGTCAGGAATCTTACATGAAAATGTTT 0.07 0.73 Δ of 1 central bp
NRG442 TTCTCAAAAACCATGTCAGGAAAATCTTACATGAAAATGTTT 0.15 0.40 Ω of 1 central bp
NRG443 TTTCTCAAAAACCATGTCAGGGGCCCTTACATGAAAATGTTT 0.05 5.9 Central A/T to G/C
NRG444 ATTTCTCAAAAACCATGTCAGGAAATCTTACATGAAATGTTT 0.02 0.36 −48 position
NRG445 TTCTCAAAAACCATGTCAGGAAATCTTACATGAAAAATGTTT 0.13 118 −50 position
NRG446 TTCTCAAAAACCATGTCAGGAAATCTTACATGAATAATGTTT 0.42 122 −50 position
NRG447 TCTCAAAAACCATGTCAGGAAATCTTACATGAAATAATGTTT 0.07 63 −51 position
NRG448 TCTCAAAAACCATGTCAGGAAATCTTACATGAAACAATGTTT 0.05 53 −51 position
NRG449 CTCAAAAACCATGTCAGGAAATCTTACATGAAATAAATGTTT 0.07 0.27 −52 position
NRG450 CTCAAAAACCATGTCAGGAAATCTTACATGAAACAAATGTTT 0.07 0.18 −52 position
NRG467          CCCGGGGTCAGGAAATCTTACATGAAAATGTTT 0.04 6.6 Δ to −57
NRG468         CCCGGGTGTCAGGAAATCTTACATGAAAATGTTT 0.01 9.4 Δ to −58
NRG469        CCCGGGATGTCAGGAAATCTTACATGAAAATGTTT 0.02 10 Δ to −59
NRG470       CCCGGGCATGTCAGGAAATCTTACATGAAAATGTTT 0.02 10 Δ to −60
NRG471      CCCGGGCCATGTCAGGAAATCTTACATGAAAATGTTT 0.02 11 Δ to −61
NRG473    CCCGGGAACCATGTCAGGAAATCTTACATGAAAATGTTT 0.06 25 Δ to −63
NRG475  CCCGGGAAAACCATGTCAGGAAATCTTACATGAAAATGTTT 0.04 59 Δ to −65
NRG477 CCGGGCAAAAACCATGTCAGGAAATCTTACATGAAAATGTTT 0.04 115 Δ to −67
a

The nrgAB nucleotide sequence extending from −71 to −30 is shown. The complete upstream nrgAB inverted repeat is underlined. The TnrA-binding-site consensus sequence is aligned above the sequence. The −35 region of the nrgAB promoter is overlined. 

b

Cells containing the various nrgA-lacZ fusions were grown with either excess nitrogen (glutamate plus ammonium) or limiting nitrogen (glutamate) and harvested during exponential growth phase. Each value is the average of two or more determinations. The standard error did not exceed 15% for any of the values. 

c

Deletions (Δ), insertions (Ω), nucleotide substitutions, and position of the TnrA site relative to the transcriptional start site. 

Effect of spacing mutations on nrgAB expression.

The distance between the two half-sites of the TnrA inverted repeat was altered to determine whether this spacing is important for nrgAB regulation. Nitrogen regulation of nrgAB expression was almost completely eliminated by either the deletion of a single A nucleotide at position −48 (NRG441) or the insertion of a single A nucleotide at position −48 (NRG442) within the central region of the TnrA site (Table 2).

The TnrA sites upstream of the nrgAB, gabP P2, and nas promoters are all centered 49 to 51 bp upstream of their transcriptional start sites. If the TnrA inverted repeat functions as the binding site for a positive regulatory protein, then the relative spatial orientation of this site and −35 region of the promoter should be critical for productive interactions between the TnrA protein and RNA polymerase. To examine this hypothesis, small deletion and insertion mutations between the TnrA site and the nrgAB promoter −35 region were generated. Deletion of a single A nucleotide at position −38 (NRG444) causes the inverted repeat to be centered at −48 and reduces the level of nrgAB regulation over 400-fold (Table 2). Increasing the spacing between the TnrA site and the transcriptional start site by insertion of a single nucleotide at position −38 had no effect on nrgAB regulation (NRG445 and NRG446) (Table 2). A twofold reduction in the level of nrgAB activation occurred when the TnrA site was centered 51 bp upstream of the nrgAB transcriptional start site due to the insertion of two nucleotides at position −38 (NRG447 and NRG448) (Table 2). When the TnrA site was centered 52 bp upstream of the nrgAB transcriptional site (NRG449 and NRG450), nitrogen regulation of nrgAB expression was abolished (Table 2).

Deletion analysis of the nrgAB promoter region.

A 5- to 6-bp A+T-rich sequence is located upstream of the TnrA sites in the nas, gabP P2, and nrgAB promoters (Fig. 1). Deletion analysis of the gabP P2 promoter indicated that this upstream sequence is required for high-level gabP P2 transcription in nitrogen-restricted cultures (7). To determine whether the tract of five A nucleotides located between −61 and −65 in the nrgAB promoter region is required for high-level nrgAB expression during nitrogen-limited growth, various truncated versions of the nrgAB regulatory region were constructed. In these constructs, increasing amounts of the sequence upstream of the nrgAB TnrA site were deleted and replaced with the sequence CCCGGG. Deletion to position −67 (NRG477) leaves the upstream A sequence intact and has no effect on nrgAB regulation (Table 2). In contrast, deletions to −65 (NRG475) and −63 (NRG474) remove a portion of the A tract and reduce the level of nrgAB activation two- and fivefold, respectively (Table 2). The remaining deletions (NRG467, NRG468, NRG469, NRG470, and NRG471) all completely remove the upstream A tract and cause a 12- to 20-fold reduction in the level of nrgAB activation (Table 2). These results indicate that the A tract upstream of the TnrA site is required for optimal nrgAB expression during nitrogen-limited growth.

Gel mobility shift DNA-binding assays.

To determine if the nrgAB promoter is the direct target of the TnrA protein, crude protein extracts from an E. coli strain engineered to overproduce TnrA were used to conduct gel mobility shift DNA-binding experiments with DNA fragments containing either the wild-type or mutated TnrA site of the nrgAB promoter. While DNA containing the wild-type nrgAB promoter had reduced mobility in the presence of the TnrA overexpression extract (Fig. 2), no retardation was observed with an extract that lacked TnrA (data not shown). The DNA fragment containing a C-to-G mutation at −42 (NRG416-42G) exhibited no significant binding even in the presence of 5 μg of the TnrA extract (Fig. 2). Since binding of TnrA to the wild-type nrgAB promoter fragment could be observed with 8 ng of extract, these results indicate that TnrA has at least a 625-fold-higher affinity for the wild-type TnrA site than the mutated site. The binding of TnrA to the wild-type nrgAB DNA fragment was not altered in the presence of either 5 mM glutamine, 5 mM glutamate, or 5 mM NH4Cl (data not shown). This result suggests that these compounds are unlikely to function as a nitrogen signal that regulates the DNA-binding activity of TnrA.

FIG. 2.

FIG. 2

Retardation analysis of wild-type and mutant nrgAB promoter regions by TnrA. A 164-bp nrgAB promoter DNA fragment containing the B. subtilis wild-type TnrA-binding site (lanes 1 to 6) and the mutant TnrA-binding site from NRG416-42G (lanes 7 to 12) was used in the binding reactions. Total amounts of protein from TnrA overexpression extracts present in the reaction mixtures: lanes 1 and 7, 0 μg; lanes 2 and 8, 8 ng; lanes 3 and 9, 40 ng; lanes 4 and 10, 200 ng; lanes 5 and 11, 1.0 μg; lanes 6 and 12, 5.0 μg.

Mutational analysis of the gabP P2 upstream inverted repeat.

High-level expression of gabP during nitrogen restriction primarily results from TnrA-dependent activation of transcription from the gabP P2 promoter (7). To demonstrate that the putative TnrA site in the gabP P2 region is required for TnrA regulation of gabP expression, single and double symmetric mutations were introduced into conserved nucleotides in both half-sites of the gabP P2 TnrA site. Expression of the wild-type gabP P2 promoter (NRG706) increases 13-fold during nitrogen-limited growth (Table 3). A single nucleotide replacement at position −58 (NRG715) reduces nitrogen regulation of the gabP P2 promoter twofold, while no nitrogen regulation is observed when a T is introduced into position −44 (NRG732 and NRG733) (Table 3). Single nucleotide substitutions at positions −55 (NRG735) and −45 (NRG714) reduced the level of gabP P2 activation during nitrogen limitation 6.5- and 3-fold, respectively (Table 3). A double symmetrical mutation at these positions (NRG731) abolished nitrogen regulation (Table 3).

TABLE 3.

Mutational analysis of the gabP P2 regulatory region

lacZ fusion DNA sequencea β-Galactosidase sp act (U/mg of protein) in cells grown onb:
Excess nitrogen Limiting nitrogen
     TGT-A ------- T-ACA
NRG706 AAGC TGGTA TATTTTC TTACA CGAA 0.56 7.1
NRG715 .... .A... ....... ..... .... 0.75 4.7
NRG732 .... ..... ....... ...T. .... 0.51 0.29
NRG733 .... .A... ....... ...T. .... 0.67 0.24
NRG735 .... ....C ....... ..... .... 0.40 0.98
NRG714 .... ..... ....... G.... .... 0.43 1.7
NRG731 .... ....C ....... G.... .... 0.28 0.16
a

The gabP P2 nucleotide sequence extending from −63 to −39 is shown. The TnrA-binding-site consensus sequence is aligned above the sequence. Nucleotide substitutions in the gabP mutant derivatives are indicated. 

b

Cells containing the various gabP-lacZ fusions were grown with either excess nitrogen (glutamate plus ammonium) or limiting nitrogen (glutamate) and harvested during exponential growth phase. Each value is the average of two or more determinations. The standard error did not exceed 15% for any of the values. 

Expression of the nrgAB-lacZ fusion in a ptsl mutant strain.

During a search for gene products that regulate nrgAB expression, we isolated a Tn10 transposon insertion mutant, SF15W, which was unable to activate the expression of the nrgAB-lacZ fusion during nitrogen-limited growth with glucose as the carbon source. Cloning and sequencing experiments revealed that the transposon insertion occurred in the 65th codon of the ptsl gene that encodes the enzyme I component of the phosphoenolpyruvate:carbohydrate phosphotransferase transport system (PTS) (10). Since enzyme I is required for the PTS-dependent phosphorylation and transport of PTS sugars across the membrane, ptsl mutants are completely deficient in the PTS-mediated transport of glucose (24). As expected, the ptsl15::Tn10 mutant cultures grow slowly in glucose minimal medium containing excess nitrogen (glutamate plus ammonium) compared to wild-type cultures (Table 4). The residual growth of the ptsl mutant in the glucose minimal medium presumably results from PTS-independent transport of glucose (27).

TABLE 4.

β-Galactosidase levels in extracts of wild-type and pstI mutant strains grown in various media

Growth conditionsa SF416 (wild type)
SF416P (ptsI::Tn917)
β-Galactosidase sp actb (U/mg of protein) Doubling time (min) β-Galactosidase sp act (U/mg of protein) Doubling time (min)
Glucose + glutamine 0.03 40 NDc ND
Glucose + glutamate + N 0.08 56 0.06 150
Glucose + glutamate 143 116 0.14 120
Malate + glutamate + N 0.12 114 0.13 105
Malate + glutamate 159 140 136 170
Citrate + glutamine 0.04 125 ND  ND
a

Cultures were grown in minimal medium containing the indicated carbon and nitrogen sources. N, ammonium chloride. 

b

Enzyme activity was determined in extracts of cells harvested during exponential growth. Each value is the average of three or more determinations which did not vary by more than 25%. 

c

ND, not determined. 

While wild-type and ptsl mutant cultures had similar doubling times in minimal medium containing glucose and glutamate as the carbon and nitrogen sources, nrgAB expression was activated in the wild-type strain but not in the ptsl mutant (Table 4). This finding suggests that nitrogen does not limit growth of the ptsl mutant in this medium. When wild-type and ptsl mutant cells were grown in minimal medium containing malate, a carbon compound that is not transported by the PTS system, nrgAB was expressed at high levels in both strains when glutamate was used as the nitrogen source (Table 4). This observation indicates that the ptsl mutation prevents the activation of nrgAB expression only when cells are grown on a PTS-dependent carbon source.

Expression of the nrgAB-lacZ fusion in nutrient broth sporulation medium.

Wang et al. (36) have reported that expression of the TnrA-regulated operon encoding Kipl is induced by glucose when cells are grown in NSM. To determine if this mode of regulation is also exhibited by other TnrA-regulated genes, nrgAB expression was examined by determining β-galactosidase levels from strain SF407 [(nrgA-lacZ)407] harvested at various times during growth in NSM. No expression of nrgAB was observed in wild-type cells during exponential- or early stationary-phase growth in NSM (Fig. 3). In contrast, when the NSM contained 1% glucose, the culture grew to a higher cell density and nrgAB expression increased 25-fold during late exponential-phase growth (Fig. 3). No activation of nrgAB expression is observed when glutamine, one of the best nitrogen sources for B. subtilis, is added to NSM cultures containing glucose (data not shown). Expression of the (nrgA-lacZ)407 lacZ fusion could not be detected in a tnrA mutant strain grown in NSM containing 1% glucose (Fig. 3). This result indicates that the activation of nrgAB expression in NSM containing 1% glucose requires the TnrA protein.

FIG. 3.

FIG. 3

Growth and β-galactosidase expression from the (nrgA-lacZ)407 fusion in wild-type and tnrA cells during growth in either NSM or NSM containing 1% glucose. Samples were removed periodically, and β-galactosidase activity was assayed in cell extracts. Data from a typical experiment are shown. Triangles, SF407 [(nrgA-lacZ)407] cells grown in NSM plus glucose; squares, SF407T [(nrgA-lacZ)407 tnrA62] cells grown in NSM plus glucose; circles, SF407 [(nrgA-lacZ)407] cells grown in NSM. Open symbols, Klett units; closed symbols, β-galactosidase specific activity.

While B. subtilis is able to sporulate when grown in NSM, sporulation is inhibited when cells are grown in NSM containing glucose (30). Although wild-type and tnrA mutant strains sporulate with similar frequencies in NSM-grown cultures (38), the observation that the expression of TnrA-regulated genes is activated in NSM containing glucose raised the possibility that glucose repression of sporulation could be mediated by a TnrA-regulated gene. This hypothesis seems unlikely because the tnrA mutation did not relieve the glucose repression of sporulation in NSM containing 1% glucose (data not shown).

DISCUSSION

Several lines of evidence indicate that TnrA-dependent activation of the nrgAB, nasA, nasBC, and gabP genes requires the common palindromic sequence located upstream of their promoters. Mutational analysis has shown that conserved nucleotides within this sequence are required for high-level expression of the nrgAB, gabP P2, and nas promoters during nitrogen-limited growth. Nucleotide replacements at two of the four conserved positions in the nrgAB half-sites reduced the level of nrgAB activation during nitrogen-limited growth. Mutations at the corresponding positions in the TnrA sites for the gabP P2 and nas promoters also abolish nitrogen regulation (22). Interestingly, single mutations at the innermost conserved nucleotide in the TnrA half-sites for the nas and gabP P2 promoters reduced transcriptional activation, while double symmetric mutations at these positions were required to inhibit nitrogen regulation of nrgAB expression. One explanation for this result is that a transcriptional activation assay was used to examine the in vivo effect of TnrA site mutations. Since transcriptional activation involves two TnrA-dependent steps, DNA binding and stimulation of RNA polymerase, mutations in an optimal TnrA site which only partially reduces TnrA binding may still be capable of activating transcription to wild-type levels. Thus, if the nrgAB TnrA site is an optimal site (compared to the nas and gabP P2 TnrA sites), then only those mutations in the nrgAB TnrA site with a significantly lower affinity for TnrA may reduce the level of nrgAB activation observed in vivo. In this regard, it is worth noting that Morett et al. (21) identified mutations in the NifA-binding site of the nifH promoter that have reduced affinity for NifA but are still capable of activating nifH expression.

A gel mobility shift DNA-binding assay was used to show that the TnrA protein in crude protein extracts has a 625-fold-higher affinity for the wild-type TnrA site than for a mutant TnrA site with a C-to-G mutation at position −42. The reduced in vitro affinity of the TnrA protein for the mutant TnrA site correlates well with the low level of nrgAB activation by this mutant site in vivo. The twofold symmetry of the TnrA site suggests that TnrA most likely binds to this site as a dimeric protein. Since the DNA sequence between the two TnrA half-sites (TGTNA and TNACA) is always 7 bp, this spacing must position the two half-sites into the alignment required for recognition by TnrA. Indeed, mutations which increase or reduce the spacing between the half-sites by a single nucleotide abolished the activation of nrgAB expression. Although this 7-bp central sequence is A+T rich, there is no conserved nucleotide sequence between the TnrA half-sites of the nrgAB, gabP P2, or nas promoters. Since replacement of the A+T-rich central base pairs in the nrgAB TnrA site with a G+C-rich sequence reduced the level of nrgAB activation, this A+T-rich central sequence appears to enhance TnrA binding in vivo. Similar results have been observed for the 434 repressor, which binds to an operator with an A+T-rich central sequence (15). In this case, because there is no evidence for direct interaction between the central nucleotides and the 434 repressor protein, the A+T-rich central base pairs most likely increase the affinity of the 434 repressor for its binding site by influencing DNA conformation.

Deletion analysis showed that an upstream A+T-rich sequence is required for optimal expression of the nrgAB and gabP P2 promoters during nitrogen-limited growth. Similar A+T-rich sequences adjacent to the binding sites for the catabolite gene activator and Lex proteins have been shown to increase affinity for these sites by promoting protein-induced DNA bending (9, 16). It is possible that the A+T-rich sequences upstream of the nrgAB and gabP P2 promoters play a similar role in TnrA activation of the transcription from these promoters. An alternative explanation is that maximal nrgAB transcription requires both TnrA binding and an interaction between the alpha subunit of RNA polymerase and the A+T-rich sequences located upstream of the nrgAB promoter (29).

TnrA belongs to the MerR family of DNA-binding positive regulatory proteins which includes MerR, SoxR, TipAL, and BmrR (1, 11, 12, 20). These four proteins activate transcription by binding to inverted repeats located between the −35 and −10 regions of promoters that have suboptimal 19-bp (rather than 17-bp) spacing between the −35 and −10 regions. It has been shown in vitro that binding of the MerR protein to the mer PT promoter causes an alteration of the DNA structure located between the −35 and −10 promoter regions (26). This resulting distortion of the DNA reorients the conserved promoter regions to optimal spatial positions that facilitate RNA polymerase binding (2). A number of observations indicate that TnrA utilizes a different mechanism for transcriptional activation than does MerR. First, unlike the MerR DNA-binding site, the TnrA sites of the nrgAB, nasA, nasBC, and gabP P2 promoters are all located upstream of the −35 region for these promoters. Second, the observation that high-level activation of the nrgAB expression occurs only when the TnrA site is centered 49 to 51 bp upstream of the transcriptional start site argues that the relative alignment of the TnrA site and the −35 region of the nrgAB promoter is critical for transcriptional activation. Finally, the nucleotide sequence of the −35 and −10 regions of the mer PT promoter are highly similar to the consensus sequences for these regions. In contrast, the promoters for TnrA-regulated genes generally contain multiple mismatches within the −35 and −10 consensus sequences for promoters transcribed by the ςA form of RNA polymerase. Taken together, these observations suggest that TnrA activates transcription by directly interacting with and facilitating the binding of RNA polymerase to the promoter region.

The ptsl mutant strain is able to activate nrgAB expression during nitrogen-limited growth on malate, a carbon source that is not transported by the PTS. This result indicates that the PTS is not required for the activation of nrgAB expression and suggests that the ptsl mutation indirectly affects nrgAB expression in glucose-grown cultures. Because growth of the ptsl mutant is carbon limited in glucose minimal medium, depletion of intracellular nitrogen pools may not occur when the ptsl mutant is grown in glucose minimal medium containing glutamate as the nitrogen source. This hypothesis would explain why no activation of nrgAB expression is observed in the ptsl mutant grown on this medium.

Examination of the β-galactosidase expression from the nrgAB-lacZ fusion showed that nrgAB expression is activated by TnrA in cultures grown in NSM containing glucose but not in NSM cultures grown in the absence of glucose. Since nrgAB is expressed at similar levels in minimal media with glutamine as the nitrogen source and either glucose or citrate as the carbon source (Table 4), nrgAB expression is not regulated in response to carbon availability. Thus, it seems unlikely that glucose directly induces nrgAB expression in cultures grown in NSM containing glucose. Because the glucose-grown NSM cultures reach a higher final cell density than NSM cultures, the simplest explanation for the activation of nrgAB expression in NSM containing glucose is that the increased cell growth depletes the nitrogen compounds from the growth medium and that this results in nitrogen-limited growth and the activation of nrgAB expression. This hypothesis is supported by the observations that the activation of nrgAB expression in NSM containing glucose requires TnrA and that this activation is abolished by the addition of glutamine to this growth medium.

ACKNOWLEDGMENTS

We thank Vesa Kontinen for providing plasmid pJVK75 and Dave Lemos, James Park, and Kelly Rohrer for providing technical assistance.

This study was supported by NSF grant MCB 9408094.

REFERENCES

  • 1.Ahmed M, Borsch C M, Taylor S S, Vázquez-Laslop N, Neyfakh A A. A protein that activates expression of a multidrug efflux transporter upon binding the transporter substrates. J Biol Chem. 1994;269:28506–28513. [PubMed] [Google Scholar]
  • 2.Ansari A Z, Chael M L, O’Halloran T V. Allosteric underwinding of DNA is a critical step in positive control of transcription by Hg-MerR. Nature. 1992;355:87–89. doi: 10.1038/355087a0. [DOI] [PubMed] [Google Scholar]
  • 3.Atkinson M R, Fisher S H. Identification of genes and gene products whose expression is activated during nitrogen-limited growth in Bacillus subtilis. J Bacteriol. 1991;173:23–27. doi: 10.1128/jb.173.1.23-27.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Atkinson M R, Wray L V, Jr, Fisher S H. Regulation of histidine and proline degradation enzymes by amino acid availability in Bacillus subtilis. J Bacteriol. 1990;172:4758–4765. doi: 10.1128/jb.172.9.4758-4765.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Brown S W, Sonenshein A L. Autogenous regulation of the Bacillus subtilis glnRA operon. J Bacteriol. 1996;178:2450–2454. doi: 10.1128/jb.178.8.2450-2454.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chambers S P, Prior S E, Barstow D A, Minton N P. The pMTL nic− cloning vectors. I. Improved pUC polylinker regions to facilitate the use of sonicated DNA for nucleotide sequencing. Gene. 1988;68:139–149. doi: 10.1016/0378-1119(88)90606-3. [DOI] [PubMed] [Google Scholar]
  • 7.Ferson A E, Wray L V, Jr, Fisher S H. Expression of the Bacillus subtilis gabP gene is regulated independently in response to nitrogen and amino acid availability. Mol Microbiol. 1996;22:693–701. doi: 10.1046/j.1365-2958.1996.d01-1720.x. [DOI] [PubMed] [Google Scholar]
  • 8.Fisher S H, Sonenshein A L. Bacillus subtilis glutamine synthetase mutants pleiotropically altered in glucose catabolite repression. J Bacteriol. 1984;157:612–621. doi: 10.1128/jb.157.2.612-621.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Gartenberg M R, Crothers D M. DNA sequence determinants of CAP-induced bending and protein binding affinity. Nature. 1988;333:824–829. doi: 10.1038/333824a0. [DOI] [PubMed] [Google Scholar]
  • 10.Gonzy-Tréboul G, Zagorec M, Rain-Guion M C, Steinmetz M. Phosphoenolpyruvate:sugar phosphotransferase system of Bacillus subtilis: nucleotide sequence of ptsX, ptsH and the 5′-end of ptsl and evidence for a ptsHI operon. Mol Microbiol. 1989;3:103–112. doi: 10.1111/j.1365-2958.1989.tb00109.x. [DOI] [PubMed] [Google Scholar]
  • 11.Hidalgo E, Demple B. An iron-sulfur center essential for transcriptional activation by the redox-sensing SoxR protein. EMBO J. 1994;13:138–146. doi: 10.1002/j.1460-2075.1994.tb06243.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Holmes D J, Caso J L, Thompson C J. Autogenous transcriptional activation of a thiostrepton-induced gene in Streptomyces lividans. EMBO J. 1993;12:3183–3191. doi: 10.1002/j.1460-2075.1993.tb05987.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ikeda T P, Shauger A E, Kustu S. Salmonella typhimurium apparently perceives external nitrogen limitation as internal glutamine limitation. J Mol Biol. 1996;259:589–607. doi: 10.1006/jmbi.1996.0342. [DOI] [PubMed] [Google Scholar]
  • 14.Kontinen V P, Helander I M, Tokuda H. The secG deletion mutation of Escherichia coli is suppressed by expression of a novel regulatory gene of Bacillus subtilis. FEBS Lett. 1996;389:281–284. doi: 10.1016/0014-5793(96)00602-3. [DOI] [PubMed] [Google Scholar]
  • 15.Koudelka G B, Harrison S C, Ptashne M. Effect of non-contacted bases on the affinity of 434 operator for 434 repressor and Cro. Nature. 1987;326:886–888. doi: 10.1038/326886a0. [DOI] [PubMed] [Google Scholar]
  • 16.Lloubès R, Lazdunski C, Granger-Schnarr M, Schnarr M. DNA sequence determinants of LexA-induced DNA bending. Nucleic Acids Res. 1993;21:2363–2367. doi: 10.1093/nar/21.10.2363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lopilato J, Bortner S, Beckwith J. Mutations in a new chromosomal gene of Escherichia coli K-12, pcnB, reduce plasmid copy number of pBR322 and its derivatives. Mol Gen Genet. 1986;205:285–290. doi: 10.1007/BF00430440. [DOI] [PubMed] [Google Scholar]
  • 18.Magasanik B. Regulation of nitrogen utilization. In: Neidhardt F C, Curtiss III R, Ingraham J L, Lin E C C, Low K B, Magasanik B, Reznikoff W S, Riley M, Schaechter M, Umbarger H E, editors. Escherichia coli and Salmonella: cellular and molecular biology. 2nd ed. Washington, D.C: American Society for Microbiology; 1996. pp. 1344–1356. [Google Scholar]
  • 19.Merrick M J, Edwards R A. Nitrogen control in bacteria. Microbiol Rev. 1995;59:604–622. doi: 10.1128/mr.59.4.604-622.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Misra T K, Brown N L, Fritzinger D C, Pridmore R D, Barnes W M, Haberstroh L, Silver S. Mercuric ion-resistance operon of plasmid R100 and transposon Tn501: the beginning of the operon including the regulatory region and the first two structural genes. Proc Natl Acad Sci USA. 1984;81:5975–5979. doi: 10.1073/pnas.81.19.5975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Morett E, Cannon W, Buck M. The DNA-binding domain of the transcriptional activator protein NifA resides in its carboxy terminus, recognizes the upstream activator sequences of nif promoters, and can be separated from the positive control function of NifA. Nucleic Acids Res. 1988;16:11469–11488. doi: 10.1093/nar/16.24.11469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Nakano M M, Yang F, Hardin P, Zuber P. Nitrogen regulation of nasA and the nasB operon, which encode genes required for nitrate assimilation in Bacillus subtilis. J Bacteriol. 1995;177:573–579. doi: 10.1128/jb.177.3.573-579.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Neidhardt F C, Bloch P L, Smith D F. Culture medium for enterobacteria. J Bacteriol. 1974;119:736–747. doi: 10.1128/jb.119.3.736-747.1974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Niaudet B, Gay P, Dedonder R. Identification of the structural gene of the PEP-phosphotransferase enzyme I in Bacillus subtilis Marburg. Mol Gen Genet. 1975;136:337–349. doi: 10.1007/BF00341718. [DOI] [PubMed] [Google Scholar]
  • 25.Nicholson W L, Setlow P. Sporulation, germination and outgrowth. In: Harwood C R, Cutting S M, editors. Molecular biological methods for Bacillus. Chichester, England: John Wiley & Sons; 1990. pp. 391–450. [Google Scholar]
  • 26.O’Halloran T V, Frantz B, Shin M K, Ralston D M, Wright J G. The MerR heavy metal receptor mediates positive activation in a topologically novel transcription complex. Cell. 1989;56:119–129. doi: 10.1016/0092-8674(89)90990-2. [DOI] [PubMed] [Google Scholar]
  • 27.Paulsen I T, Chauvaux S, Choi P, Saier M H., Jr Characterization of glucose-specific catabolite repression-resistant mutants of Bacillus subtilis: identification of a novel hexose:H+ symporter. J Bacteriol. 1998;180:498–504. doi: 10.1128/jb.180.3.498-504.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Petit M S, Bruand C, Jannière L, Ehrlich S D. Tn10-derived transposons active in Bacillus subtilis. J Bacteriol. 1990;172:6736–6740. doi: 10.1128/jb.172.12.6736-6740.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ross W, Gosink K K, Salomon J, Igarashi K, Zou C, Ishihama A, Severinov K, Gourse R L. A third recognition element in bacterial promoters: DNA binding by the α subunit of RNA polymerase. Science. 1993;262:1407–1413. doi: 10.1126/science.8248780. [DOI] [PubMed] [Google Scholar]
  • 30.Schaeffer P, Millet J, Aubert J P. Catabolite repression of bacterial sporulation. Proc Natl Acad Sci USA. 1965;54:704–711. doi: 10.1073/pnas.54.3.704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Schreier H J. Biosynthesis of glutamine and glutamate and the assimilation of ammonia. In: Sonenshein A L, Hoch J A, Losick R, editors. Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular biology. Washington, D.C: American Society for Microbiology; 1993. pp. 281–298. [Google Scholar]
  • 32.Schreier H J, Brown S W, Hirschi K D, Nomellini J F, Sonenshein A L. Regulation of Bacillus subtilis glutamine synthetase gene expression by the product of the glnR gene. J Mol Biol. 1989;210:51–63. doi: 10.1016/0022-2836(89)90290-8. [DOI] [PubMed] [Google Scholar]
  • 33.Schreier H J, Sonenshein A L. Altered regulation of the glnA gene in glutamine synthetase mutants of Bacillus subtilis. J Bacteriol. 1986;167:35–43. doi: 10.1128/jb.167.1.35-43.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sonenshein A L, Cami B, Brevet J, Cote R. Isolation and characterization of rifampin-resistant and streptolydigin-resistant mutants of Bacillus subtilis with altered sporulation properties. J Bacteriol. 1974;120:253–265. doi: 10.1128/jb.120.1.253-265.1974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Steinmetz M, Richter R. Easy cloning of mini-Tn10 insertions from the Bacillus subtilis chromosome. J Bacteriol. 1994;176:1761–1763. doi: 10.1128/jb.176.6.1761-1763.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wang L, Grau R, Perego M, Hoch J A. A novel histidine kinase inhibitor regulation development in Bacillus subtilis. Genes Dev. 1997;11:2569–2579. doi: 10.1101/gad.11.19.2569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Wray L V, Jr, Ferson A E, Fisher S H. Expression of the Bacillus subtilis ureABC operon is controlled by multiple regulatory factors including CodY, GlnR, TnrA, and Spo0H. J Bacteriol. 1997;179:5494–5501. doi: 10.1128/jb.179.17.5494-5501.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wray L V, Jr, Ferson A E, Rohrer K, Fisher S H. TnrA, a transcription factor required for global nitrogen regulation in Bacillus subtilis. Proc Natl Acad Sci USA. 1996;93:8841–8845. doi: 10.1073/pnas.93.17.8841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wray L V, Jr, Fisher S H. The nitrogen-regulated Bacillus subtilis nrgAB operon encodes a membrane protein and a protein highly similar to the Escherichia coli glnB-encoded PII protein. J Bacteriol. 1994;176:108–114. doi: 10.1128/jb.176.1.108-114.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES