Skip to main content
NCBI home page
The Journal of Nutrition logoLink to The Journal of Nutrition
. 2023 Aug 29;153(10):2915–2928. doi: 10.1016/j.tjnut.2023.08.033

Palmitate-Induced Inflammation and Myotube Atrophy in C2C12 Cells Are Prevented by the Whey Bioactive Peptide, Glycomacropeptide

Naomi MMP de Hart 1, Jonathan J Petrocelli 2, Rebekah J Nicholson 1, Elena M Yee 2, Patrick J Ferrara 1, Eric D Bastian 3, Loren S Ward 4, Brent L Petersen 4, Scott A Summers 1, Micah J Drummond 1,2,∗
PMCID: PMC10731921  PMID: 37652286

Abstract

Background

Metabolic diseases are often associated with muscle atrophy and heightened inflammation. The whey bioactive compound, glycomacropeptide (GMP), has been shown to exhibit anti-inflammatory properties and therefore may have potential therapeutic efficacy in conditions of skeletal muscle inflammation and atrophy.

Objectives

The purpose of this study was to determine the role of GMP in preventing lipotoxicity-induced myotube atrophy and inflammation.

Methods

C2C12 myoblasts were differentiated to determine the effect of GMP on atrophy and inflammation and to explore its mechanism of action in evaluating various anabolic and catabolic cellular signaling nodes. We also used a lipidomic analysis to evaluate muscle sphingolipid accumulation with the various treatments. Palmitate (0.75 mM) in the presence and absence of GMP (5 μg/mL) was used to induce myotube atrophy and inflammation and cells were collected over a time course of 6–24 h.

Results

After 24 h of treatment, GMP prevented the palmitate-induced decrease in the myotube area and myogenic index and the increase in the TLR4-mediated inflammatory genes tumor necrosis factor-α and interleukin 1β. Moreover, phosphorylation of Erk1/2, and gene expression of myostatin, and the E3 ubiquitin ligases, FBXO32, and MuRF1 were decreased with GMP treatment. GMP did not alter palmitate-induced ceramide or diacylglycerol accumulation, muscle insulin resistance, or protein synthesis.

Conclusions

In summary, GMP prevented palmitate-induced inflammation and atrophy in C2C12 myotubes. The GMP protective mechanism of action in muscle cells during lipotoxic stress may be related to targeting catabolic signaling associated with cellular stress and proteolysis but not protein synthesis.

Keywords: whey protein, inflammation, muscle atrophy, protein breakdown, C2C12

Graphical abstract

Image 1

Open in a new tab

Introduction

Maintenance of skeletal muscle mass not only is critical for generating force and aiding movement but also plays an integral role in supporting immune function and regulating whole-body metabolism [1,2]. A lifestyle of overnutrition of fatty acids is known to induce lipotoxicity, obesity, and overall decreased muscle quality and function [[3], [4], [5]]. These muscle-specific responses are often accompanied by increased inflammation, triggered by the activation of toll-like receptor 4 (TLR4)-nuclear factor of kappa light polypeptide gene enhancer in B cells (NF-κB) signaling cascade in a broad range of tissues, including skeletal muscle cells [6,7]. Therefore, strategies focused on reducing local inflammation and improving muscle function in circumstances of lipid-induced overnutrition are needed.

Whey protein has been used in many food products and supplements to promote protein anabolism [[8], [9], [10]]In addition, for known roles in stimulating muscle-protein synthesis through the mechanistic target of rapamycin (mTOR) and because of its optimal essential amino acid profile, whey protein has also been shown to reduce circulating inflammation and improve levels of insulin resistance and glucose sensitivity in rodents and humans [[11], [12], [13], [14], [15], [16]], although the mechanism of this anti-inflammatory response remains elusive. Importantly, whey protein contains biologically active proteins and peptides that have characteristics of exhibiting anti-inflammatory, antioxidative, and anti-microbial responses. For example, lactoferrin has been shown to control the immune response in rodents after an insult or injury by reducing oxidative stress, consequently regulating excess inflammatory signaling [17]. Moreover, in cell culture, β-lactoglobulin has also been demonstrated to enhance cell proliferation and increase proinflammatory cytokine secretion to enhance immune responses [18]. Similarly, casein glycomacropeptide (GMP) has been shown to have anti-inflammatory properties but its cell-autonomous influence in skeletal muscle is not known. GMP is a 64-aminoacid-long peptide found in the casein fraction of milk proteins and makes up ∼20%–25% of the total amount of whey protein found in bovine milk [19]. GMP is obtained during the cheese-making process when it is released in the liquid whey-protein fraction by the addition of chymosin. GMP has shown clinical utility in patients with ulcerative colitis to reduce intestinal inflammation [20] while also known for increasing commensal growth and regulating the immune system both in vitro and in vivo (rodents) [[21], [22], [23]]. Interestingly, in cells in culture, GMP was shown to reduce the binding of LPS to TLR4 in macrophages (RAW264.7, macrophage cell line [24], suggesting that GMP might be similarly effective at attenuating lipid-induced inflammation in skeletal muscle because palmitate has been shown to operate through TLR4 signaling [25].

Therefore, the purpose of this study was to determine if GMP could prevent palmitate-induced skeletal muscle inflammation and myotube atrophy in vitro. We hypothesized that GMP could mitigate TLR4-mediated inflammation and prevent palmitate-induced C2C12 myotube atrophy and that this would be associated with enhanced protein synthesis and reduced proteolytic cellular pathways.

Methods

Cell culture

C2C12 myoblasts (American type culture collection (ATCC) Cat. #CRL-1772) were cultured in high-glucose Dulbecco's Modified Eagle Medium (DMEM, 4.5 g/L glucose, l-glutamine; Gibco Cat. #11965-092) with 10% fetal bovine serum (GenClone 25-550) and 1% penicillin-streptomycin (10,000 U/mL; Gibco Cat. #151401-22) in an incubator at 37°C with 5% CO2. Cells were differentiated after reaching ∼95%–100% confluence in differentiation media [low-glucose DMEM (1 g/L glucose, l-glutamine, pyruvate; Gibco Cat. #11885-084) supplemented with 2% horse serum (Gibco Cat. #160501-30) and 1% penicillin-streptomycin] for 4–5 days (Figure 1A). To determine the effects of GMP during myotube atrophy, differentiated myotubes were treated for 6, 12, or 24 h with and without 5 μg/mL GMP (provided by Glanbia Nutritionals) and/or 0.75 mM palmitate (Sigma-Aldrich Cat. #P5585) conjugated to fatty acid-free bovine serum albumin (BSA) (Sigma-Aldrich Cat. #A7030) [26]. The purity of the GMP product was assessed by Glanbia Nutritionals via ion-exchange chromatography and showed comparable purity to caseinoglycopeptide from bovine casein (Sigma-Aldrich Cat. #C7278) (80% and 80.6%, respectively). Palmitic acid was mixed with 100% ethanol, heated to dissolve, and added to 2% BSA in the low-glucose differentiation medium that was syringe-filtered through a 0.22 μm membrane prior to the addition of palmitate, after which it was placed in a shaking heat bath to dissolve properly. GMP was dissolved in filtered 2% BSA in the low-glucose differentiation medium and added to wells at a final concentration of 5 μg/mL. Control and GMP-only wells received filtered 2% BSA in the low-glucose differentiation media and an equivalent amount of ethanol as the palmitate-treated wells.

FIGURE 1.

FIGURE 1

Open in a new tab

GMP prevents C2C12 myotube atrophy. (A) Overview of the experimental design where C2C12 myoblasts were seeded and grown until ∼95%–100% confluence. Differentiation media were administered for 4–5 d, after which different treatments were given for 6, 12, or 24 h. (B) Representative images of MF20/DAPI staining at the 24-h interval; scale bar is equivalent to 500 μm. Fold-change from control (no palmitate, no GMP), for (C–E) percent myotube area and (F–H) myogenic index, at 6 h (n = 3), 12 h (n = 3), and 24 h (n = 6). One-way ANOVA with Šídák’s post hoc analysis was used to compare groups. ∗Significantly different from the control (no palmitate, no GMP) and #significantly different from the palmitate-only group. P < 0.05. DAPI, 4′,6-diamidino-2-phenylindole; GMP, glycomacropeptide.

To investigate the mechanism of action of GMP during palmitate-induced inflammation and atrophy, a TLR4 inhibitor TAK-242 (CLI-095; InvivoGen Cat. #tlrl-cli95) was used at a concentration of 1 μM [27]. The same experimental procedure and time course as above were used, substituting TAK-242 for GMP. TAK-242 was dissolved in DMSO and added to wells at a final concentration of 1 μM. Cells were pretreated with TAK-242 for 1 h before treatments with or without palmitate were given for 6, 12, and 24 h. Control wells were filled with an equivalent amount of DMSO as cells treated with TAK-242.

To examine insulin resistance following GMP and palmitate treatments, insulin from porcine pancreas (Sigma-Aldrich Cat. #I5523) was used at a concentration of 10 nM (dissolved in H2O, pH = 3). Cells were treated with or without GMP and/or palmitate for 6, 12, and 24 h as described above. Before insulin treatments, cells were deprived of horse serum by changing the medium to a serum-free, low-glucose differentiation medium. After starvation for 2 h along with treatments, cells were treated with 10 nM insulin for 10 min.

To assess protein synthesis at 24 h with a more sensitive and accurate marker than protein expression of the mTOR pathway, a puromycin (Sigma-Aldrich Cat. #540411) experiment was performed. Cells were treated with or without GMP and/or palmitate for 24 h as described above. Then, myotubes were treated with puromycin at a final concentration of 1 μM for 30 min. A control well without treatment and without puromycin was used to assess background puromycin levels.

Immunocytochemistry

We measured myotube size and myogenic index, as described previously by our group [28]. Briefly, myotubes were washed thrice with 1× phosphate-buffered saline (PBS) and then fixed with 4% paraformaldehyde for 30 min. After 3 washes with 1× PBS, myotubes were permeabilized with 0.25% Triton-X100 (in PBS) for 15 min. Permeabilized myotubes were then washed with 1× PBS and blocked with 10% horse serum (Gibco Cat. #160501-30) in 1× PBS for 30 min. Subsequently, the primary antibody myosin-4 monoclonal antibody (MF20) (Invitrogen Cat. #50-6503-82) was added at a concentration of 1:100 in 1% horse serum in 1× PBS for 1 h. Next, the myotubes were washed with 1% horse serum in 1× PBS and stained with 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen Cat. #D1306) at a concentration of 1:10,000 in 1× PBS for 5 min. After another wash with 1% horse serum and 3 washes with 1× PBS, the myotubes were left in 1× PBS. For imaging, 7 × 7 fields were captured on a fully automated widefield light microscope (Nikon Ti) operating with a high-sensitivity Andor Clara CCD camera with a 10× objective. The software ImageJ was used to determine the myotube area with a threshold of >500 μm2 to obtain the percentage of myotubes covering the image, normalized to the size of the entire image. The myogenic index was established using ImageJ software as the percentage of nuclei within myotubes divided by the total amount of nuclei, as previously described [29].

RT-qPCR

RNA was isolated from myotubes using the QIAzol lysis reagent (Qiagen Cat. #79306), as described previously [30]. Chloroform and isopropanol were used to separate and precipitate the RNA, after which the RNA was washed with 75% ethanol and resuspended in nuclease-free water. The concentration of the extracted RNA was determined using an EPOCH microplate spectrophotometer (Take3 BioTek; Agilent). One microgram of RNA was reverse-transcribed using an iScript cDNA synthesis kit (Bio-Rad Cat. #17088-91) and a T100 Thermal Cycler (Bio-Rad) with the following settings: lid 105°C, volume 20 μL, 25°C for 5 min, 46°C for 20 min, 95°C for 1min, and 4°C. RT-qPCR was performed with 1:8 diluted cDNA (in nuclease-free water) on a CFX Connect real-time PCR detection system (Bio-Rad) using the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Cat. #17252-70). All data were normalized to the ribosomal protein L32 gene: (5'→3') (Forward) TTCCTGGTCCACAATGTCAA and (Reverse) GGCTTTTCGGTTCTTAGAGGA. The following primers from Bio-Rad were used: TNF (Tnf, qMmuCED0004141), IL-6 (Il6, qMmuCED0045760), IL-1β (Ilb, qMmuCED0045755), nuclear factor of kappa light polypeptide gene enhancer in B cells 1 (NF-κB) (Nfkb1, qMmuCED0047222), F-box protein 32 (FBXO32) (Fbxo32, qMmuCED0045679), tripartite motif-containing 63 (Trim63/MuRF1, qMmuCID0014591), and myostatin (Mstn, qMmuCED0045853).

Flow cytometry with fluorescently labeled palmitate

C2C12 myoblasts (ATCC Cat. #CRL-1772) were cultivated, grown, and differentiated as described above. Following 4–5 d of differentiation, myotubes were treated for 1 h with or without 500 nM of fluorescently labeled palmitate (Palmitic Acid - Lissamine Rhodamine; Avanti Cat. #810104P) and/or 5 μg/mL GMP in filtered 2% BSA in the low-glucose differentiation medium. Representative images were taken on an EVOS FL cell imaging system (Life Technologies; ThermoFisher). After treatment, cells were washed with 1× PBS, taken off the well with trypsin, and resuspended in differentiation media (low-glucose DMEM [1 g/L glucose, l-glutamine; Gibco Cat. #11885-084] supplemented with 2% horse serum [Gibco Cat. #160501-30] and 1% penicillin-streptomycin) for flow cytometry, as previously described [24].

A BD FACSCanto II analyzer with FACSDiva 6.0 software was used to acquire and analyze the data. A forward-scatter area and side-scatter area plot was used to exclude debris and dead cells. Next, a forward-scatter width compared with forward-scatter area plot was used to exclude doublets. Finally, gated live single cells were plotted on a fluorescein isothiocyanate (FITC-A) and phycoerythrin plot. Data of 50,000 live cells were acquired and reported as the median fluorescence intensity. Unstained controls were used to determine proper gating and eliminate any background fluorescence.

Lipidomic detection and analysis

Lipid extractions

Following treatments (palmitate and/or GMP) for 6, 12, and 24 h, cells were collected and lysed in 225 μL of methanol containing a lipid internal standard, as described previously [31]. An aliquot of cell lysate was collected from each sample for protein quantification. A process blank was included in the assay, which contained equal amounts of methanol and internal standard without the cell lysate. After the addition of 750 μL of methyl tert-butyl ether, samples were incubated on ice, with brief vortexing every 15 min. After 60 min, 188 μL of PBS was added and sample tubes were incubated at room temperature for 15 min. Samples were centrifuged for 10 min at 15,000 × g and 4°C, and the organic lipid-containing top layer was transferred and completely evaporated using a miVac vacuum pump (SP Scientific). A second extraction was performed by adding 1 mL of methyl tert-butyl ether:methanol:ddH2O (10:3:2.5, v/v/v). Samples were incubated at room temperature for 30 min and centrifuged for 10 min at 15,000 × g and 4°C. The organic layer from the second extraction was combined with the first and dried completely. Aqueous fractions were also collected and dried. Organic samples were resuspended in 350-μL isopropyl alcohol:acetonitrile:ddH2O (8:2:2, v/v/v). Aqueous samples were resuspended in 350-μL methanol:ddH2O (8:2, v/v). Samples were centrifuged for 5 min at 15,000× g and 4°C, and 300 μL of supernatant was transferred to a glass vial (Agilent Cat. #5182-0554 and 5153-2086), whereas 50 μL was pooled for quality control. Samples were stored at −20°C before LC-MS/MS analysis.

Lipid standards

Sphingolipid internal standard stocks were obtained from Avanti Polar Lipids. Standards for myotubes were prepared in methanol with the following lipid species and concentrations: sphingomyelin (d18:1/16:1)-d9 (74 pmol/sample); sphingomyelin (d18:1/18:1)-d9 (47 pmol/sample); sphingomyelin (d18:1/20:1)-d9 (23 pmol/sample); sphingomyelin (d18:1/22:1) (44 pmol/sample); sphingomyelin (d18:1/24:1) (64 pmol/sample); ceramide (d18:1-d7/16:0) (367 pmol/sample); ceramide (d18:1-d7/18:0) (349 pmol/sample); ceramide (d18:1-d7/24:0) (304 pmol/sample); ceramide (d18:1-d7/24:1) (305 pmol/sample); dihydroceramide (d18:0/18:1) (2.5 pmol/sample); glucosylceramide (d18:1/17:0) (50 pmol/sample); sphingosine (d18:1-d7) (2.5 pmol/sample); sphingosine-1-phosphate-d7 (2.5 pmol/sample); sphinganine-1-phosphate-d7 (2.5 pmol/sample); triacylglycerol (15:0-18:1(d7)-15:0) (492 pmol/sample); diacylglycerol (15:0-18:1(d7)) (500 pmol/sample); and phosphatidylcholine (15:0-18:1(d7)) (500 pmol/sample).

LC-MS analysis

Lipid extracts were separated on an Acquity Ultra-performance liquid chromatography (UPLC) Charged surface hybrid (CSH) C18 column (2.1 × 100 mm; 1.7 μm) coupled to an Acquity UPLC CSH C18 VanGuard precolumn (5 × 2.1mm; 1.7 μm) (Waters) maintained at 65°C and connected to an Agilent HiP 1290 Sampler, Agilent 1290 Infinity pump, and Agilent 6490 triple quadrupole (QQQ) mass spectrometer. Sphingolipids were detected using dynamic multiple-reaction monitoring in the positive-ion mode. The temperature of the source gas was set to 175°C, with a gas (N2) flow of 15L/min and a nebulizer pressure of 30 psi. Sheath gas temperature was 250°C, sheath gas (N2) flow was 12 L/min, capillary voltage was 3500 V, nozzle voltage was 500 V, high-pressure radio frequency (RF) was 190 V, and low-pressure RF was 120 V. Injection volume was 3 μL and the samples were analyzed randomly with the pooled quality control (QC) sample injected 8 times throughout the sample queue. Mobile phase A consisted of acetonitrile:H2O (60:40 v/v) in 10-mM ammonium formate and 0.1% formic acid, whereas mobile phase B consisted of isopropanol:acetonitrile:H2O (90:9:1 v/v/v) in 10-mM ammonium formate and 0.1% formic acid. The chromatography gradient started at 15% mobile phase B, increased to 30% B over 0.7 min, 60% B from 0.7–1.4 min, 80% B from 1.4–7.0 min, and 99% B from 7.0–7.14 min, where it was maintained until 9.45 min before being returned to starting conditions at 9.8 min. The post-time was 3.5 min and the flow rate was 0.4 mL/min throughout.

LC-MS data processing

For data processing, an Agilent MassHunter Workstation and the software packages MassHunter Qualitative and MassHunter Quantitative were used. The pooled QC (n = 8) and process blank (n = 4) were injected throughout the sample queue to ensure the reliability of the acquired lipidomics data. Data exported from MassHunter Quantitative were assessed using Microsoft Excel where initial lipid targets were parsed. Only lipids with relative SDs of <30% in QC samples were used for data analysis. Additionally, only lipids with background AUC counts in process blanks that were <30% of QC were used for data analysis. The parsed Excel data tables were normalized based on the ratio to class-specific internal standards, and then to sample protein amount.

Immunoblotting

Cells from 6-well plates were collected for protein extraction to determine the protein content by immunoblotting analysis, as previously described [30]. After treatments at various intervals, the myotubes were washed and homogenized in an ice-cold protein homogenization buffer (0.1% SDS, 1% Triton-X100, 50 mM Tris-HCl pH = 7.5, 5 mM EDTA, 150 mM NaCl, and 0.1% sodium deoxycholate) with 1× protease and phosphatase inhibitor (ThermoFisher Cat. #78444). Then, the myotubes were scraped off the wells and disrupted by forceful pipetting, followed by incubation at 4°C for 10 min on a rocker. Then, the cells were collected and centrifuged at 17,500 × g for 15 min at 4°C. The supernatant was collected and used to determine the amount of protein using a Pierce BCA protein assay kit (ThermoFisher Cat. #23227) measured by an EPOCH spectrophotometer (Take3; BioTek). Proteins were separated using SDS-PAGE and transferred onto nitrocellulose membranes. Ponceau S (VWR Cat. #K793) staining was used to confirm sufficient transfer quality. Membranes were blocked in 5% BSA (Fisher Cat. #BP1605-100) tris-buffered saline (TBST) at room temperature, after which they were incubated with primary antibodies for detecting the proteins of interest in 5% BSA-TBST overnight at 4°C. The secondary antibody (CST Cat. #7074, anti-rabbit) was dissolved to a final concentration of 1:4000 in 5% BSA-TBST for 1 h at room temperature. For 4-hydroxynonenal, the secondary antibody (CST Cat. #7076, anti-mouse) was dissolved at 1:4000 in 2% nonfat dry milk (Bio-Rad Cat. #1706404)-TBST, whereas for puromycin, secondary antibody (CST Cat. #7076, anti-mouse) was dissolved at 1:5000 in 5% BSA-TBST. The membranes were incubated in WesternBright ECL (Advansta K-12045-D20), imaged using a ChemiDoc Imaging System (Bio-Rad), and quantified using Image Lab software (Bio-Rad). Membranes with phosphorylated proteins were stripped twice for 10 min each at ∼60°C in a mild-stripping buffer at pH = 2.2 (for 1 L in ultrapure water: 15 g of glycine, 1 g of SDS, and 10 mL of Tween 20, adjusted to a pH of 2.2 by adding HCl) and re-probed for total proteins. The following primary antibodies (all from Cell Signaling Technologies) were used: p-Akt(Ser473) Cat. #9271, at 1:1000; Akt Cat. #9272, at 1:1000; p-AS160(Ser588) Cat. #8730, at 1:1000; AS160 Cat. #2670, at 1:1000; Caspase-3 Cat. #14220, at 1:500; PARP Cat. #9532, at 1:1000; SOD2 Cat. #13141, at 1:1000; p-mTOR(Ser2448) Cat. #2971, at 1:1000; mTOR Cat. #2983, at 1:1000; p-p70S6K1(Thr389) Cat. #9205, at 1:1000; p70S6K1 Cat. #9202, at 1:1000; p-rpS6(Ser240/244) Cat. #2215, at 1:1000; rpS6 Cat. #2217, at 1:1000; p-4E-BP1(Thr37/46) Cat. #9259 at 1:1000; 4E-BP1 Cat. #9452 at 1:1000; p-FoxO3a(Ser253) Cat. #9466, at 1:500; FoxO3a Cat. #2497, at 1:500; p-Erk1/2(Thr202/Tyr204) Cat. #4370, at 1:1500; Erk Cat. #4695, at 1:1000; p-SMAD2/3(Ser465/467/Ser423/425) Cat. #8828, at 1:500; and SMAD2/3 Cat. #8685, at 1:500. The 4-hydroxynonenal was purchased from Abcam (Cat. #ab48506) and used at 1:1000. Anti-puromycin was purchased from Sigma-Aldrich (Cat. #MABE343) and used at 1:10000. All nonphosphorylated proteins were normalized to GAPDH (CST Cat. #2118, at 1:1000).

Statistical analyses

All data were presented as means ± SEM. To compare GMP treatment and palmitate and/or control, a one-way analysis of variance (ANOVA) with Šídák’s post hoc analysis was conducted. To compare the treatment groups at different concentrations of palmitate, a two-way ANOVA with Šídák’s multiple comparisons was performed. For the palmitate-only experiments, a one-way ANOVA with Šídák’s multiple comparisons test was conducted to compare the experimental groups and control groups, while for the fluorescently labeled palmitate experiment, an unpaired two-tailed t-test was performed. Statistical significance was set to P value of < 0.05. The statistical software GraphPad Prism version 9.5.1 () was used for all statistical analyses and plots.

Results

GMP prevents C2C12 myotube atrophy and palmitate-induced inflammation

To determine the effect of GMP on myotubes after inducing atrophy with palmitate, we examined myotube area and myogenic index, measured by an MF20/DAPI stain. We performed 24-h dose-response experiments using 0.25, 0.5, 0.75, and 1 mM concentrations of palmitate (Supplemental Figure 1A–G) and 1, 2, and 5 μg/mL of GMP (Supplemental Figure 2A–G) on indices of atrophy and inflammation. Higher doses of GMP (<1750 μg/mL) showed no preventative effect on myotube atrophy and myogenic index (data not shown). Thus, we determined that 0.75-mM palmitate and 5-μg/mL GMP were optimal for studying the temporal responses of inflammation and atrophy in the presence or absence of palmitate and GMP. Following 4–5 d of differentiation, myotube area, and myogenic index remained unaltered after palmitate treatment alone at 6 and 12 h (Figure 1C, D, F, G). After 24 h, palmitate treatment reduced the myotube area (Figure 1B), corresponding to a decrease in the myogenic index, whereas GMP prevented palmitate-induced atrophy and enhanced differentiation (Figure 1E, H). Interestingly, GMP, independent of palmitate, did not alter myotube differentiation or myogenic fusion index, suggesting that cellular stress may be needed to exert its positive effects on muscle cells (Supplemental Figure 2G). Thus, GMP effectively prevented palmitate-induced myotube atrophy.

To determine the effects of GMP on palmitate-induced inflammation in these myotubes, we assessed the gene expression of TNF-α, IL-6, and IL-1β over 6–24 h. As expected, palmitate differentially increased the expression of inflammatory markers over time (Figure 2A–I) [32,33]. However, after 24 h, GMP effectively prevented the palmitate-induced increase in the expression of TNF-α and IL-1β but not IL-6 (Figures 2C, F, I). Next, we blocked the inflammatory signaling with a TLR4 inhibitor (TAK-242) to gain insight into the mechanism of action of GMP, as previous studies showed that the anti-inflammatory properties of GMP may occur through TLR4 signaling [21,24]. As expected, the palmitate-induced increase in the expression of TNF-α was decreased by TAK-242 at 24 h, which was not observed for IL-6 and only slightly for IL-1β (P = 0.1658) (Figure 3). Interestingly, a similar temporal response was observed in the presence of GMP (Figure 2) suggesting that GMP may reduce inflammation arising from the TLR4 pathway. However, when we assessed the myotube area and fusion index in the presence of the TLR4 inhibitor (Figure 4), palmitate-induced inflammation and muscle atrophy were disconnected, perhaps indicating that the prevention of palmitate-induced atrophy by GMP was independent of a TLR4 mechanism.

FIGURE 2.

FIGURE 2

Open in a new tab

GMP prevents palmitate-induced inflammation. Gene expression of (A–C) TNF-α, (D–F) IL-6, and (G–I) IL-1β for intervals 6 h (n = 5–6), 12 h (n = 4–6), and 24 h (n = 10–12). All graphs are presented as a fold-change from the control (no palmitate, no GMP) after normalization to the housekeeping gene L32. One-way ANOVA with Šídák’s post hoc analysis was used to compare groups. ∗Significantly different from the control (no palmitate, no GMP) and #, significantly different from the palmitate-only group. P < 0.05. GMP, glycomacropeptide; TNF-α, tumor necrosis factor-alpha.

FIGURE 3.

FIGURE 3

Open in a new tab

TAK-242, a TLR4 inhibitor, prevents palmitate-induced inflammation. (A) Overview of the experimental design. C2C12 myoblasts were seeded and grown until ∼95%–100% confluence. Differentiation media was administered for 4–5 d, after which different treatments were given for 6, 12, or 24 h. Gene expression of (B–D) TNF-α, (E–G) IL-6, and (H–J) IL-1β for 6 h (n = 3), 12 h (n = 3), and 24 h (n = 4–5) intervals. Graphs are presented as a fold-change from control (no palmitate, no GMP) after normalization to the housekeeping gene L32. One-way ANOVA with Šídák’s post hoc analysis was used to compare groups. ∗Significantly different from the control (no palmitate, no GMP) and #, significantly different from the palmitate-only group. P < 0.05. GMP, glycomacropeptide; TLR4, toll-like receptor 4; TNF-α, tumor necrosis factor-alpha.

FIGURE 4.

FIGURE 4

Open in a new tab

TAK-242 does not prevent palmitate-induced myotube atrophy. (A) Representative images of MF20/DAPI staining at the 24-h interval; scale bar is equivalent to 500 μm. (B–D) Percent myotube area and (E–G) myogenic index are displayed for 6 h (n = 3), 12 h (n = 3), and 24 h (n = 3) intervals; all are shown as a fold-change from control (no palmitate, no GMP). One-way ANOVA with Šídák’s post hoc analysis was used to compare groups. ∗Significantly different from the control (no palmitate, no GMP) and #, significantly different from the palmitate-only group. P < 0.05. DAPI, 4′,6-diamidino-2-phenylindole; GMP, glycomacropeptide.

GMP does not offset lipid accumulation, insulin resistance, or apoptosis in the presence of palmitate

We conducted fluorescently labeled palmitate experiments to further explore the mechanism of GMP, which was effective at sequestering the TLR4 ligand LPS in a previous study [24] and may therefore operate through a similar mechanism with palmitate. With the addition of this palmitate-analog, we could visualize and assess palmitate within myotubes and determine whether GMP could prevent the myocellular incorporation of palmitate (Figure 5A). Cell sorting with flow cytometry determined that GMP did not reduce the entry of palmitate into myotubes at a palmitate concentration of 500 nM (Figure 5B).

FIGURE 5.

FIGURE 5

Open in a new tab

GMP neither prevents palmitate from entering the myotubes nor inhibits lipid accumulation, insulin resistance, and markers of apoptosis when administered with palmitate. (A) Representative images of control or unstained myotubes and fluorescently labeled palmitate along with GMP (5 μg/mL) within myotubes; scale bar is equivalent to 100 μm. (B) The amount of FITC-labeled palmitate measured by flow cytometry with or without GMP during 1-h treatment with 500 nM of fluorescently labeled palmitate on myotubes (n = 3–4). The total amount of (C–E) ceramides and (F–H) diacylglycerols, at 6 h (n = 3), 12 h (n = 3), and 24 h (n = 3), normalized to the amount of protein used (pmol lipid/mg protein), measured by lipidomics. Protein expression measured by immunoblotting of (I–K) p-Akt(Ser473) normalized to total Akt and (L–N) p-AS160(Ser588) normalized to total AS160, at 6 h (n = 6), 12 h (n = 6), and 24 h (n = 6). (O) Representative images of immunoblots. In addition, protein expression from immunoblotting at 24 h for (P) cleaved caspase-3, (Q) total caspase-3, (R) cleaved PARP, and (S) total PARP, all normalized to GAPDH. (T) Representative images of immunoblots of panels P–T. All protein expression graphs are displayed as a fold-change from the control (no palmitate, no GMP). (B) An unpaired two-tailed t-test was used to compare groups. (C–N, P–S) One-way ANOVA with Šídák’s post hoc analysis was used to compare groups. ∗Significantly different from the control (no palmitate, no GMP) and #, significantly different from the palmitate-only group. P < 0.05. FITC, fluorescein isothiocyanate; GMP, glycomacropeptide; PARP, poly (ADP-ribose) polymerase.

We then quantified sphingolipids in the myotubes in the presence of GMP, as palmitate is well-known to increase the accumulation of intracellular ceramide and diacylglycerol and induce muscle insulin resistance [7]. As expected, palmitate increased muscle ceramides and diacylglycerols at 24 h, although this response was not prevented in the presence of GMP (Figure 5C–H).

It is known that palmitate-induced accumulation of lipids causes muscle insulin resistance [7]. Therefore, we performed insulin-stimulated experiments in the presence of palmitate and GMP (Figure 5I–O). As expected, palmitate decreased p-Akt/Akt signaling in response to insulin, although this response was not attenuated with GMP (Figure 5K). In addition to insulin resistance, protein markers of apoptosis (Figure 5P–T) were increased with palmitate but remained unaffected by the addition of GMP (Figure 5P). Similarly, lipid-induced reactive oxygen species production and buffering were also unaltered at the 24-h interval in the presence of GMP (Supplemental Figure 3A-C). Together, these data suggested that GMP did not prevent myocellular lipid accumulation, insulin resistance, apoptosis, or oxidative stress.

GMP regulates markers of protein breakdown but not mTOR signaling or protein synthesis in the presence of palmitate

We then assessed whether the prevention of muscle atrophy by GMP corresponded to changes in the mTOR pathway and protein synthesis. Surprisingly, phosphorylation of mTOR and p70S6K1 was reduced in the GMP-only group (Figure 6A, B). Moreover, palmitate reduced p-rpS6/rpS6 after 24 h of treatment, which was not observed with the addition of GMP (Figure 6C). The phosphorylation of 4E-BP1 remained unchanged across all treatments (Figure 6D). Finally, we found that palmitate reduced puromycin incorporation after 24 h of treatment, which was not observed with the addition of GMP (Figure 6F, G). Together, these outcomes implied that GMP did not mitigate atrophy through mTOR signaling or protein synthesis.

FIGURE 6.

FIGURE 6

Open in a new tab

Regulation of the protein synthesis pathway by GMP at 24 h. Immunoblotting was used for the protein expression of (A) p-mTOR(Ser2448) normalized to total mTOR, (B) p-p70S6K1(Thr389) normalized to total p70S6K1, (C) p-rpS6(Ser240/244) normalized to total rpS6, (D) p-4E-BP1(Thr37/46) normalized to total 4E-BP1. (E) Representative images of immunoblots. (F) Puromycin normalized to GAPDH. (G) Representative image of puromycin immunoblot. All graphs are presented as a fold-change from control (no palmitate, no GMP) (n = 5–6). One-way ANOVA with Šídák’s post hoc analysis was used to compare groups. ∗, significantly different from the control (no palmitate, no GMP) and #, significantly different from the palmitate-only group. P < 0.05. 4E-BP1, eukaryotic translation initiation factor 4E-binding protein 1; GMP, glycomacropeptide; mTOR, mammalian target of rapamycin.

We also assessed the readouts of catabolic cellular pathways at 24 h. Immunoblotting for p-FoxO3a/FoxO3a revealed an increase for the palmitate group and a slight increase for the palmitate + GMP group (P = 0.0553) (Figure 7A, B). However, the gene expression of NF-κB1, FBXO32, and MURF1 was similarly downregulated in response to GMP as in the presence of palmitate (Figure 7C–E), which was independent of palmitate alone influencing these markers. These data suggested that GMP decreased the regulators of catabolism independent of palmitate action.

FIGURE 7.

FIGURE 7

Open in a new tab

GMP decreases the markers of protein degradation and inflammation independent of palmitate action at the 24-h interval. Immunoblotting was used to measure the protein expression of (A) p-FoxO3a(Ser253) normalized to total FoxO3a (n = 6) after 24 h of treatment. (B) Representative images of immunoblots used for panel A. Gene expression of (C) NF-κB (n = 5-6), (D) FBXO32 (n = 5–6), and (E) MuRF1 (n = 5–6), normalized to the housekeeping gene L32. All graphs are presented as a fold-change from the control (no palmitate, no GMP). One-way ANOVA with Šídák’s post hoc analysis was used to compare groups. ∗Significantly different from the control (no palmitate, no GMP) and #, significantly different from the palmitate-only group. P < 0.05. FBXO32, f-box protein 32; FoxO3a, forkhead box O3; GMP, glycomacropeptide; MuRF1, muscle ring-finger protein 1; NF-κB, nuclear factor of kappa light polypeptide gene enhancer in B cells.

GMP regulates muscle Erk1/2 signaling and myostatin gene expression

Finally, we examined the MAPK signaling pathway because Erk1/2 increases muscle atrophy by enhancing the transcription of MuRF1 and FBXO32, possibly through TLR4-mediated upregulation and/or regulation through an Erk1/2-myostatin axis [34,35]. Interestingly, we found that the protein expression of p-Erk1/2/Erk1/2 increased in response to palmitate. In contrast, GMP, independently or in combination with palmitate, reduced Erk1/2 signaling (Figure 8A, E). Likewise, the gene expression of myostatin was robustly increased following palmitate treatment, which was prevented with the addition of GMP (Figure 8B). The change in myostatin was independent of SMAD2/3 phosphorylation across treatments (Figure 8C, D). These findings indicate that GMP may regulate muscle atrophy by reducing the catabolic and growth-inhibiting pathways associated with cellular stress and myostatin induction.

FIGURE 8.

FIGURE 8

Open in a new tab

Potential regulatory mechanism of GMP to limit myotube atrophy. (A) Gene expression of myostatin as a fold-change from the control (no palmitate, no GMP) after normalization to the housekeeping gene L32 (n = 5–6). Protein expression measured by immunoblotting for (B) p-Erk1/2(Thr202/Tyr204) normalized to total Erk1/2, (C) p-SMAD2(Ser465/467) normalized to total SMAD2, and (D) p-SMAD3(Ser423/425) normalized to total SMAD3. All graphs were presented as a fold-change from the control (no palmitate, no GMP) (n = 6). (E) Representative images of immunoblots. One-way ANOVA with Šídák’s post hoc analysis was used to compare groups. ∗, significantly different from the control (no palmitate, no GMP) and #, significantly different from the palmitate-only group. P < 0.05. Erk 1/2, extracellular signal-related protein kinase 1/2; GMP, glycomacropeptide; SMAD, suppressor of mothers against decapentaplegic homolog.

Discussion

Obesity and metabolic disorders are commonly associated with skeletal muscle inflammation [36] and muscle wasting [37]. Here, we examined the therapeutic efficacy of the dairy bioactive peptide GMP in reducing lipotoxicity-induced myocellular inflammation and atrophy in vitro. The main findings of this study were that GMP prevented palmitate-induced inflammation and myotube atrophy but did not affect resistance to muscle insulin or the accumulation of myocellular lipids. The reversal of TLR4-mediated inflammation and muscle atrophy with GMP coincided with reduced Erk1/2 signaling and the gene expression of E3 ubiquitin ligases and myostatin but not mTOR signaling or protein synthesis, suggesting that GMP may modulate muscle size by targeting the catabolic and atrophy-regulating pathways. Collectively, these data indicate that GMP effectively limits myotube inflammation and atrophy under a lipotoxic stimulus and this may occur through a TLR4-mediated mechanism and by blunting proteolytic pathways that cumulatively assist in the maintenance of a positive protein balance.

To our knowledge, we showed for the first time that intact GMP had skeletal muscle-specific effects and effectively reduced myotube atrophy under a lipotoxic stimulus in vitro. Lactoferrin, another anti-inflammatory bioactive protein found in the whey-protein fraction (but much lower in abundance) that also has a glycosylated feature like GMP [38], has similarly been shown to induce hypertrophy in myotube cultures [39].In addition, β-lactoglobulin, the major protein in whey (accounting for ∼50% of total whey), has also been shown to increase protein synthesis [40] and support muscle growth by increasing differentiation [41]. Here, we revealed that GMP, a bioactive peptide that also comprises a large component of the total whey (∼20% by weight), exerted profound protective effects in muscle cells in the presence of atrophy-inducing stress, thus providing a potential therapeutic application of this nutritional compound in metabolic diseases that lead to myopathies [42]. However, unlike lactoferrin [38], GMP did not exert anti-inflammatory and growth-promoting effects in muscle cells in the absence of a stress stimulus. We hypothesize that a cellular stressor such as disease or even exercise may be obligatory to unmask the clinical utility of GMP. Interestingly, the synergistic muscle growth-promoting effects of whey protein, when combined with resistance exercise [43], may be partly attributed to the bioactive proteins and peptides such as GMP found within, independent of the individual branched-chain amino acids, such as leucine [44]. Further studies are warranted to examine the combined muscle-protein anabolic effects of GMP and muscle contraction.

The mechanism underlying the protective effects of GMP on myotube size and myonuclear fusion is unclear. However, our studies lend evidence that this mechanism is at least partly attributed to attenuating intracellular signaling through the cellular stress MAPK and Erk1/2 pathways, as well as the subsequent regulation of the ubiquitin-proteasome system, namely MURF1 and FBXO32 [45,46], but not the mTOR signaling pathway or protein synthesis. This suggests that GMP targets pathways to alter proteolysis and not necessarily protein synthesis in the context of lipotoxicity-induced myotube atrophy. GMP in combination with other anabolic whey protein components such as leucine [47], may exert an even more positive protein balance, as both arms of the protein balance equation could be targeted. Interestingly, we also noted that GMP decreased the robust palmitate induction of myostatin gene expression, which was independent of SMAD signaling. However, a prior study has identified that in C2C12 myoblasts, myostatin may operate through an Erk signaling cascade [48,49], suggesting that it could be linked to the observed MAPK signaling response and inhibited by GMP.

We originally considered that a mechanism of GMP action may involve sequestering palmitate outside the cell, as was previously shown in the RAW264.7 macrophage cell line in the presence of LPS [24]. However, GMP did not prevent the cellular entry of palmitate as demonstrated using flow cytometry, which corresponded with the accumulation of sphingolipids and associated resistance to muscle insulin [7]. However, in myotubes in culture, GMP blocked palmitate-induced inflammation, a palmitate inflammatory mechanism that occurs via the TLR4 receptor [25], as supported by our experiments using TLR4 inhibitors. This indicated that GMP could at least exert anti-inflammatory properties at the level of the TLR4 receptor. We also cannot rule out that intact GMP may exert anti-catabolic action on muscle cells by entering the cell through a small-peptide transporter or have an unidentified receptor, as what has been discovered for other dairy bioactive compounds, such as lactoferrin [50]. Additional studies are needed to further unravel the cell-autonomous mechanisms of GMP on regulation of the myotube size, as well as examine if GMP is equally effective in vivo under conditions of skeletal muscle atrophy and inflammation.

In conclusion, we show that the whey protein-derived peptide GMP has potent properties to offset muscle inflammation and myotube atrophy, but not muscle insulin resistance, in the presence of a lipotoxic stimulus. The mechanisms of GMP action may involve the inhibition of TLR4 signaling and reduction in proteolytic and atrophy-related mechanisms tied to a myostatin-Erk-ubiquitin E3 ligase pathway, but not by altering mTOR signaling or protein synthesis. This study provides evidence for the potential of GMP to preserve muscle mass and halt a metabolically dysregulated state such as obesity and/or diabetes by exerting anti-catabolic properties.

Author contributions

The authors’ responsibilities were as follows – NMMPdH and MJD: conceived and designed experiments; NMMPdH, JJP, RJN, EMY, and PJF: performed experiments and data acquisition; NMMPdH, JJP, and RJN: analyzed the data; NMMPdH, JJP, PJF, and MJD: interpreted the data; SAS: contributed reagents and methodical tools; EDB, LSW, and BLP: provided the GMP; NMMPdH and MJD: designed final figures and drafted the manuscript; and all authors: read and approved the final version of the manuscript.

Conflicts of interest

EDB is employed by Dairy West and LSW and BLP are employed by Glanbia Nutritionals. SAS is a founder and shareholder with Centaurus Therapeutics. All other authors report no conflicts of interest.

Funding

This project was funded by Building University-Industry Linkages through Learning and Discovery (BUILD) Dairy and Glanbia Nutritionals and National Institute on Aging (NIA) grant (F99AG073493) to JJP. Mass spectrometry equipment for the Metabolomics core was obtained through National Center for Research Resources (NCRR) shared instrumentation grants 1S10OD016232-01, 1S10OD018210-01A1, and 1S10OD021505-01. Additional research support was received from the National Institutes of Health (DK115824, DK116888, DK116450, and DK130296) to SAS. The content of this manuscript is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health (NIH). Glanbia Nutritionals also provided the experimental product GMP.

Acknowledgments

We thank J Alan Maschek, the University of Utah Metabolomics, Proteomics, and Mass Spectrometry Cores for conducting the lipidomic analysis; the University of Utah Flow Cytometry Core Facility for conducting the flow cytometry analysis; and the University of Utah Cell Imaging Core for imaging acquisition and analysis.

Footnotes

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.tjnut.2023.08.033.

Appendix A. Supplementary data

The following are the Supplementary data to this article:

Multimedia component 1
mmc1.pdf (195.2KB, pdf)
Multimedia component 2
mmc2.docx (20.9KB, docx)

References

  • 1.Reidy P.T., McKenzie A.I., Mahmassani Z.S., Petrocelli J.J., Nelson D.B., Lindsay C.C., et al. Aging impairs mouse skeletal muscle macrophage polarization and muscle-specific abundance during recovery from disuse. Am. J. Physiol. Endocrinol. Metab. 2019;317(1):E85–E98. doi: 10.1152/ajpendo.00422.2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wang Y., Wehling-Henricks M., Welc S.S., Fisher A.L., Zuo Q., Tidball J.G. Aging of the immune system causes reductions in muscle stem cell populations, promotes their shift to a fibrogenic phenotype, and modulates sarcopenia. FASEB. J. 2019;33(1):1415–1427. doi: 10.1096/fj.201800973R. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Snel M., Jonker J.T., Schoones J., Lamb H., de Roos A., Pijl H., et al. Ectopic fat and insulin resistance: pathophysiology and effect of diet and lifestyle interventions. Int. J. Endocrinol. 2012;2012 doi: 10.1155/2012/983814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Correa-de-Araujo R., Addison O., Miljkovic I., Goodpaster B.H., Bergman B.C., Clark R.V., et al. Myosteatosis in the context of skeletal muscle function deficit: an interdisciplinary workshop at the National Institute on Aging. Front. Physiol. 2020;11:963. doi: 10.3389/fphys.2020.00963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Morgan P.T., Smeuninx B., Breen L. Exploring the impact of obesity on skeletal muscle function in older age. Front. Nutr. 2020;7 doi: 10.3389/fnut.2020.569904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Zhang H., He F., Zhou L., Shi M., Li F., Jia H. Activation of TLR4 induces inflammatory muscle injury via mTOR and NF-κB pathways in experimental autoimmune myositis mice. Biochem. Biophys. Res. Commun. 2022;603:29–34. doi: 10.1016/j.bbrc.2022.03.004. [DOI] [PubMed] [Google Scholar]
  • 7.Holland W.L., Bikman B.T., Wang L.P., Yuguang G., Sargent K.M., Bulchand S., et al. Lipid-induced insulin resistance mediated by the proinflammatory receptor TLR4 requires saturated fatty acid-induced ceramide biosynthesis in mice. J. Clin. Invest. 2011;121(5):1858–1870. doi: 10.1172/JCI43378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.West D.W.D., Abou Sawan S., Mazzulla M., Williamson E., Moore D.R. Whey protein supplementation enhances whole body protein metabolism and performance recovery after resistance exercise: a double-blind crossover study. Nutrients. 2017;9(7):735. doi: 10.3390/nu9070735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Trommelen J., van Lieshout G.A.A., Pabla P., Nyakayiru J., Hendriks F.K., Senden J.M., et al. Pre-sleep protein ingestion increases mitochondrial protein synthesis rates during overnight recovery from endurance exercise: a randomized controlled trial. Sports Med. 2023;53(7):1445–1455. doi: 10.1007/s40279-023-01822-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.de Hart N.M.M.P., Mahmassani Z.S., Reidy P.T., Kelley J.J., McKenzie A.I., Petrocelli J.J., et al. Acute effects of cheddar cheese consumption on circulating amino acids and human skeletal muscle. Nutrients. 2021;13(2):614. doi: 10.3390/nu13020614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zhou L.M., Xu J.Y., Rao C.P., Han S., Wan Z., Qin L.Q. Effect of whey supplementation on circulating C-reactive protein: a meta-analysis of randomized controlled trials. Nutrients. 2015;7(2):1131–1143. doi: 10.3390/nu7021131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Pal S., Ellis V., Dhaliwal S. Effects of whey protein isolate on body composition, lipids, insulin and glucose in overweight and obese individuals. Br. J. Nutr. 2010;104(5):716–723. doi: 10.1017/s0007114510000991. [DOI] [PubMed] [Google Scholar]
  • 13.Adams R.L., Broughton K.S. Insulinotropic effects of whey: mechanisms of action, recent clinical trials, and clinical applications. Ann. Nutr. Metab. 2016;69(1):56–63. doi: 10.1159/000448665. [DOI] [PubMed] [Google Scholar]
  • 14.Inui T., Kawamura N., Nakama R., Inui A., Katsuura G. Degalactosylated whey protein suppresses inflammatory responses induced by lipopolysaccharide in mice. Front. Nutr. 2022;9 doi: 10.3389/fnut.2022.852355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Tong X., Li W., Xu J.Y., Han S., Qin L.Q. Effects of whey protein and leucine supplementation on insulin resistance in non-obese insulin-resistant model rats. Nutrition. 2014;30(9):1076–1080. doi: 10.1016/j.nut.2014.01.013. [DOI] [PubMed] [Google Scholar]
  • 16.Shertzer H.G., Woods S.E., Krishan M., Genter M.B., Pearson K.J. Dietary whey protein lowers the risk for metabolic disease in mice fed a high-fat diet. J. Nutr. 2011;141(4):582–587. doi: 10.3945/jn.110.133736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Safaeian L., Zabolian H. Antioxidant effects of bovine lactoferrin on dexamethasone-induced hypertension in rat. ISRN Pharmacol. 2014;2014 doi: 10.1155/2014/943523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Tai C.S., Chen Y.Y., Chen W.L. β-Lactoglobulin influences human immunity and promotes cell proliferation. Biomed. Res. Int. 2016;2016 doi: 10.1155/2016/7123587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sharma N.R., Sharma R., Rajput Y.S., Mann B. Chemical and functional properties of glycomacropeptide (GMP) and its role in the detection of cheese whey adulteration in milk: a review. Dairy Sci. Technol. 2013;93(1):21–43. doi: 10.1007/s13594-012-0095-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hvas C.L., Dige A., Bendix M., Wernlund P.G., Christensen L.A., Dahlerup J.F., et al. Casein glycomacropeptide for active distal ulcerative colitis: a randomized pilot study. Eur. J. Clin. Invest. 2016;46(6):555–563. doi: 10.1111/eci.12634. [DOI] [PubMed] [Google Scholar]
  • 21.Cordova-Davalos L.E., Jimenez M., Salinas E. Glycomacropeptide bioactivity and health: a review highlighting action mechanisms and signaling pathways. Nutrients. 2019;11(3):598. doi: 10.3390/nu11030598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Brody E.P. Biological activities of bovine glycomacropeptide. Br. J. Nutr. 2000;84(Suppl 1):S39–S46. doi: 10.1017/s0007114500002233. [DOI] [PubMed] [Google Scholar]
  • 23.Sawin E.A., De Wolfe T.J., Aktas B., Stroup B.M., Murali S.G., Steele J.L., et al. Glycomacropeptide is a prebiotic that reduces Desulfovibrio bacteria, increases cecal short-chain fatty acids, and is anti-inflammatory in mice. Am. J. Physiol. Gastrointest. Liver Physiol. 2015;309(7):G590–G601. doi: 10.1152/ajpgi.00211.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Cheng X., Gao D., Chen B., Mao X. Endotoxin-binding peptides derived from casein glycomacropeptide inhibit lipopolysaccharide-stimulated inflammatory responses via blockade of NF-κB activation in macrophages. Nutrients. 2015;7(5):3119–3137. doi: 10.3390/nu7053119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lancaster G.I., Langley K.G., Berglund N.A., Kammoun H.L., Reibe S., Estevez E., et al. Evidence that TLR4 is not a receptor for saturated fatty acids but mediates lipid-induced inflammation by reprogramming macrophage metabolism. Cell Metab. 2018;27(5) doi: 10.1016/j.cmet.2018.03.014. 1096–1110.e5. [DOI] [PubMed] [Google Scholar]
  • 26.da Paixão A.O., Bolin A.P., Silvestre J.G., Rodrigues A.C. Palmitic acid impairs myogenesis and alters temporal expression of miR-133a and miR-206 in C2C12 myoblasts. Int. J. Mol. Sci. 2021;22(5):2748. doi: 10.3390/ijms22052748. PubMed PMID: 33803124; PubMed Central PMCID: PMC7963199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ono Y., Maejima Y., Saito M., Sakamoto K., Horita S., Shimomura K., et al. TAK-242, a specific inhibitor of Toll-like receptor 4 signalling, prevents endotoxemia-induced skeletal muscle wasting in mice. Sci. Rep. 2020;10(1):694. doi: 10.1038/s41598-020-57714-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Fix D.K., Mahmassani Z.S., Petrocelli J.J., de Hart N.M.M.P., Ferrara P.J., Painter J.S., et al. Reversal of deficits in aged skeletal muscle during disuse and recovery in response to treatment with a secrotome product derived from partially differentiated human pluripotent stem cells. Geroscience. 2021;43(6):2635–2652. doi: 10.1007/s11357-021-00423-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Mahmassani Z.S., McKenzie A.I., Petrocelli J.J., de Hart N.M., Reidy P.T., Fix D.K., et al. Short-term metformin ingestion by healthy older adults improves myoblast function. Am. J. Physiol Cell Physiol. 2021;320(4):C566–C576. doi: 10.1152/ajpcell.00469.2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Petrocelli J.J., Mahmassani Z.S., Fix D.K., Montgomery J.A., Reidy P.T., McKenzie A.I., et al. Metformin and leucine increase satellite cells and collagen remodeling during disuse and recovery in aged muscle. FASEB. J. 2021;35(9) doi: 10.1096/fj.202100883R. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Park M., Kaddai V., Ching J., Fridianto K.T., Sieli R.J., Sugii S., et al. A role for ceramides, but not sphingomyelins, as antagonists of insulin signaling and mitochondrial metabolism in C2C12 myotubes. J. Biol. Chem. 2016;291(46):23978–23988. doi: 10.1074/jbc.M116.737684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Chen S.C., Chen P.Y., Wu Y.L., Chen C.W., Chen H.W., Lii C.K., et al. Long-chain polyunsaturated fatty acids amend palmitate-induced inflammation and insulin resistance in mouse C2C12 myotubes. Food Funct. 2016;7(1):270–278. doi: 10.1039/c5fo00704f. [DOI] [PubMed] [Google Scholar]
  • 33.Sadeghi A., Seyyed Ebrahimi S.S., Golestani A., Meshkani R. Resveratrol ameliorates palmitate-induced inflammation in skeletal muscle cells by attenuating oxidative stress and JNK/NF-κB pathway in a SIRT1-independent mechanism. J. Cell Biochem. 2017;118(9):2654–2663. doi: 10.1002/jcb.25868. [DOI] [PubMed] [Google Scholar]
  • 34.Baehr L.M., Hughes D.C., Waddell D.S., Bodine S.C. SnapShot: skeletal muscle atrophy. Cell. 2022;185(9):1618-.e1. doi: 10.1016/j.cell.2022.03.028. [DOI] [PubMed] [Google Scholar]
  • 35.Chen M.M., Zhao Y.P., Zhao Y., Deng S.L., Yu K. Regulation of myostatin on the growth and development of skeletal muscle. Front. Cell Dev. Biol. 2021;9 doi: 10.3389/fcell.2021.785712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wu H., Ballantyne C.M. Skeletal muscle inflammation and insulin resistance in obesity. J. Clin. Investig. 2017;127(1):43–54. doi: 10.1172/JCI88880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Kalinkovich A., Livshits G. Sarcopenic obesity or obese sarcopenia: a cross talk between age-associated adipose tissue and skeletal muscle inflammation as a main mechanism of the pathogenesis. Ageing Res. Rev. 2017;35:200–221. doi: 10.1016/j.arr.2016.09.008. [DOI] [PubMed] [Google Scholar]
  • 38.Karav S., German J.B., Rouquié C., Le Parc A., Barile D. Studying lactoferrin N-glycosylation. Int. J. Mol. Sci. 2017;18(4):870. doi: 10.3390/ijms18040870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Kitakaze T., Oshimo M., Kobayashi Y., Ryu M., Suzuki Y.A., Inui H., et al. Lactoferrin promotes murine C2C12 myoblast proliferation and differentiation and myotube hypertrophy. Mol. Med. Rep. 2018;17(4):5912–5920. doi: 10.3892/mmr.2018.8603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Mose M., Møller N., Jessen N., Mikkelsen U.R., Christensen B., Rakvaag E., et al. β-Lactoglobulin is insulinotropic compared with casein and whey protein ingestion during catabolic conditions in men in a double-blinded randomized crossover trial. J. Nutr. 2021;151(6):1462–1472. doi: 10.1093/jn/nxab010. [DOI] [PubMed] [Google Scholar]
  • 41.Kim Y.E., Kim J.W., Cheon S., Nam M.S., Kim K.K. Alpha-casein and beta-lactoglobulin from cow milk exhibit antioxidant activity: a plausible link to antiaging effects. J. Food Sci. 2019;84(11):3083–3090. doi: 10.1111/1750-3841.14812. [DOI] [PubMed] [Google Scholar]
  • 42.Stump C.S., Henriksen E.J., Wei Y., Sowers J.R. The metabolic syndrome: role of skeletal muscle metabolism. Ann. Med. 2006;38(6):389–402. doi: 10.1080/07853890600888413. [DOI] [PubMed] [Google Scholar]
  • 43.Witard O.C., Jackman S.R., Breen L., Smith K., Selby A., Tipton K.D. Myofibrillar muscle protein synthesis rates subsequent to a meal in response to increasing doses of whey protein at rest and after resistance exercise. Am. J. Clin. Nutr. 2014;99(1):86–95. doi: 10.3945/ajcn.112.055517. [DOI] [PubMed] [Google Scholar]
  • 44.Holwerda A.M., Paulussen K.J.M., Overkamp M., Goessens J.P.B., Kramer I.F., Wodzig W.K.W.H., et al. Leucine coingestion augments the muscle protein synthetic response to the ingestion of 15 g of protein following resistance exercise in older men. Am. J. Physiol. Endocrinol. Metab. 2019;317(3):E473–E482. doi: 10.1152/ajpendo.00073.2019. [DOI] [PubMed] [Google Scholar]
  • 45.Kim J., Won K.J., Lee H.M., Hwang B.Y., Bae Y.M., Choi W.S., et al. p38 MAPK participates in muscle-specific RING finger 1-mediated atrophy in cast-immobilized rat gastrocnemius muscle. Korean J. Physiol. Pharmacol. 2009;13(6):491–496. doi: 10.4196/kjpp.2009.13.6.491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Belova S.P., Mochalova E.P., Kostrominova T.Y., Shenkman B.S., Nemirovskaya T.L. P38α-MAPK signaling inhibition attenuates soleus atrophy during early stages of muscle unloading. Int. J. Mol. Sci. 2020;21(8):2756. doi: 10.3390/ijms21082756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Mahmassani Z.S., McKenzie A.I., Petrocelli J.J., de Hart N.M., Fix D.K., Kelly J.J., et al. Reduced physical activity alters the leucine-stimulated translatome in aged skeletal muscle. J. Gerontol.A. Biol. Sci. Med. Sci. 2021;76(12):2112–2121. doi: 10.1093/gerona/glab077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Yang W., Chen Y., Zhang Y., Wang X., Yang N., Zhu D. Extracellular signal-regulated kinase 1/2 mitogen-activated protein kinase pathway is involved in myostatin-regulated differentiation repression. Cancer Res. 2006;66(3):1320–1326. doi: 10.1158/0008-5472.Can-05-3060. [DOI] [PubMed] [Google Scholar]
  • 49.Drysch M., Schmidt S.V., Becerikli M., Reinkemeier F., Dittfeld S., Wagner J.M., et al. Myostatin deficiency protects C2C12 cells from oxidative stress by inhibiting intrinsic activation of apoptosis. Cells. 2021;10(7):1680. doi: 10.3390/cells10071680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Kell D.B., Heyden E.L., Pretorius E. The biology of lactoferrin, an iron-binding protein that can help defend against viruses and bacteria. Front. Immunol. 2020;11:1221. doi: 10.3389/fimmu.2020.01221. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.pdf (195.2KB, pdf)
Multimedia component 2
mmc2.docx (20.9KB, docx)

Articles from The Journal of Nutrition are provided here courtesy of American Society for Nutrition

RESOURCES