Table 1. List of RhlR binding sites in WT PA14 and their associated expression and binding dependencies in different genetic backgrounds.
Expression values were determined using Rockhopper [65] with data from Simanek et al. 2022 [29]. Q-values represent the probability of a false discovery of differentially expressed genes. Expression values used to calculate relative expression all increased by 1 to prevent div/0.
| Site Locationa | Synonymb | Motifc | WT Binding | ΔrhlR Binding | ΔpqsE Binding | ΔrhlI Binding | RhlR Expression Change | PqsE Expression Change | RhlI Expression Change | Previously Found |
|---|---|---|---|---|---|---|---|---|---|---|
| 64211 | phzH | CAACTATTGAATATAAGAGTT | 2437.4 | 906.1 | 906.8 | 962.1 | 5.8 | 3.0 | 5.8 | Mukherjee, Letizia, Asfahl |
| 139733 | PA14_01490 (rahU) | - | 2364.4 | 24.5 | 640.1 | 2111.9 | 18.4 | 1.4 | 2.9 | Asfahl, Letizia, Schuster, Mukherjee |
| 560072 | PA14_06320 | CCCCTACTAGAATTCACAGGT | 1010.4 | 8.9 | 596.4 | 1461.2 | 0.8 | 0.8 | 0.6 | Letizia |
| 754615 | rpsL operon | GCCCTGCCAATTTTCGGGGTA | 552.9 | 35.1 | 194.2 | 144.2 | 0.6 | 1.4 | 1.1 | - |
| 812427 | phzB1*, phzC1 | - | 3931.3 | 966.2 | 1641.1 | 3353.5 | 264.5, 138.3 | 29.3, 20.8 | 44.1, 31.1 | Asfahl, Letizia, Schuster, Cruz |
| 813529 | phzA1 operon, phzM | CACCTACCAGATCTTGTAGTT | 10446.1 | 995.9 | 1676.3 | 5496.0 | 124, 19 | 15.5, 8.4 | 15.5, 7.0 | Asfahl, Letizia, Mukherjee, Cruz |
| 895433 | PA14_10360 operon | GAACTGCCAGGATTAGCGGTT | 6809.1 | 800.8 | 1376.8 | 794.7 | 28.9 | 1.9 | 12.9 | Asfahl, Letizia, Mukherjee, Cruz, Schuster |
| 1372370 | PA14_16100*, PA14_16110 | CACCTGCTTGAAATTGCAGTA | 6758.9 | 66.6 | 1914.7 | 1152.0 | 1.5, 1.3 | 1.4, 0.7 | 1.6, 1.1 | Mukherjee, Asfahl, Letizia |
| 1387361 | lasB | AACCTGCCAGAACTGGCAGGT | 878.9 | 9.4 | 605.7 | 296.7 | 2.4 | 0.7 | 3.2 | Cruz, Schuster, Mukherjee, Asfahl, Letizia |
| 1620628 | PA14_18800 | TACCTGAGAGATTTATGAGTT | 1315.4 | 395.0 | 863.9 | 629.5 | 4.0 | 1.1 | 3.6 | Mukherjee, Asfahl, Letizia |
| 1621028 | PA14_18810 operon | - | 481.3 | 189.0 | 481.7 | 257.6 | 0.6 | 1.3 | 1.3 | Asfahl |
| 1648391 | rhlA operon | TAACTGCCAGATTTCACAGGA | 11271.2 | 28.5 | 7736.8 | 2586.2 | 45.3 | 1.0 | 5.1 | Asfahl, Letizia, Mukherjee, Schuster, Cruz |
| 1651804 | rhlI | - | 1112.2 | 9.8 | 1080.2 | 1021.5 | 1.5 | 1.0 | 35.2 | Cruz, Schuster, Asfahl |
| 1735823 | PA14_20130, PA14_20140 (fpr) | - | 414.7 | 62.4 | 307.4 | 233.3 | 1.0, 1.2 | 1.0, 1.2 | 1.0, 1.1 | Mukherjee, Asfahl |
| 1774336 | lecB, PA14_20620 operon | CCACTGCTAGAGTTCGCAGGA | 32231.7 | 35.0 | 577.6 | 33814.6 | 5.6, 1.4 | 2.9, 1.1 | 2.2, 1.0 | Asfahl, Cruz, Letizia, Mukherjee |
| 1816906 | PA14_21020 (azeB) operon, PA14_21030 (azeA) | TACCTACCAGAATTAACAGTT | 15193.0 | 301.7 | 16297.0 | 6827.0 | 11.2, 4.3 | 2.3, 0.9 | 5.3, 2.2 | Asfahl, Letizia, Cruz, Schuster, Mukherjee |
| 1924465 | PA14_22090 | - | 390.1 | 89.1 | 242.1 | 142.1 | 1.0 | 0.9 | 1.0 | - |
| 2444398 | PA14_28250*, PA14_28260 | AAGCTGCCGGATCTGGTAGGC | 885.1 | 8.4 | 321.1 | 166.8 | 0.9, 1.2 | 0.8, 0.8 | 0.8, 1.1 | Mukherjee |
| 2568048 | PA14_29620, fhp operon | AAACTACCAGAATTCACGGGC | 7797.7 | 20.9 | 1780.0 | 1602.7 | 0.7, 0.02 | 0.9, 0.03 | 0.8, 1.1 | Letizia, Asfahl |
| 2647472 | PA14_30570, PA14_30580 (vqsR) | CACCTACCAGAACTGGTAGTT | 2294.2 | 118.2 | 3484.9 | 1094.3 | 1.8, 0.8 | 1.0, 0.6 | 1.4, 0.8 | Cruz, Schuster, Mukherjee, Asfahl, Letizia |
| 2677542 | PA14_30840 * | - | 17187.9 | 23.2 | 90.7 | 9811.6 | 1.3 | 0.8 | 0.9 | Letizia |
| 2721761 | pa1L | CTCCTGCATGAATTGATAGGC | 431.0 | 410.1 | 278.4 | 315.4 | 5.5 | 1.7 | 6.0 | Mukherjee, Cruz, Asfahl, Letizia |
| 3188223 | tnpS, tnpT operon | - | 556.8 | 243.6 | 339.1 | 258.0 | 1.3, 1.0 | 1.0, 1.2 | 1.0, 1.2 | - |
| 3236436 | hcnA operon, exoY | - | 3335.0 | 5.4 | 342.1 | 4885.0 | 10.2, 1.4 | 3.6, 0.8 | 2.4, 0.9 | Asfahl, Letizia, Mukherjee, Schuster, Cruz |
| 3364761 | PA14_37745 operon | GCCCTGCCAGATTTCGCAGGC | 423.7 | 4.9 | 112.0 | 37.0 | 34.2 | 1.5 | 14.6 | Mukherjee, Letizia, Asfahl, Schuster |
| 3561157 | phzB2*, phzC2 | - | 453.4 | 340.6 | 420.0 | 336.5 | 100.1, 132.4 | 8.3, 14.9 | 40.0, 34.0 | Mukherjee, Cruz, Letizia, Schuster, Asfahl |
| 3561969 | phzA2 operon | CACCTGTAATTTTTAAGGGGT | 2238.4 | 314.8 | 1218.8 | 348.0 | 88.5 | 8.4 | 29.5 | Letizia, Mukherjee, Cruz, Asfahl |
| 3600666 | lasA | CAACTATCAGCTTTTGCAGTA | 555.5 | 6.0 | 277.4 | 206.6 | 2.3 | 0.9 | 2.5 | Cruz, Mukherjee, Asfahl, Letizia |
| 3831541 | hsiA2 operon, hcpD | - | 3119.5 | 373.5 | 1767.9 | 629.0 | 2.7, 2.2 | 1.9, 1.8 | 2.3, 2.7 | Cruz, Schuster, Mukherjee, Asfahl, Letizia |
| 4285523 | PA14_48140 operon | CACCTGGCAGAACTGACAGGT | 1059.8 | 136.6 | 405.7 | 272.9 | 0.9 | 0.7 | 0.9 | Asfahl, Letizia |
| 4313855 | PA14_48530 operon | CAACTATGAGAATTGGTAGTT | 2800.5 | 127.7 | 2597.9 | 2645.5 | 2.7 | 1.0 | 1.3 | Mukherjee, Cruz, Asfahl, Letizia |
| 4314560 | PA14_48530 * | - | 620.4 | 137.3 | 974.9 | 651.9 | 2.7 | 1.0 | 1.3 | Mukherjee, Cruz, Asfahl, Letizia |
| 4382169 | PA14_49310 | CAACTGCCAGATCTGGCAGGC | 1136.8 | 39.3 | 880.7 | 1398.4 | 0.9 | 0.8 | 1.2 | Asfahl, Letizia |
| 4425570 | PA14_49740, PA14_49750 operon | AAACTACCGGAATTCACAGGT | 7939.2 | 8.7 | 6100.9 | 3189.2 | 0.9, 6.8 | 1.0, 0.9 | 0.8, 2.1 | Mukherjee, Letizia, Asfahl, Cruz |
| 5159548 | PA14_57970*, PA14_57980 | CAACTGTTACATATGAGCGGT | 881.2 | 12.7 | 106.4 | 236.3 | 0.9, 1.0 | 1.2, 1.5 | 0.9, 1.1 | - |
| 5268881 | PA14_59180 * | CAACTCGCAGAACTGGTGGGG | 679.5 | 29.4 | 185.2 | 247.1 | 0.9 | 0.5 | 0.7 | - |
| 6082366 | rmlB operon | CACCTACCAGATCTGGGGTTG | 10477.0 | 23.2 | 4067.5 | 1291.5 | 2.3 | 0.9 | 1.8 | Mukherjee, Letizia |
| 6093032 | arcD operon | TCCCTATAGGAATTGAGAGTG | 3285.2 | 16.5 | 333.9 | 205.1 | 0.9 | 2.6 | 0.7 | - |
aSite location refers to the genomic position of the base in the center of a given ChIP peak.
bTwo genes are listed where a site is upstream of a gene on both strands, or within one gene and upstream of an adjacent gene on the same strand.
*Gene is associated with an internal binding site.
cBinding motifs were identified using MEME analysis [63] and the sequence contributing to the consensus motif is listed in line with its associated ChIP site and gene(s) where identified.