Abstract
Short sequence repeats (SSRs), potentially representing variable numbers of tandem repeat (VNTR) loci, were identified for the human-pathogenic yeast species Candida albicans by computerized DNA sequence scanning. The individual SSR regions were investigated in different clinical isolates of C. albicans. Most of the C. albicans SSRs were identified as genuine VNTRs. They appeared to be present in multiple allelic variants and were demonstrated to be diverse in length among nonrelated strains. As such, these loci provide adequate targets for the molecular typing of C. albicans strains. VNTRs encountered in other microbial species sometimes participate in regulation of gene expression and function as molecular switches at the transcriptional or translational level. Interestingly, the VNTRs identified here often encode polyglutamine stretches and are frequently located within genes potentially involved in the regulation of transcription. DNA sequencing of these VNTRs demonstrated that the length variability was restricted to the CAA/CAG repeats encoding the polyglutamine stretches. For these reasons, paired C. albicans isolates of similar genotype, either found as noninvasive colonizers or encountered in an invasive state in the same individual, were studied with respect to potentially invasion-related alterations in the VNTR profiles. However, none of the VNTRs analyzed thus far varied systematically with the transition from colonization to invasion. In contrast to the situation described for some prokaryotic species, this finding suggests that VNTRs of C. albicans may not simply function as contingency loci related to straightforward on/off regulation of invasion-related gene expression.
Candida albicans is a permanently diploid microorganism for which no sexual cycle has been described. This medically relevant yeast species provides a typical example of an emerging pathogen: together with some other Candida spp., it is now the fourth most common organism isolated from blood, and its incidence is still on the rise (1). Despite the fact that a large proportion of humans are colonized with this yeast species (29), invasive disease is generally limited to persons suffering from innate or therapy-induced immunodeficiencies. This finding raises the question of whether either the virulence or host deficiencies of C. albicans are the major determinants for the development of invasive disease. Systemic infection by C. albicans is considered to be preceded by a complex and multifactorial series of events starting with epithelial adhesion and colonization (30). After epithelial penetration, possibly as a consequence of hypha formation and the excretion of lytic enzymes, vascular invasion and hematogenous dissemination can lead to endothelial adhesion and, ultimately, tissue invasion (30). It has been suggested that modulation of gene expression, which has been described in detail for the phenomenon of phenotypic colony morphology switching (35), could play a crucial role in the transition of C. albicans from a mere colonizer of body surfaces to an invasive infectious agent.
Phenotype switching in C. albicans has been experimentally correlated with phase-specific expression of subsets of genes shown to be scattered throughout the entire fungal genome; the physical basis of switching, however, remains enigmatic (25, 26). Various hypothetical switch-regulatory molecular models have been presented (36), and the existence of regulatory (suppressor) proteins was demonstrated by gel retardation studies (35, 37). However, a master regulatory site has not yet been identified. The number of theoretical models describing the development of infectious disease in general is limited (reviewed in reference 3). Major inductive schemes such as gene rearrangement, gene conversion, and the modification of gene transcription levels or protein-encoding reading frames have to be correlated with the pathogenicity related alterations during Candida invasion.
Short sequence repeats (SSRs) represent a class of DNA motifs consisting of tandemly organized, reiterated DNA sequences that sometimes show variability in the number of sequence units. These so-called variable number of tandem repeat loci (VNTRs) have been described as molecular switches controlling gene expression in several microbial species (43, 47–49). These simple DNA sequence and structure elements provide interesting targets in the analysis of controlled gene expression in C. albicans in analogy with studies in neisseriae (47) and Haemophilus influenzae (16). Several potentially regulatory VNTR domains have been described recently for C. albicans, and various modes of involvement in gene expression regulation were suggested. Field and Wills (10) noted that many of the VNTRs encode amino acid homopolymers at the protein level, which could be involved in modulation of transcriptional activity of genes (14). Moreover, the same group of researchers have detected elaborate sequence and repeat number variability at various SSR loci in the C. albicans genome (11, 24). These observations emphasize the relevance of these elements in this particular yeast species, warranting further studies on possible structure-function relationships.
This study describes computerized identification of additional tri- and tetranucleotide unit SSRs as present in C. albicans sequence entries in the GenBank dataset. PCR assays amplifying these SSRs were developed, and a search for VNTR-type size variation in all of these SSRs was undertaken. Although various scenarios for dissemination of C. albicans in an affected host can be envisaged, we have selected pairs of strains for which genotyping provided evidence that the colonizing cells provided the precursor population for the invading yeast cells. Whether variability in the SSR was associated with the transition from colonization to clinically manifest disease was investigated.
MATERIALS AND METHODS
C. albicans isolates and patients.
Thirty-two isolates of C. albicans were obtained from eleven patients nursed in the surgical intensive care unit of the University Hospital Nijmegen. Strains isolated from five healthy people were included as well. Strains from the patients were classified as being invasive (n = 14; isolated from blood cultures) or mere colonizers (n = 10; isolated from nonsterile sites). From patients, both invasive and colonizing isolates were obtained; strains derived from various sites in healthy people were all considered to be noninvasive (Table 1). For reasons of comparison, two fluconazole-resistant isolates derived from a single individual (6319 and 6713) were included in the study.
TABLE 1.
Clinical and genotyping data for strains included in this studya
| Patient no. or reference | Strain | Clinical material | SSR type
|
No. of identical assays/total (%) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| E1/E2 RAPD | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 25 | 26 | ||||
| Intensive care patients | |||||||||||||||||||||||||||||
| 1 | 4082-26 | Blood | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | |
| 4042-27 | Blood | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | ||
| 4041-10 | Vagina | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | A | 25/25 (100) | |
| 31 | 4394-29 | Blood | C | C | A | C | C | A | B | B | C | C | B | C | B | C | A | C | A | C | B | C | A | A | B | C | C | B | |
| 4395-25 | Blood | C | C | A | C | C | A | B | B | C | C | B | C | B | C | A | C | A | C | B | C | A | A | B | C | C | B | ||
| 4359-09 | Bronchi | C | C | A | C | C | A | B | — | C | C | B | C | B | C | A | C | A | C | B | C | A | A | B | C | C | B | ||
| 4360-08 | Urine | C | C | A | C | C | A | B | B | C | C | B | C | B | C | A | C | A | C | B | C | A | A | B | C | C | B | 25/25 (100) | |
| 39 | 4479-32 | Blood | B | B | B | B | B | B | A | B | B | B | C | B | B | B | A | B | C | B | C | B | B | A | B | B | B | B | |
| 4481-24 | Blood | B | B | B | B | B | B | A | B | B | B | C | B | B | B | A | B | C | B | C | B | B | A | B | B | B | B | ||
| 4454-07 | Mouth | D | D | B | D | D | A | C | A | D | D | D | A | C | D | A | D | B | D | C | B | A | A | A | D | B | B | ||
| 4910-03 | Bronchi | D | D | B | D | D | A | C | A | D | D | D | A | C | D | A | D | B | D | C | B | A | A | A | D | B | B | 7/25 (28) | |
| 43 | 4518-33 | Blood | E | E | B | E | E | C | D | C | E | B | C | A | B | E | B | B | B | E | C | A | C | A | C | B | D | A | |
| 4519-23 | Blood | E | E | B | E | E | C | D | C | E | B | C | A | B | E | B | B | B | E | C | A | C | A | C | B | D | A | ||
| 4471-06 | Bronchi | E | E | B | E | E | C | D | C | E | B | C | A | B | E | B | B | B | E | C | A | C | A | C | B | D | A | ||
| 4494-01 | Feces | E | E | B | E | E | C | D | C | E | B | C | A | B | E | B | B | B | E | C | A | C | A | C | B | D | A | ||
| 4496-02 | Skin | E | E | B | E | E | C | D | C | E | B | C | A | B | E | B | B | B | E | — | A | C | A | C | B | D | A | 25/25 (100) | |
| 57 | 4774-31 | Blood | F | F | B | B | F | B | E | C | C | B | A | C | D | A | B | B | B | F | C | A | B | A | A | C | C | A | |
| 4793-04 | Bronchi | F | F | B | B | F | B | E | C | C | B | A | C | D | A | B | B | B | F | C | A | B | A | A | C | C | A | 25/25 (100) | |
| 4794-05 | Feces | B | B | B | B | B | B | A | B | B | B | A | B | B | F | A | B | B | B | D | B | B | A | C | B | B | A | ||
| 2 | 4060-28 | Blood | B | B | B | B | B | B | A | B | B | B | A | B | B | B | A | B | B | B | — | B | B | A | A | B | B | B | |
| 68 | 4882-30 | Blood | B | B | B | B | I | D | A | B | F | B | A | B | B | F | A | B | C | B | — | B | B | A | A | B | B | A | |
| 90 | 6218-21 | Blood | B | C | A | B | L | A | A | A | G | C | D | A | B | G | A | C | B | C | D | D | B | A | C | B | C | A | |
| 91 | 6260-19 | Blood | A | C | A | F | A | A | F | A | H | A | A | A | A | G | A | A | A | C | E | A | A | A | A | A | E | A | |
| 92 | 6254-20 | Blood | G | E | B | E | G | C | G | C | I | B | A | A | B | H | B | B | B | E | D | A | C | A | C | B | D | A | |
| Carriers | |||||||||||||||||||||||||||||
| 23 | 4225-16 | Bronchi | G | E | B | E | G | D | G | D | I | B | A | A | B | H | B | B | B | E | D | A | C | A | C | E | D | A | |
| 40 | 4442-15 | Feces | B | C | C | B | B | B | A | B | B | B | A | B | B | I | A | B | B | C | D | B | B | A | B | B | B | A | |
| 50 | 4599-14 | Bronchi | H | G | A | C | C | A | C | A | C | B | C | D | E | G | A | B | C | G | B | C | B | A | C | F | A | A | |
| 50 | 4633-13 | Feces | H | G | A | C | C | A | C | A | C | B | C | D | E | G | A | B | C | G | B | C | B | A | C | F | A | A | 25/25 (100) |
| 56 | 4817-12 | Urine | C | C | A | C | C | A | B | B | C | C | C | E | B | C | A | C | B | C | B | E | A | A | C | G | C | A | |
| 56 | 4819-11 | Feces | C | C | A | C | C | A | B | B | C | C | C | E | B | C | A | C | B | C | B | E | A | A | C | G | C | A | 25/25 (100) |
| 87 | 5639-18 | Feces | B | B | B | B | B | B | A | B | B | B | C | B | B | B | C | B | C | B | D | B | B | A | B | B | B | A | |
| 87 | 5721-17 | Bronchi | I | B | B | B | B | B | A | B | B | B | A | B | D | B | A | B | C | B | C | B | B | A | C | B | — | A | 19/24 (79) |
| Fluconazole-resistant and -sensitive isogenic pair of strains | |||||||||||||||||||||||||||||
| Reference 43 | 6319 | H | B | G | H | F | B | E | L | E | A | A | D | L | A | E | C | H | C | A | B | A | A | D | — | A | |||
| 6713 | H | B | G | H | F | B | E | L | E | A | A | D | L | A | E | C | H | C | A | B | A | A | D | — | A | 24/24 (100) | |||
VNTR amplification assays 1 and 17, 4 and 8, and 9 and 15 are pairwise similar (see Table 2 for overlap in primer sequences). Strains 6319 and 6713 were obtained from a single patient, early and late in therapy, respectively. Primers chosen for SSR 24 did not successfully amplify DNA. Assays 1 and 17, 4 and 8, and 9 and 15 are for pairwise identical SSRs, respectively. Note that the number of different letter codes given per SSR type column identifies the number of different banding patterns observed. —, no data available.
Computerized search for C. albicans SSRs.
All C. albicans DNA sequences deposited in the GenBank collection (May 1996 issue) were screened for the occurrence of repetitive DNA, with emphasis on repeats consisting of tri- and tetranucleotide motifs. Screening was performed with a previously described computer program that is freely available through the worldwide web (http:-//ALCES.MED.UMN.EDU/webrepeat.htmL; see also reference 44). The repeats that were organized in tandem and thus presented as potential VNTRs are identified in Table 2.
TABLE 2.
SSRs detected by computerized GenBank database screening
| VNTRa
|
Repeat unit | Repeat motif | Position with respect to gene
|
Primer
|
Length
|
No. of typesc | Reference | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| No. | GenBank entry code | +/− | Gene involved | No. | Sequence | PCR product (bp) | Poly(Q)b | ||||
| 1 | CACCN1 | 3 | (CAA)7 | + | G1 cyclin | 01 | TCCTAAATCTTATCATGACA | 72 | 7 | 8 | 34 |
| 02 | GATGTGGAGGACCATATTTG | ||||||||||
| 2 | CACDC3G | 3 | (TGT)5/(TAC)5d | − | Noncoding | 03 | TCAGGTTTTTTTTTTAGTTT | 180 | 3 | 9 | |
| 04 | TACCGATCAATCAATACCAT | ||||||||||
| 3 | CACDR1 | 3 | (TTG)6 | − | Noncoding | 05 | AAATATAATAGACGTTTTTA | 68 | 7 | 33 | |
| 06 | AGGTATAAATAATTACTCTA | ||||||||||
| 4 | CACEF3G | 3 | (TTC)6 | − | Noncoding | 07 | TCTTATAATTTCTTTCTTTC | 68 | 10 | 28 | |
| 08 | ATGTTGTTGATAAAAAGAAG | ||||||||||
| 5 | CAEFGTF | 3 | (CAA)6/(CAG)5 | + | Transcription factor | 09 | TCAACAGACTGGACAGACAG | 83 | 11 | 5 | 39 |
| 10 | ATCTGTTGTAGGTATTGTAA | ||||||||||
| 6 | CAMNT2GEN | 3 | (AAC)6 | + | Mannosyltransferase | 11 | CCACCACAATCACCTTCATC | 68 | 5 | 7 | DSg |
| 12 | TTGACGATTTGATCTTGGTT | ||||||||||
| 7 | CAREBEME | 3 | (GAA)6 | − | Noncoding | 13 | GAATCATGAAACAGAAACTG | 68 | 5 | 12 | |
| 14 | TGGGTGAAGGATAATCTGCA | ||||||||||
| 8 | CATEF3G | 3 | (CTT)6 | − | Noncoding | 15 | CTTCTTATAATTTCTTTCTT | 68 | 10 | 8 | |
| 16 | AAATGTTGTTGATAAAAAGA | ||||||||||
| 9 | CAU15152 | 3 | (CAA/CAG)22 | + | Transcription factor | 17 | TATGATTGGCATGATTCCAC | 146 | 9 + 13 | 5 | 19 |
| 18 | TCTTTTTAGTCATTGTAGAA | ||||||||||
| 10 | CAU29369 | 3 | Multiplee | + | Hyphal wall protein | 19 | ATGAGATTATCAACTGCTCA | 704 | Rich | 4 | 38 |
| 20 | GTTTTTGGAGTAGTAGATGA | ||||||||||
| 11 | CAU35070a | 3 | (CAG)2/(CAA)7 | + | Integrin-like protein | 21 | TCAATCGATATACAACAAAC | 90 | 12 | 5 | 13 |
| 22 | ATCAATTAAATTATTGTCGG | ||||||||||
| 12 | CAU35070b | 3 | (CAT)6 | + | Integrin-like protein | 23 | GCCTCGTGAAAAGCAAAAGC | 80 | 9 His | 5 | 13 |
| 24 | CACCCGGAATATCAGTTTTT | ||||||||||
| 13 | CAU35070c | 3 | (CAA)10 | + | Integrin-like protein | 25 | TGAACCATGGGTAAATTTGA | 92 | 10 + 2 | 10 | 13 |
| 26 | AAATCAAAAGTAGACCTTTC | ||||||||||
| 14 | S75352 | 3 | (CTT)7 | − | Noncoding | 27 | TTAATCTACTTTTCTCTAAA | 71 | 3 | 18 | |
| 28 | GGAGGGTAAGACAACAGTAT | ||||||||||
| 15 | YSAAPRP | 3 | (CAA/CAG)22 | + | Transcription factor | 29 | TATGATTGGCATGATTCCACf | 146 | 9 + 13 | 5 | 23 |
| 30 | TCTTTTTAGTCATTGTAGAAf | ||||||||||
| 16 | YSAARG4A | 3 | (CAA)6 | − | Noncoding | 31 | TTGTCATTAACCGCGCTGGC | 68 | 3 | 17 | |
| 32 | TTGCCTTGTCAAGTTTTTAA | ||||||||||
| 17 | YSACLN1 | 3 | (CAA)7 | + | G1 cyclin | 33 | TCCTAAATCTTATCATGACA | 71 | 7 | 8 | 50 |
| 34 | ATGTGGAGGACCATATTTGA | ||||||||||
| 18 | YSAEBP1A | 3 | (CAT)5 | − | Noncoding | 35 | AACAAATTTCAAACCACTAC | 65 | 5 | 22 | |
| 36 | TAACAATACAAAATTGAAAC | ||||||||||
| 19 | YSAEF1B | 3 | (CTT)7 | − | Noncoding | 37 | TTTTCCCTCGTCATCTTGAT | 71 | 5 | 41 | |
| 38 | GACTATAATGTGTGAAGAAA | ||||||||||
| 20 | YSAZNF1 | 3 | (CAA)11 | + | Zinc finger protein | 39 | GATAAACTACAGCAGGTTCA | 83 | 11 | 3 | 50 |
| 40 | TGTGGCGGATATTGCTGGTA | ||||||||||
| 21 | CAU46158 | 3 | (CAA/CAG)12 | + | RAS-related protein RSR1 | 49 | GAAACAACAAAAAGAATTAC | 104 | 7 + 5 | 1 | DS |
| 50 | CAGACGATTTGGATTTTCCT | ||||||||||
| 22 | CAACT1A | 4 | (GATT)4 | − | Noncoding, actin intron | 41 | CCCTTTTTCAAAGTTCACGT | 66 | 3 | 21 | |
| 42 | GTTTTGAAACCACTGCCGAC | ||||||||||
| 23 | CACDC3G | 4 | (AGTA)8 | − | Noncoding | 43 | GATATAATTGCTACAGAGTG | 90 | 7 | 9 | |
| 44 | CACAAGATTAAAATGTTCAA | ||||||||||
| 24 | CACEF3G | 4 | (TTTC)5/(GA)8 | − | Noncoding (T rich) | 45 | TGTTAATTAAGATATGAGAA | 310 | 28 | ||
| 46 | ACATTTTCCAAAATGTTGTT | ||||||||||
| 25 | CAU46158 | 4 | (CAAT)5 | − | 3′ noncoding RSR1 | 47 | AGGAAGCAAGTTCTGCACAA | 70 | 5 | DS | |
| 48 | TAATACATATATATATAGAT | ||||||||||
| 26 | YSACARPEP | 4 | (CTTT)5 | − | Noncoding | 51 | GTAACTACAAAAAAATTCCC | 70 | 2 | 27 | |
| 52 | GTCCTTGAAGTTAATTGGGA | ||||||||||
VNTRs 1 and 17, 9 and 15, and 4 and 8, though based on different GenBank entries, involve the same gene.
Number of glutamine residues present at the protein level.
Number of different DNA banding patterns obtained after native polyacrylamide gel electrophoresis.
PCR product includes an interrepeat region of approximately 100 bp.
Both short motif (CAA/CAG) repeats and a repeat comprising 30 nucleotides are present; the primers amplify the entire gene.
Identical to sequence deduced for CAU15152; the sequences of the same gene were published by two groups.
DS, direct submission.
RAPD analysis of C. albicans strains.
RAPD (rapid amplification of polymorphic DNA ends) analysis was performed for all of the C. albicans isolates with the help of the ERIC1-ERIC2 primer combination. Primers were included in a single assay, and amplification was performed as described previously (45, 46). Amplicons were length separated by agarose gel electrophoresis and photographed after ethidium bromide staining upon UV transillumination. For definition of genotypes, single band differences were ignored.
VNTR analysis of C. albicans strains.
For each of the SSRs detected by computer analysis, oligonucleotide primers potentially suited for locus-specific amplification were designed according to the following simple rule: 20-nucleotide-long primers were deduced from sequences precisely 5 nucleotides upstream and downstream of the repeat locus (oligonucleotide sequences are given in Table 2). PCRs were performed according to the following general program: 5 min at 94°C for predenaturation, followed by 40 cycles of 1 min at 94°C, 1 min at 52°C, and 1 min at 74°C. After PCR, the amplicons were size separated by polyacrylamide gel electrophoresis at a constant current of 9 mA for 18 h in 14 to 15% polyacrylamide gels (40% acrylamide-bisacrylamide stock solutions; Bio-Rad, Veenendaal, The Netherlands) and visualized by ethidium bromide staining. In some instances, amplicons were analyzed as well on 10% polyacrylamide gels containing 7 M urea. Banding patterns were scored on the basis of the number of amplicons and the length distribution of the different fragments.
DNA cloning and sequencing.
Some of the SSR-derived amplicons were cloned into the plasmid pCR1 by using a TA cloning kit (Invitrogen, Leek, The Netherlands) according to the manufacturer’s instructions. DNA sequencing was performed with the help of cycle sequencing and an automated ABI 373 DNA sequencer (ABI, Warrington, Great Britain).
RESULTS
Computerized searches for C. albicans SSRs.
Table 2 surveys all of the 26 SSRs, representing potential VNTRs, which were encountered. In addition to the GenBank entry codes, gene identification (where relevant) and repeat compositions are given. PCR primers were chosen as defined above except in cases where complex SSRs (harboring more than one potentially variable region) were present. In these instances, predicted sizes for the PCR products are relatively large because the primers define larger regions of DNA to be amplified. This is the case for SSRs 2, 9, 10, 15, 21, and 24 (Table 2).
Twenty-one trinucleotide SSRs were found by computerized screening of the C. albicans DNA sequence subset of GenBank. Twelve SSRs were located in genes; the other nine were within stretches of noncoding DNA. Most of the C. albicans sequences deposited in GenBank were part of coding regions, which may explain the fact that most of the SSRs identified are located within genes. In six SSRs we encountered mixed repeats, most of which harbored CAA/CAG motifs. Eleven of the SSRs encoded polyglutamine tracts at the protein level, whereas one is expressed as a polyhistidine region. The polyglutamine stretches are within genes, and some of the SSRs identified by GenBank screening appeared to be in the same target sequence. More specifically, SSR 9 equals SSR 15, SSR 1 is identical to SSR 17, and SSR 8 is homologous to SSR 4. The references cited in Table 2 show that sequences were documented in duplicate by independent researchers. Some sequence heterogeneity is encountered in the DNA bordering the SSR, which is sometimes reflected by differences in primer sequences aiming at homologous SSRs (for instance, primers 7 and 8 versus primers 15 and 16 [Table 2]). SSR 10 covers a large region of a hyphal wall protein gene (38) which harbors large and short repeats.
Overall, five potential VNTRs consisting of tetranucleotide unit sequences were retrieved from GenBank. All of these repeats were located in noncoding DNA, one being located in the intron of an actin gene (21). One of these tetranucleotide SSRs was located in the vicinity of a (GA)8 dinucleotide SSR, as such establishing a complex repeat region.
PCR-mediated amplification of C. albicans DNA.
To determine whether the colonizing strain served as a precursor reservoir for the invasive strain, gross genetic identity must be assessed. For this reason, overall genome homogeneity between the paired strains derived from individual patients was determined by RAPD analysis. This analysis revealed that in four of five cases where paired isolates were available, the nature of the colonizer strain was identical to that of the invasive isolate (Table 1). Based on these data, strains could be separated into homologous pairs (patients 1, 31, 43, and 57) or were deemed unrelated, unique isolates (patient 39).
Data obtained by the individual PCR assays aiming at VNTR amplification are summarized in Tables 1 and 2. Table 2 gives an inventory of all of the different VNTR sizing assays, relating specific VNTRs (1 to 26) to the number of different banding patterns or types that were encountered after electrophoretic analysis of amplicons on native polyacrylamide gels (Fig. 1 shows some examples). Depending on the assay, between one and nine DNA bands were visualized. Based on these studies, it can be stated that all of the SSRs that were successfully amplified represent genuine VNTRs except for SSR 21, where a single, identically sized DNA fragment was amplified from all DNA samples. When amplicons were reanalyzed on denaturing polyacrylamide gels, banding patterns were significantly simplified. Most likely the urea induced denaturation of aberrant, multimeric DNA conformers. In these instances, only single or double bands were observed per VNTR. The variability among strains was maintained, however, in agreement with the expectations for a homo- or heterozygous diploid genome as is the case for C. albicans. Since the complex banding patterns obtained upon native electrophoresis were not essentially different with respect to the genotyping results in comparison with the simple patterns obtained upon denaturation, we decided to analyze VNTR polymorphisms by using native gels only. Of 26 assays, 6 were duplicate tests for three different loci. One of these gave rise to different data depending on the (subtly differing) primer set used (VNTRs 4 and 8). Only a single assay failed in the amplification step (SSR 24), possibly because the stringency applied during annealing in the PCR was too high. This SSR is located in a region with a high A/T base content. One of the assays (VNTR 21) generated the same product for all strains examined thus far. All other assays (24 of 26 [92%]) showed various degrees of pattern variability, emphasizing the relative ease and certainty with which the procedure described here identifies polymorphic DNA regions within Candida DNA.
FIG. 1.
Experimental data obtained by VNTR amplification using DNA from the C. albicans strains described in Table 1 as the template. Samples were analyzed on native polyacrylamide gels. Size markers (10-bp ladder; Gibco BRL, Etten Leur, The Netherlands) as well as strain and patient numbers are indicated. Strains derived from a single patient are bracketed. The nature of each VNTR analyzed, identified by GenBank entry code, is indicated on the right (C, coding region; NC, noncoding region; tri, repeated trinucleotide motif; tetra, repeated tetranucleotide motif). Note that YSAZNF1 represents one of the polyglutamine-encoding VNTRs which are located within genes. Note that strain 5023-22 (patient 72) behaves aberrantly, with some of the assays negative in amplification. The data for this isolate were deleted from Results since the strain represented a non-C. albicans yeast of unspecifies nature upon mycological reanalysis.
Table 1 summarizes the genomic compositions of all different VNTRs for all of the strains by SSR type. The number of different VNTR types is indicated in Table 2. The pair of strains showing different susceptibility to fluconazole (strains 6319 and 6713) cannot be separated on the basis of differing VNTR profiles. Identical pairs of strains from the healthy carriers, defined on the basis of identical RAPD patterns (patients 50 and 56), were also identical in the VNTR allele sizing assays. Interestingly, strains derived from two different individuals (40 and 87) which share RAPD type B are still 64% (16 of 25 assays) identical with respect to VNTR profiles. The resolving capacities of VNTR sizing can best be read from data obtained for the incidental single blood isolates from unrelated patients (2, 68, and 90 to 92). Although some of the strains share the same RAPD type, the homology at the VNTR level is clearly reduced. Only strains 4060-28 and 4882-30 (RAPD type B) share 18 of 24 VNTR types (75% identical). When all the other strains are compared in a single matrix, the homology values vary between 13 and 38% (average, 27%). This result suggest that for typing purposes, the threshold separating related and nonrelated strains may be in the order of 40% VNTR identity.
VNTR composition in relation to C. albicans invasion.
The paired superficial and invasive C. albicans isolates enable the analysis of VNTR polymorphisms in relation to the transition from colonization to dissemination and/or invasion. Table 1 demonstrates the following. Analysis of the strains from patient 39 reveals that the colonizing strain is completely different from the invasive strain. This observation, substantiated by both RAPD and VNTR typing, suggests that yeast infection was not caused by an autologous strain in this patient or that not all colonizing strains were identified by culture techniques. Patients 1, 31, 43, and 57 show the other end of the spectrum: in these cases neither RAPD nor VNTR analysis separates the invasive from the colonizing strain. Full identity is observed at both levels. Note that patient 57 was colonized with multiple C. albicans strains. Unrelated strains can be well resolved by VNTR mapping. However, when invasive and colonizing strains are compared, they appear to be either fully identical or completely different. No consistently variable VNTR, distinguishing invasive from colonizing strains with identical RAPD genotype, was detected.
VNTR sequencing.
Unidirectional sequencing was initially confined to six clones derived from three C. albicans DNA samples amplified for VNTR 9. This VNTR contains a consensus (CAA/CAG)22 sequence motif (Table 2). The base order in the different clones revealed some changes in the repeat region all restricted to the polyglutamine stretches. Three of the six clones analyzed harbored a number of repeats that was concordant with published data (19). One clone demonstrated an A-to-T mutation in a CAA codon, which leads to a change from glutamine to leucine at the amino acid level. In one clone, a single CAA codon was missing, whereas the last clone missed both a CAA and a CAG repeat unit. Bidirectional sequencing of the VNTR 9 products cloned for C. albicans 4060-28, 4394-29, and 4518-33 essentially confirmed the data mentioned above. Again, polymorphisms were restricted to the repeat moieties (Table 3). VNTR 7 sequencing for the amplicon obtained with DNA from strain 6319 revealed the presence of 6 GAA units, which is concordant with literature data (12). To substantiate the observation that variability was restricted to the repetitive domains, additional bidirectional sequencing was performed for VNTR 23, an SSR containing tetranucleotide units. Variability was once more restricted to the repeat domain, although the sequences determined for the interrepeat parts were slightly different from those reported before (Table 3 and reference 9).
TABLE 3.
Sequences as determined for a number of clones derived from VNTR amplificationsa
| VNTR | Source | Allele | Sequence |
|---|---|---|---|
| 23 (CACDC3Gb) | 9 | 5′-(TACT) T (TACT)8 GG (TACT)-3′ | |
| Strain 4041-10 | 1 | 5′-(TACT) T (TACT)6 AG (TACT)-3′ | |
| 2 | 5′-(TACT) T (TACT)9 GG (TACT)-3′ | ||
| Strain 4082-26 | 1 | 5′-(TACT) T (TACT)6 AG (TACT)-3′ | |
| 2 | 5′-(TACT) T (TACT)9 GG (TACT)-3′ | ||
| 9 (CAU15152) | 19 | 5′-CTCAC (CAG) (CAA)2(CAG) (CAA)5 –––– (CAA)5(CAG)3(CAA)3 CCTTC-3′ | |
| Strain 4060-28 | 1 | 5′-CTCAC (CAA)3(CAG) (CAA)5 –––– (CAA)4(CAG)4(CAA)3 CCTTC-3′ | |
| 2 | 5′-CTCAC (CAA)3(CAG) (CAA)5 –––– (CAA)5(CAG)5(CAA)3 CCTTC-3′ | ||
| Strain 4394-29 | 1 | 5′-CTCAC (CAA)3(CAG) (CAA)5 –––– (CAA)5(CAG)4(CAA)3 CCTTC-3′ | |
| 2 | 5′-CTCAC (CAA)3(CAG) (CAA)2(CTA) (CAA)2 –––– (CAA)5(CAG)5(CAA)3 CCTTC-3′ | ||
| Strain 4518-33 | 1 | 5′-CTCAC (CAA)3(CAG) (CAA)5 –––– (CAA)4(CAG)4(CAA)3 CCTTC-3′ | |
| 2 | 5′-CTCAC (CAA)3(CAG) (CAA)5 –––– (CAA)5(CAG)5(CAA)3 CCTTC-3′ | ||
| Strain 6319 | 1 | 5′-CTCAC (CAG) (CAA)2(CAG) (CAA)5 –––– (CAA)5(CAG)3(CAA)3 CCTTC-3′ | |
| Strain 4084-26 | 1 | 5′-CTCAC (CAA)3(CAG) (CAA)5 –––– (CAA)5(CAG)5(CAA)3 CCTTC-3′ | |
| 2 | 5′-CTCAC (CAG) (CAA)2(CAG) (CAA)5 –––– (CAA)9(CAG)4(CAA)3 CCTTC-3′ |
The sequence of allele 2 for strain 6319 could not be determined, but the number of CAG/CAA trinucleotide repeats was 23. The arrow points at an A/G variable site in VNTR 23; the dashed lines in the VNTR 9 sequences identify a nonrepetitive constant sequence motif.
GenBank entry code.
DISCUSSION
Scattered throughout both prokaryotic and eukaryotic genomes, continuous stretches of repetitive DNA occur in an apparently random fashion (42). Monotonously repeated, short motifs are thought to evolve rapidly as a consequence of strand slippage during replication, often in combination with defective DNA mismatch repair (40). It was recently suggested that high-frequency transcription of repetitive DNA contributes to size changes as well (2). Variability in repetitive DNA has been associated with various genetically predisposed diseases in humans (5) and with regulation of (virulence) gene expression in several species of prokaryotic microorganisms (43, 47–49). Length variability in different alleles containing VNTRs has been demonstrated for C. albicans on previous occasions; the high-resolution typing capacity of some of these regions was emphasized previously (4, 10, 24), and their putative involvement in regulation of gene expression has been suggested (10).
A putative link between VNTR polymorphism and virulence (or avirulence) of eukaryotic microbial pathogens was recently established for Toxoplasma gondii (6). Based on the nature of a repetitive DNA domain, parasites which show clear virulence in a mouse infection model could be separated from the avirulent strains. This finding raises the question of whether VNTRs controlling fungal invasiveness in a similar fashion exist in the genome of C. albicans. In this respect, it is interesting that several of the VNTRs assayed in the present study encode polyglutamine stretches (10, 11). This type of domain has been shown to be variable in specific human genes such as that encoding the dentatorubral-pallidoluysian atrophy-associated gene product (31). Moreover, the relation between polyglutamine variation and regulation of gene expression was demonstrated for the TATA binding protein (15), whereas model studies revealed that transcription activation was dependent on the number of glutamine residues present in a transcriptional activator (14). Another of the repeat-containing genes (CAU29369, VNTR 10 [Table 2]) (38) was shown to encode a protein that is expressed in the hyphal state only. This protein provides an example of a surface-located structure containing both large and short repeat motifs, for which we here describe different-size allelic variants (Table 1). It is interesting that among various species of prokaryotes, examples of so-called microbial surface components recognizing adhesive matrix molecules show similarities in structural organization and surface association (32). Many of these factors are considered to be possible virulence factors.
Recently, VNTR sizing using DNA sequencing gels was suggested to be a valuable molecular typing procedure amenable to automation and standardization (3). Besides the fact that it may not fully recognize the high spontaneous mutation rates for these loci, performance of single-assay VNTR mapping studies is inadequate. Here we demonstrate that the results of separate VNTR mappings may lead to different conclusions because of different levels of resolution. It is suggested that multiple VNTRs need to be monitored in order to reliably establish potential relatedness between strains of C. albicans. Moreover, our data show that strains that are epidemiologically unrelated may still be identical for approximately 40% of their VNTRs. With respect to the design of generally applicable guidelines for the epidemiological interpretation of VNTR mapping data, this observation suggests that identity of 50% of the VNTRs may indicate that strains are at least remotely related. Strains sharing in the order of 90% of the VNTR types may be considered to have a recent common ancestor; additional validation studies, covering large collections of epidemiologically and genetically well-defined strains of C. albicans, are still required. Sequencing of more of the alleles may shed light on the precise mode of VNTR evolution, but our preliminary data conform with the suggestion that length alterations are dependent on the variability of the number of directly repeated DNA motifs.
Quite frequently also the sequences that immediately border the repeats are liable to variability (e.g., reference 24). This may be an obstacle to the design of adequate PCR tests. However, our current experience is that this may not be a frequently occurring problem: in only 1 of the 26 assays described in this report (Table 1) was DNA amplification unsuccessful. Furthermore, as was demonstrated previously as well (10, 11), the assays are reproducible on a day-to-day basis and VNTR changes do not arise upon in vitro passaging of the strains (results not shown).
Our present studies do not provide evidence for concordant changes in one or more specific VNTRs in relation with the transition from mere colonization to invasive disease. This may reflect a shortcoming in the type and number of VNTRs analyzed or, alternatively, indicate that repeat variability is not associated with pathogenicity transitions in C. albicans. This lack of apparent changes in the VNTRs analyzed may also be due to the fact that for the specific group of patients studied here, the immune-competence status does not require any adaptive behavior for the C. albicans strain to take place. The computer search used for the detection of VNTRs was performed more than a year ago, and in the meantime additional examples of repeat containing genes have been presented. The transcriptional repressor gene TUP1, for instance, encodes a product containing a very substantial polyglutamine stretch (3). When TUP1 is site-specifically mutated, the yeast can grow only in the hyphal state, showing its possible importance in the transition from colonization to invasion. Moreover, deletion of the ras-related gene (CAU46158, VNTR 21 [Table 2]) resulted in problematic bud site selection and attenuated virulence, and more examples are proposed in current literature. Several authors link entire genes containing VNTRs to pathogenicity-related features of C. albicans (e.g., references 20, 38, and 51). Our data do not indicate that the VNTRs that are located in putative virulence genes (for instance, SSRs 10, 11 to 13, and 21 [Table 2]) show a degree of variability that is substantially different from that observed for the VNTRs that are not associated with potential virulence genes. It is quite possible that the variability in many of the polyglutamine-encoding VNTR targets (as described in this report) in a concerted fashion determines the differentiating capacity of a C. albicans cell. Additional studies including strains from patients undergoing recurrent infections (e.g., vaginal candidosis or oropharyngeal candidosis) may provide strain pairs that prove to be more informative.
ACKNOWLEDGMENTS
The first two authors contributed equally to this work.
Lidia Licciardello was supported by a grant from the University of Catania (Sicily, Italy) and was on leave in the University Hospital Rotterdam at the time of these studies.
REFERENCES
- 1.Banerjee S N, Emori T G, Culver D H, Gaynes G P, Jarvis W R, Huran T. Secular trends in nosocomial primary bloodstream infections in the United States. Am J Med. 1991;91:86S–89S. doi: 10.1016/0002-9343(91)90349-3. [DOI] [PubMed] [Google Scholar]
- 2.Bowater R P, Jaworski A, Larson J E, Parniewski P, Wells R D. Transcription increases the deletion frequency of long CTG.CAG triplet repeats from plasmids in Escherichia coli. Nucleic Acids Res. 1997;25:2861–2868. doi: 10.1093/nar/25.14.2861. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Braun B R, Johnson A D. Control of filament formation in Candida albicans by the transcriptional repressor TUP1. Science. 1997;277:105–109. doi: 10.1126/science.277.5322.105. [DOI] [PubMed] [Google Scholar]
- 4.Bretagne S, Costa J, Besmond C, Carsique R, Calderone R. Microsatellite polymorphism in the promoter sequence of the elongation factor 3 gene of Candida albicans as the basis for a typing system. J Clin Microbiol. 1997;35:1777–1780. doi: 10.1128/jcm.35.7.1777-1780.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Caskey C T, Pizzuti A, Fu Y-H, Fenwick R G, Nelson D L. Triplet repeat mutations in human disease. Science. 1992;256:784–789. doi: 10.1126/science.1589758. [DOI] [PubMed] [Google Scholar]
- 6.Costa J M, Darde M, Assouline B, Vidaud M, Bretagne S. Microsatellite in the beta-tubulin gene of Toxoplasma gondii as a new genetic marker for use in direct screening of amniotic fluids. J Clin Microbiol. 1997;35:2542–2545. doi: 10.1128/jcm.35.10.2542-2545.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Deitsch K W, Moxon E R, Wellems T E. Shared themes of antigenic variation and virulence in bacterial, protozoal, and fungal infections. Microbiol Mol Biol Rev. 1997;61:281–293. doi: 10.1128/mmbr.61.3.281-293.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.DiDomenico B J, Lupisella J, Sandbaken M, Chakraburtty K. Isolation and sequence analysis of the gene encoding translation elongation factor 3 from Candida albicans. Yeast. 1992;8:337–352. doi: 10.1002/yea.320080502. [DOI] [PubMed] [Google Scholar]
- 9.DiDomenico B J, Brown N H, Lupisella J, Greene J R, Yanko M, Koltin Y. Homologs of the yeast neck filament associated genes: isolation and sequence analysis of Candida albicans CDC3 and CDC10. Mol Gen Genet. 1994;242:689–698. doi: 10.1007/BF00283424. [DOI] [PubMed] [Google Scholar]
- 10.Field D, Wills C. Long, polymorphic microsatellites in simple organisms. Proc R Soc Lond B. 1996;263:209–215. doi: 10.1098/rspb.1996.0033. [DOI] [PubMed] [Google Scholar]
- 11.Field D, Eggert L, Metzgar D, Rose R, Wills C. Use of polymorphic short and clustered coding-region microsatellites to distinguish strains of Candida albicans. FEMS Immunol Med Microbiol. 1996;15:73–79. doi: 10.1111/j.1574-695X.1996.tb00056.x. [DOI] [PubMed] [Google Scholar]
- 12.Fling M E, Kopf J, Tamarkin A, Gorman J A, Smith H A, Koltin Y. Analysis of a Candida albicans gene that encodes a novel mechanism for resistance to benomyl and methotrexate. Mol Gen Genet. 1991;227:318–329. doi: 10.1007/BF00259685. [DOI] [PubMed] [Google Scholar]
- 13.Gale C, Finkel D, Tao N, Meinke M, McClellan M, Olson J, Kendrick K, Hostetter M. Cloning and expression of a gene encoding an integrin like protein in Candida albicans. Proc Natl Acad Sci USA. 1996;93:357–361. doi: 10.1073/pnas.93.1.357. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Gerber H P, Seipel K, Georgiev O, Hofferer M, Hug M, Rusconi S, Schaffner W. Transcription activation modulated by homopolymeric glutamine and proline stretches. Science. 1994;263:808–811. doi: 10.1126/science.8303297. [DOI] [PubMed] [Google Scholar]
- 15.Gostout B, Liu Q, Sommer S S. Cryptic repeating triplets of purines and pyrimidines (cRRY(i)) are frequent and polymorphic: analysis of coding cRRY(i) in the proopiomelanocortin (POMC) and TATA binding protein (TBP) genes. Am J Hum Genet. 1993;52:1182–1190. [PMC free article] [PubMed] [Google Scholar]
- 16.Hood D W, Deadman M E, Jennings M P, Bisercic M, Fleischmann R D, Venter J C, Moxon E R. DNA repeats identify novel virulence genes in Haemophilus influenzae. Proc Natl Acad Sci USA. 1996;93:11121–11125. doi: 10.1073/pnas.93.20.11121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Hoyer L L, Magee B B, Rikkerink E H, Scherer S. The Arg4 gene of Candida albicans. Gene. 1994;142:213–218. doi: 10.1016/0378-1119(94)90263-1. [DOI] [PubMed] [Google Scholar]
- 18.Kelly R, Kwon-Chung K J. A zinc finger protein from Candida albicans is involved in sucrose utilization. J Bacteriol. 1992;174:222–232. doi: 10.1128/jb.174.1.222-232.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Liu H, Kohler J, Fink G R. Suppression of hyphal formation of Candida albicans by mutation of a STE12 homolog. Science. 1994;266:1723–1726. doi: 10.1126/science.7992058. [DOI] [PubMed] [Google Scholar]
- 20.Lo H, Koehler J R, DiDomenico B, Loebenberg D, Cacciapuoti A, Fink G R. Non filamentous C. albicans mutants are avirulent. Cell. 1997;90:939–949. doi: 10.1016/s0092-8674(00)80358-x. [DOI] [PubMed] [Google Scholar]
- 21.Losberger C, Ernst J F. Sequence of the Candida albicans gene encoding actin. Nucleic Acids Res. 1989;17:9488. doi: 10.1093/nar/17.22.9488. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Madani N D, Malloy P J, Rodriguez-Pombo P, Krishnan A V, Feldman D. Candida albicans estrogen binding protein gene encodes an oxidoreductase that is inhibited by estradiol. Proc Natl Acad Sci USA. 1994;91:922–926. doi: 10.1073/pnas.91.3.922. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Malathi K, Ganesan K, Datta A. Identification of a putative transcription factor in Candida albicans that can complement the mating defect on Saccharomyces cerevisiae ste12 mutants. J Biol Chem. 1994;269:22945–22951. [PubMed] [Google Scholar]
- 24.Metzgar, D., D. Field, R. Haubrich, and C. Wills. Sequence analysis of a compound coding region microsatellite in Candida albicans resolves homoplasies and provides a high-resolution tool for genotyping. FEMS Immunol. Med. Microbiol., in press. [DOI] [PubMed]
- 25.Morrow B, Srikantha T, Soll D R. Transcription of the gene for a pepsinogen PEP1 is regulated by white-opaque switching in Candida albicans. Mol Cell Biol. 1992;12:2997–3005. doi: 10.1128/mcb.12.7.2997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Morrow B, Srikantha T, Anderson J, Soll D R. Coordinate regulation of two opaque specific genes during white-opaque switching in Candida albicans. Infect Immun. 1993;61:1823–1828. doi: 10.1128/iai.61.5.1823-1828.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Mukhtar M, Logan D A, Kaufer N F. The carboxypeptidase Y-encoding gene from Candida albicans and its transcription during yeast-to-hyphae conversion. Gene. 1992;121:173–177. doi: 10.1016/0378-1119(92)90178-r. [DOI] [PubMed] [Google Scholar]
- 28.Myers K K, Fonzi W A, Sypherd P S. Isolation and sequence analysis of the gene for translation elongation factor 3 from Candida albicans. Nucleic Acids Res. 1992;20:1705–1710. doi: 10.1093/nar/20.7.1705. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Odds F C. Candida and candidosis: a review and bibliography. London, United Kingdom: Bailliere Tindale; 1988. [Google Scholar]
- 30.Odds F C. Candida species and virulence. ASM News. 1994;60:313–318. [Google Scholar]
- 31.Onodera O, Oyake M, Takano H, Ikeuchi T, Igarashi S, Tsuji S. Molecular cloning of a full-length cDNA for dentatorubral-pallidoluysian atrophy and regional expressions of the expanded alleles in the CNS. Am J Hum Genet. 1995;57:1050–1060. [PMC free article] [PubMed] [Google Scholar]
- 32.Patti J M, Allen B L, McGavin M J, Höök M. MSCRAMM-mediated adherence of microorganisms to host tissues. Annu Rev Microbiol. 1994;48:585–617. doi: 10.1146/annurev.mi.48.100194.003101. [DOI] [PubMed] [Google Scholar]
- 33.Prasad R, de Wergifosse P, Goffeau A, Balzi E. Molecular cloning and characterization of a novel gene of Candida albicans, CDR1, conferring multiple resistance to drugs and antifungals. Curr Genet. 1995;27:320–329. doi: 10.1007/BF00352101. [DOI] [PubMed] [Google Scholar]
- 34.Sherlock G, Bahman A M, Mahal A, Shieh J C, Ferreira M, Rosamond J. Molecular cloning and analysis of CDC28 and cyclin homologues from the human fungal pathogen Candida albicans. Mol Gen Genet. 1994;245:716–723. doi: 10.1007/BF00297278. [DOI] [PubMed] [Google Scholar]
- 35.Soll D R. The emerging molecular biology of switching in Candida albicans. ASM News. 1996;62:415–420. [Google Scholar]
- 36.Soll D R, Morrow B, Srikantha T, Vargas K, Wertz P. Development and molecular biology of switching in Candida albicans. Oral Surg Oral Med Oral Pathol. 1994;78:194–201. doi: 10.1016/0030-4220(94)90147-3. [DOI] [PubMed] [Google Scholar]
- 37.Srikantha T, Chandrasekhar A, Soll D R. Functional analysis of the promoter of the phase-specific WH11 gene of Candida albicans. Mol Cell Biol. 1995;15:1797–1805. doi: 10.1128/mcb.15.3.1797. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Staab J F, Ferrer C A, Sundstrom P R. Developmental expression of a tandemly repeated proline and glutamine rich amino acid motif on hyphal surfaces on Candida albicans. J Biol Chem. 1996;271:6298–6305. doi: 10.1074/jbc.271.11.6298. [DOI] [PubMed] [Google Scholar]
- 39.Stoldt V R, Sonneborn A, Leuker C E, Ernst J F. Efg1p, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi. EMBO J. 1994;16:1982–1991. doi: 10.1093/emboj/16.8.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Strand M, Prolla T A, Liskay R M, Petes T D. Destabilisation of tracts of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair. Nature. 1993;365:274–276. doi: 10.1038/365274a0. [DOI] [PubMed] [Google Scholar]
- 41.Sundstrom P, Smith D, Sypherd P S. Sequence analysis and expression of the two genes for elongation factor 1-alpha from the dimorphic yeast Candida albicans. J Bacteriol. 1990;172:2036–2045. doi: 10.1128/jb.172.4.2036-2045.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Tautz D, Schlotterer C. Simple sequences. Curr Opin Genet Dev. 1994;4:832–837. doi: 10.1016/0959-437x(94)90067-1. [DOI] [PubMed] [Google Scholar]
- 43.Van Belkum, A., S. Scherer, L. van Alphen, and H. A. Verbrugh. Variable number of tandem DNA repeats in prokaryotic genomes. Microbiol. Mol. Biol. Rev., in press. [DOI] [PMC free article] [PubMed]
- 44.Van Belkum A, Scherer S, van Leeuwen W, Willemse D, van Alphen L, Verbrugh H. Variable number of tandem repeats in clinical strains of Haemophilus influenzae. Infect Immun. 1997;65:5017–5027. doi: 10.1128/iai.65.12.5017-5027.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Van Belkum A, Melchers W, de Pauw B E, Scherer S, Quint W, Meis J F G M. Genotypic characterization of sequential Candida albicans isolates from fluconazole treated neutropenic patients. J Infect Dis. 1994;169:1062–1070. doi: 10.1093/infdis/169.5.1062. [DOI] [PubMed] [Google Scholar]
- 46.Van Belkum A, Mol W, van Saene R, Ball L M, van Velzen D, Quint W. PCR mediated genotyping of Candida albicans strains from bone marrow transplantation patients. Bone Marrow Transplant. 1994;13:811–815. [PubMed] [Google Scholar]
- 47.Van der Ende A, Hopman C T, Zaat S, Essink B B, Berkhout B, Dankert J. Variable expression of class I outer membrane protein in Neisseria meningitidis is caused by variation in the spacing of the −10 and −35 regions of the promoter. J Bacteriol. 1995;177:2475–2480. doi: 10.1128/jb.177.9.2475-2480.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Van Ham S M, van Alphen L, Mooi F R, van Putten J P M. Phase variation of Haemophilus influenzae fimbriae: transcriptional control of two divergent genes through a variable combined promoter region. Cell. 1993;73:1187–1196. doi: 10.1016/0092-8674(93)90647-9. [DOI] [PubMed] [Google Scholar]
- 49.Weiser J N, Love J M, Moxon E R. The molecular mechanism of phase variation of Haemophilus influenzae lipopolysaccharides. Cell. 1989;59:657–665. doi: 10.1016/0092-8674(89)90011-1. [DOI] [PubMed] [Google Scholar]
- 50.Whiteway M, Dignard D, Thomas D Y. Dominant negative selection of heterologous genes: isolation of Candida albicans genes that interfere with Saccharomyces cerevisiae mating factor-induced cell cycle arrest. Proc Natl Acad Sci USA. 1991;89:9410–9414. doi: 10.1073/pnas.89.20.9410. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Yaar L, Mevarech M, Koltin Y. A Candida albicans RAS-related gene (CaRSR1) is involved in budding, cell morphogenesis and hypha development. Microbiology. 1997;143:3033–3044. doi: 10.1099/00221287-143-9-3033. [DOI] [PubMed] [Google Scholar]