Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer used for amplification of TLR3 SNPs rs3775291 and rs3775290.
| Gene | Strand type | Sequence (5’-3’) | Guidance | Annealing temperature | Fragment length | Binding site (5’) |
|---|---|---|---|---|---|---|
| TLR3 | Forward (F) | CGGGCTTTTCAATGTGAGG | Sense | 60°C | 678 base pairs (bp). | 186083063 |
| Reverse (R) | GCATAACAACTTAGCACGGCT | Antisense |
5’ binding sites of the TLR3 gene according to the reference sequence NC_000004.12 (NCBI).
