Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 1998 Nov;180(22):5844–5854. doi: 10.1128/jb.180.22.5844-5854.1998

Molecular Characterization of the Lactococcus lactis LlaKR2I Restriction-Modification System and Effect of an IS982 Element Positioned between the Restriction and Modification Genes†

Denis P Twomey 1,‡, Larry L McKay 1, Daniel J O’Sullivan 1,*
PMCID: PMC107656  PMID: 9811640

Abstract

The nucleotide sequence of the plasmid-encoded LlaKR2I restriction-modification (R-M) system of Lactococcus lactis subsp. lactis biovar diacetylactis KR2 was determined. This R-M system comprises divergently transcribed endonuclease (llaKR2IR) and methyltransferase (llaKR2IM) genes; located in the intergenic region is a copy of the insertion element IS982, whose putative transposase gene is codirectionally transcribed with llaKR2IM. The deduced sequence of the LlaKR2I endonuclease shared homology with the type II endonuclease Sau3AI and with the MutH mismatch repair protein, both of which recognize and cleave the sequence 5′ GATC 3′. In addition, M · LlaKR2I displayed homology with the 5-methylcytosine methyltransferase family of proteins, exhibiting greatest identity with M · Sau3AI. Both of these proteins shared notable homology throughout their putative target recognition domains. Furthermore, subclones of the native parental lactococcal plasmid pKR223, which encode M · LlaKR2I, all remained undigested after treatment with Sau3AI despite the presence of multiple 5′ GATC 3′ sites. The combination of these data suggested that the specificity of the LlaKR2I R-M system was likely to be 5′ GATC 3′, with the cytosine residue being modified to 5-methylcytosine. The IS982 element located within the LlaKR2I R-M system contained at its extremities two 16-bp perfect inverted repeats flanked by two 7-bp direct repeats. A perfect extended promoter consensus, which represented the likely original promoter of the llaKR2IR gene, was shown to overlap the direct repeat sequence on the other side of IS982. Specific deletion of IS982 and one of these direct repeats via a PCR strategy indicated that the LlaKR2I R-M determinants do not rely on elements within IS982 for expression and that the efficiency of bacteriophage restriction was not impaired.


Restriction and modification (R-M) systems are widespread among prokaryotes, where they have a role in counteracting bacteriophage proliferation in a manner akin to a primitive immune system (reviewed in reference 20). Their presence in lactococci in conjunction with other natural phage defense mechanisms (i.e., adsorption blocking, injection blocking, and abortive infection [Abi] mechanisms) is of particular economic importance to the dairy fermentation industry, since phage infection of commercial lactococcal starter cultures persists as one of the primary sources of failed or suboptimal fermentations. The persistent challenge posed by phage infection has required the continued search for strains with superior phage-resistant traits to meet the demands of the dairy fermentation industry.

To date, at least eight complete lactococcal R-M systems have been sequenced. Two of these have been classified as type I systems (46, 47), and five have been classified as type II systems; the latter include LlaDCHI (32), LlaBI (34), LlaCI (26), LlaDII (27), and ScrFI (7, 54, 55). The other R-M system described, LlaI, has characteristics reminiscent of both type IIS and type I R-M systems (17, 35). In general, type II systems are composed of two structural genes, an endonuclease and a methyltransferase. However, both the LlaDCHI and ScrFI R-M systems encode two methyltransferases. Comparison of LlaDCHI with the well-characterized DpnII system indicated that in addition to the conventional double-stranded DNA methyltransferase, a single-stranded DNA methyltransferase was encoded, a property which potentially facilitates the uptake of intact DNA via conjugation in Lactococcus lactis (32). Two 5-methylcytosine methyltransferases were identified in the ScrFI R-M system; while the exact role of each has not been established, the second methyltransferase may have evolved to counteract the degeneracy of the ScrFI endonuclease (55).

A prerequisite to fully developing and enhancing phage resistance systems from a biotechnological standpoint is gaining an understanding of how these defense mechanisms are expressed and regulated in vivo. A number of factors have been shown to have an influence on the phenotypic expression of a number of native lactococcal phage resistance determinants. These factors include heat, whereby elevated temperatures similar to those used during the Cheddar cheese cooking process (40°C) render such mechanisms as the LlaI R-M system and the AbiA abortive infection mechanism (originally designated Hsp due to its heat-sensitive phage resistance) less effective in counteracting phage. In addition, insertion sequence (IS) elements have been demonstrated to play a role in the expression of some Abi determinants. A promoter sequence within an iso-ISS1 element located upstream of the abiB gene from L. lactis subsp. lactis IL416 was required for transcription of this gene (6), whereas insertion of IS981 into a fragment originating from the native lactococcal plasmid, pKR223, accounted for the loss of the Abi phenotype (37). Furthermore, IS-mediated rearrangements have contributed to altered resistance phenotypes in the conjugal plasmid pTR2030 (43).

The native lactococcal phage resistance plasmid pKR223, first identified in L. lactis subsp. lactis biovar diacetylactis KR2, was shown to mediate two distinct mechanisms of resistance to bacteriophage infection: an R-M system active against the small isometric-headed phage φsk1, and an Abi mechanism which retards the proliferation of the prolate-headed phage φc2 (25, 30). Other phages, such as φstl1 and φeb1, also exhibited a reduced plaque size on hosts harboring pKR223, an observation predicted to be linked to the presence of the Abi mechanism. By using a streptococcal cloning vector, both resistance mechanisms of pKR223 were subcloned on a 19-kb HpaII fragment, generating a construct designated pGBK17 (25). A combination of deletion derivatives and a natural mutant arising from the fortuitous insertion of a novel lactococcal insertion sequence permitted the general location of both defense mechanisms to be established (30, 37). In this study, we determined the nucleotide sequence and established the precise location of the R-M determinants which contained an IS982 element. We subcloned this region and investigated the effect of the IS element on expression of the R-M phenotype.

MATERIALS AND METHODS

Bacteria, plasmids, and phage.

The strains used in this study included L. lactis subsp. lactis biovar diacetylactis KR2, an industrial starter strain containing seven plasmids including pKR223, which encodes the LlaKR2I R-M system and an Abi mechanism (25); L. lactis subsp. cremoris LM0230, a plasmid-free derivative of L. lactis subsp. cremoris C2 (12) (formerly called subsp. lactis); and L. lactis GBK17, an LM0230 transformant with a 19-kb HpaII fragment of pKR223 cloned into the HpaII site of pGB301 in a construct designated pGBK17 (25). The 5.7-kb Escherichia coli/Lactococcus shuttle vector pCI372 (16) was used to construct the following plasmids: pDOT29, containing a 1.4-kb PCR fragment encoding llaKR2IM and generated by using the primers 5′ GCACTAGTTATAACATATGAAATAG 3′ and 5′ GCGTCGACGATTGATGATAAGGCTG 3′, incorporating the restriction sites SpeI and SalI (underlined), respectively, and cloned into the XbaI and SalI sites of pCI372; pDOT31, containing a 4.1-kb PCR fragment incorporating the entire LlaKR2I R-M system including IS982 and generated by using the primers 5′ GCGGATCCAATCAGTGCCTCTGTTAC 3′ and 5′ GCGTCGACGATTGATGATAAGGCTG 3′, which incorporated the restriction sites BamHI and SalI, respectively, and was cloned into the BamHI and SalI sites of pCI372; pDOT46, containing two separate PCR fragments harboring llaKR2IR (amplified by using the primers 5′ CGGGATCCTTTTAGTATCAACCTGTC 3′ and 5′ CGACTAGTGTAAATAGTTCAGTAGG 3′, incorporating BamHI and SpeI sites, respectively) and llaKR2IM (amplified by using the primers used to construct pDOT29) fused together at an SpeI site; and pDOT51 through pDOT70, 20 8.7-kb PCR-generated constructs consisting of pCI372 and the LlaKR2I R-M system without IS982, amplified by using primers 5′ GTAAATAGTTCAGTAGGTATGAGTATGG 3′ and 5′ TATCATTATAACAGATGAAATAGTTGATCG 3′ and religated following treatment with polynucleotide kinase. E. coli XL1Blue MRF′ (Stratagene, La Jolla, Calif.) served as the host for the construction of pUC19 chimeras containing fragments of pGBK17 for sequencing. The small isometric-headed bacteriophage φsk1 was used for monitoring the R-M phenotype of the LlaKR2I determinants in L. lactis.

Media, enzymes, and culture conditions.

Lactococcal strains and their phage were routinely grown without shaking at 30°C in M17 medium (51) supplemented with 0.5% glucose (M17G). For the enumeration of phage, the base medium and the soft agar (0.75%) overlay were supplemented with 5 mM CaCl2. Where necessary, the antibiotics chloramphenicol (5 μg/ml) and erythromycin (5 μg/ml) were added to media. E. coli was grown in Luria-Bertani (LB) medium (45) at 37°C with aeration. E. coli cells containing pUC19 chimeras were maintained by the addition of ampicillin (100 μg/ml), and recombinants were selected for on LB agar supplemented with 5-bromo-4-chloro-3-indolyl-β-d-galactosidase (X-Gal; 30 μg/ml) and isopropyl-β-d-thiogalactopyranoside (IPTG; 30 μg/ml).

Molecular cloning procedures.

Restriction enzymes, T4 DNA ligase, polynucleotide kinase, and the Klenow fragment from DNA polymerase I were purchased from either New England Biolabs (Beverly, Mass.) or Promega Corporation (Madison, Wis.) and used according to the manufacturers’ instructions. Plasmid DNA for sequencing was isolated from E. coli by using a QIAGEN plasmid mini kit (QIAGEN Inc., Chatsworth, Calif.). A similar kit was used for the isolation of lactococcal DNA except that the following modifications were incorporated into the procedure: 10 ml of an overnight culture of L. lactis was pelleted; the cells were resuspended in 300 μl of buffer P1 (50 mM Tris-HCl, 10 mM EDTA [pH 8.0]) supplemented with RNase A (100 μg/ml) and lysozyme (30 mg/ml) and then incubated at 37°C for 30 min. Thereafter, the procedure outlined for the isolation of E. coli DNA was conducted. Large amounts of lactococcal plasmid DNA were isolated by the method of Anderson and McKay (4) and purified by CsCl-ethidium bromide density gradient centrifugation. Electrotransformation of DNA was performed with a Bio-Rad Gene Pulser apparatus (Bio-Rad Corp., Richmond, Calif.) according to manufacturer’s instructions for E. coli or by the method described by Holo and Nes (18) for L. lactis.

PCR.

All PCRs were performed with a Robocycler Gradient 40 temperature cycler (Stratagene). For routine PCR applications, Taq DNA polymerase (Promega) was used. In the construction of plasmids pDOT29, pDOT31, and pDOT46, the cloned high-fidelity-proofreading Pfu DNA polymerase from Pyrococcus furiosus (Stratagene) was used to amplify the inserts prior to their ligation to pCI372. The Expand high-fidelity PCR system comprising a blend of Taq DNA polymerase and Pwo polymerase (Boehringer Mannheim Corp., Indianapolis, Ind.) was used to amplify an 8.7-kb fragment whose ends were religated to generate constructs pDOT51 through pDOT70.

DNA sequencing and analysis.

A 4.6-kb segment of pGBK17, extending from an EcoRV site to an XbaI site, was subcloned in a variety of fragments in pUC19, and the nucleotide sequences of both DNA strands were determined. Sequencing reactions were performed with an ABI Prism Dye Terminator cycle sequencing kit, using AmpliTaq DNA polymerase FS, and the products were separated in an ABI 377 automatic sequencer (Applied Biosystems, Foster City, Calif.). In addition to universal pUC forward and reverse primers, custom-designed specific primers were used in sequencing reactions. DNA sequences were compiled and analyzed with DNASTAR* software (DNASTAR, Madison, Wis.) and compared to database sequences by using the BLAST suite of programs (2).

Phage assays.

The R-M status of lactococcal hosts was monitored by plaque assays using the small isometric-headed φsk1. To titer the phage, 1 ml of the relevant phage dilution was added to 4 ml of prewarmed M17G medium (46°C), which already contained 0.1 ml of an overnight culture of the appropriate host and 5 mM CaCl2; contents were mixed and poured onto M17G medium supplemented with 5 mM CaCl2. The efficiency of plaquing of the phage was defined as (phage titer on the host of interest)/(phage titer on a nonrestricting host). Phage DNA modification was established by purification of phage from single-plaque isolates and repropagation on the same host culture.

Nucleotide sequence accession number.

The nucleotide sequence presented here has been deposited in the GenBank database and has been assigned the accession no. AF051563.

RESULTS

Sequence organization of the LlaKR2I R-M system.

The native lactococcal plasmid pKR223 has previously been shown to encode an R-M system whose genetic determinants were subcloned on a 19-kb HpaII fragment in pGBK17 (25). The approximate location of the genetic loci encoding restriction and modification activities of pKR223 were previously mapped by deletion analysis to a region of ∼5 kb (30). In this study, multiple fragments from this location were subcloned in E. coli by using pUC19, and the nucleotide sequence of 4,612 bp was determined (Fig. 1). A number of open reading frames (ORFs) were identified, and the deduced protein sequences were compared to data bank sequences, permitting identification of the endonuclease and methyltransferase genes. This analysis confirmed that the R-M system had not previously been characterized; accordingly, it was designated LlaKR2I, based on the conventional nomenclature for R-M systems (50). The LlaKR2I R-M system comprised two divergently transcribed genes, an endonuclease gene (llaKR2IR) and a methyltransferase gene (llaKR2IM); there was a complete copy of the lactococcal IS element IS982 in the intergenic region, with the putative transposase gene oriented in the same transcriptional direction as llaKR2IM (Fig. 2). This organization is unique for all R-M systems described to date. The position of the IS element was also verified in the parental industrial strain L. lactis subsp. lactis biovar diacetylactis KR2 by using PCR (data not shown), indicating that insertion of this element did not occur following passage through the laboratory strain, L. lactis subsp. cremoris LM0230.

FIG. 1.

FIG. 1

FIG. 1

Nucleotide sequence of the LlaKR2I R-M system harboring a copy of the IS element IS982. The deduced protein sequences of the major ORFs observed are presented beneath the nucleotide sequence, along with the gene designation and an arrow indicating the direction of transcription. Potential ribosome binding sites (RBS) are underlined. Several potential translational start codons are available for LlaKR2I; however, the only one preceded by an appropriately spaced ribosome binding site is indicated. Inverted repeat sequences at the left and right termini of IS982 are indicated by arrows labeled IR-L and IR-R, respectively. Direct repeat sequences flanking IS982 are indicated by thick lines labeled DR. Sequences homologous to −10 and −35 promoter consensus sequences are labeled accordingly and are accompanied by the letter P and an arrow indicating the direction of transcription. A potential stem-loop transcriptional terminator structure located after llaKR2IM is indicated by facing arrows.

FIG. 2.

FIG. 2

Restriction map of the LlaKR2I R-M locus. The positions and frequencies of relevant restriction sites are shown. ORFs are represented by arrows. A predicted stem-loop secondary structure located after llaKR2IM which potentially acts as a transcriptional terminator is indicated. The ΔG value of this structure was calculated by the method of Tinoco et al. (53).

The identified llaKR2IR gene has the capacity to encode a protein of 496 amino acids with a deduced molecular mass of 58,089 Da. Data bank analyses indicated that the LlaKR2I endonuclease shared significant similarity throughout its entire sequence only with the Sau3AI endonuclease from Staphylococcus aureus 3AI (48), a widely used commercial type II endonuclease which specifically recognizes the sequence 5′ ↓GATC 3′ and cleaves prior to the 5′ guanine, as indicated by the arrow. Alignment of these two endonucleases revealed 32.9% identity throughout their protein sequences (Fig. 3A). All currently characterized type II endonucleases displaying significant similarity are isoschizomers of each other (reviewed in references 42 and 59), indicating that the LlaKR2I R-M likely recognizes 5′ GATC 3′ sites and cleaves it similarly to Sau3AI. However, the specificity remains to be experimentally confirmed. In addition, similar to previous observations for Sau3AI (5), part of LlaKR2I (amino acids 62 to 210) shared similarity with the GATC-specific mismatch repair endonuclease MutH from E. coli (15) and a MutH homolog from Haemophilus influenzae (13). Greatest similarity between the type II endonucleases and the MutH proteins extended over 35 amino acids, with a number of invariant residues observed (Fig. 3B). These include Asp87, Glu94, and Lys96 in LlaKR2I, which constitute the sequence motif D(X)6–30(E/D)XK; this motif is present in many type II endonucleases (3) and has been proposed to be the active site of the MutH homologs and Sau3AI (5). The conservation of these residues suggest that this may be the catalytic active site of LlaKR2I. LlaKR2I and Sau3AI did not share any significant homology with the GATC-specific type II endonucleases DpnII, MboI, and LlaDCHI or with the GATC-specific methylation-dependent endonuclease DpnI.

FIG. 3.

FIG. 3

(A) Alignment of the deduced protein sequences of the endonucleases Sau3AI (48) and LlaKR2I. Shaded residues indicate amino acids identical in the two sequences. (B) Alignment of segments of Sau3AI and LlaKR2I which exhibit sequence similarity with the GATC-specific MutH proteins of E. coli (15) and H. influenzae (13). Identical residues are shaded, and residues identical in three of the four sequences are boxed.

Due to the presence of IS982, the start codons of the divergently transcribed endonuclease and methyltransferase ORFs are separated by a distance of 1,137 nucleotides. The methylase gene, llaKR2IM, is capable of encoding a protein (M · LlaKR2I) of 420 amino acids with a deduced molecular mass of 48,765 Da. The ORF ended with an ochre stop codon which overlapped a 15-bp perfect inverted repeat which may form a stem-loop structure (ΔG = −21 kcal/mol ± 10%) and which potentially contributes to termination of the llaKR2IM transcript. Data bank searches with the deduced protein sequence of the modification component revealed significant homologies with 5-methylcytosine methyltransferases, a family of proteins which add a methyl group to the carbon 5 position of the pyrimidine ring of cytosine. These endocyclic methyltransferases contain 10 conserved sequence motifs which are generally arranged in invariant order, permitting unambiguous assignment of the class of methyltransferase present, distinguishing them from the exocyclic DNA methyltransferases which modify exocyclic amino nitrogens in adenine (N6-methyladenine) and cytosine (N4-methylcytosine) (23, 28, 33, 39, 48, 52). M · LlaKR2I displayed greatest sequence identity with M · Sau3AI from S. aureus (48), which specifically recognizes 5′ GATC 3′ sequences and modifies the cytosine base. Alignment of M · LlaKR2I with M · Sau3AI revealed 54.6% identity with pronounced homology throughout the 10 motifs characteristic of all 5-methylcytosine methyltransferases, most notably motif I, which helps bind the essential methylation cofactor, S-adenosylmethionine, and motif IV, which contains the catalytic active-site thiolnucleophile (Fig. 4). Furthermore, significant sequence similarity extended beyond the 10 characteristic motifs and included the region between motifs VIII and IX, a segment referred to as the variable region that contains the target recognition domain (TRD), which is responsible for specifying the cytosine within this sequence to be modified (21, 31). M · LlaKR2I and M · Sau3AI share extensive similarities throughout the variable region, suggesting that these two proteins methylate identical or very similar sequences. In agreement with this conclusion, pGBK17 DNA, which contains at least 24 5′ GATC 3′ sequences, and a number of other DNA substrates modified by M · LlaKR2I remained refractory to cleavage when incubated with Sau3AI sites (data not shown). Therefore, this evidence indicated that M · LlaKR2I is similar to M · Sau3AI in that it methylates the carbon 5 of cytosine in 5′ GATC 3′ sites, a modification not previously observed in lactococci. An IS982 element was identified in the region between llaKR2IR and llaKR2IM. IS982 was first identified by Yu et al. (60) and shown to be widely distributed in lactococci. From the data presented by Yu et al. (60), we estimated that four IS982 copies are present in L. lactis subsp. lactis biovar diacetylactis KR2. We have now located two of these IS982 elements within the 19-kb HpaII fragment of pKR223 cloned in pGBK17; one located in the LlaKR2I R-M system, and the other positioned 7.2 kb downstream (data not shown). The sequences of four additional IS982 elements have been published elsewhere (8, 40, 57, 60). Sequence alignment of these IS elements revealed greater than 98% nucleotide identity.

FIG. 4.

FIG. 4

Alignment of deduced protein sequences of M · Sau3AI and M · LlaKR2I. Shaded residues indicate amino acids identical between the two sequences; dashed lines represent breaks introduced to optimize alignment. Ten motifs (I to X) characteristic of the 5-methylcytosine methyltransferase family of proteins (39) are indicated by lines above the sequence A TL dipeptide present in both proteins which has been used to anchor alignments of numerous TRDs in other 5-methylcytosine methyltransferases is marked by two dots above the residues toward the C-terminal end of the variable region. The catalytic active site of these proteins is located within motif IV and is marked by an asterisk.

Subcloning of the LlaKR2I R-M system.

Phage φsk1 was restricted and modified when passed through L. lactis subsp. lactis biovar diacetylactis KR2 (25, 30). To confirm that the loci identified by sequence analysis were the only regions required for expression of the R-M phenotype, a 4,057-bp PCR fragment encompassing llaKR2IR, IS982, and llaKR2IM was generated with high-fidelity-proofreading Pfu DNA polymerase, using primers which included restriction sites to facilitate cloning into pCI372. Following ligation of the PCR fragment into pCI372, attempts to efficiently transform E. coli XLIBlue MRF′ with this DNA proved unsuccessful; we now know that this difficulty was due to the toxicity of the methyltransferase M · LlaKR2I (56). This finding is similar to that observed for the Sau3AI R-M system, where efforts to clone the entire R-M system in a variety of E. coli strains failed and the toxicity was tentatively linked to the expression of sau3AIM (48). Since the methyltransferase was detrimental to E. coli, all subsequent transformations with DNA incorporating llaKR2IM were carried out in L. lactis LM0230. A number of L. lactis LM0230 transformants harboring pCI372 with an insert containing llaKR2IR, IS982, and llaKR2IM were obtained (plasmid designated pDOT31), and infection with φsk1 indicated that all encoded an active endonuclease. The degree of restriction observed was similar to (or slightly better than) that observed with hosts carrying pGBK17 (Table 1). As expected, φsk1 propagated on hosts harboring pDOT31 were not restricted by pGBK17, demonstrating M · LlaKR2I activity. These data confirmed that the 4.1-kb fragment of pDOT31 encoded a functional R-M system.

TABLE 1.

Assessment of subclones of pKR223 for restriction and/or modification activity

Phage Relative EOPa on L. lactis subsp. cremoris LM0230 harboring plasmid:
pGBK17 pDOT31 pDOT29 pDOT46 pDOT70b
φsk1 2.9 × 10−2 1.5 × 10−2 1.0 0.9 3.5 × 10−3
φsk1.pGBK17 1.0 — — — —
φsk1.pDOT31 1.0 1.0 — — —
φsk1.pDOT29 1.0 — 1.0 — —
φsk1.pDOT46 1.0 — — — —
φsk1.pDOT70 1.0 — — — —
a

EOP, efficiency of plaquing of φsk1 on the host of interest relative to plaquing ability on the nonrestricting host, L. lactis subsp. cremoris LM0230. 

b

Representative of PCR clones with IS982 specifically deleted from the LlaKR2I R-M system cloned in pCI372. 

Deletion of IS982 from the LlaKR2I R-M system.

The organization of the LlaKR2I R-M system suggests that originally, expression of llaKR2IR or llaKR2IM may have been directed from divergent promoters within the intergenic region, a region disrupted by the insertion of IS982. As it is well established that IS elements may disrupt or contribute to gene expression, we investigated how the LlaKR2I R-M system functions in the absence of IS982. From the alignments of all of the boundaries of IS982 elements sequenced to date, it is clear that the IS element present in the LlaKR2I R-M system has 16-bp indirect repeats at its ends which are flanked by 7-bp direct repeats, regions believed to have been duplicated during the transposition event (Fig. 5). To generate a putative precursor of the LlaKR2I R-M system prior to the insertion of IS982, the entire IS element and one of the direct repeats (5′ TATCATT 3′) flanking this element should be eliminated.

FIG. 5.

FIG. 5

Alignment of the left and right termini of IS982 elements fully sequenced to date and their flanking DNA sequences. The termini and flanking sequences of the partially sequenced element from Wg2 are also presented (60). The IS982 element identified in the LlaKR2I R-M system is denoted by pKR223(5′), whereas a second copy located 7.2 kb downstream is denoted by pKR223(3′). A 16-bp inverted repeat sequence present in all elements, which may extend up to 18 bp in some instances, is highlighted by an arrow above the sequence. When present, direct repeats flanking the inverted repeat sequences which are believed to have been duplicated during the transposition event are boxed. The internal highly homologous portion of these IS elements is represented by dashed lines.

A PCR fragment containing only llaKR2IM, extending from the right-hand 7-bp direct repeat to after an inverted repeat structure located downstream of llaKR2IM, was cloned into pCI372 (construct designated pDOT29). Plasmid DNA from all clones analyzed was resistant to digestion by Sau3AI in vitro. Insertion of IS5 and IS10 into llaKR2IM rendered this plasmid susceptible to complete digestion by Sau3AI (56). In addition, φsk1 propagated on hosts containing pDOT29 were not restricted by pGBK17 in vivo (Table 1). These data indicated that pDOT29 encodes an active methyltransferase, M · LlaKR2I, and that llaKR2IM does not rely on promoters from IS982 for expression. This finding was not surprising, as llaKR2IM was preceded by −35 (TTGATC) and −10 (TATAAT) motifs separated by 17-nucleotide sequences, consistent with lactococcal and RpoD promoters in general.

Two PCR strategies were used to selectively delete IS982 from the LlaKR2I R-M locus. The first strategy involved PCR amplification of the endonuclease and methyltransferase genes separately, using primers with restriction sites incorporated. These fragments were digested appropriately, ligated and subjected to a second PCR using the ligation reaction product as the template. This yielded a fragment with llaKR2IR and llaKR2IM ligated at a region which corresponded to the TATCATT site duplicated during transposition (Fig. 6). However, to facilitate the ligation of these fragments, an SpeI restriction site was incorporated into each of the primers overlapping the TATCATT repeats, resulting in four nucleotide changes from the original repeat sequence (ACTAGTT) (Fig. 6, primers A and B). This 3.1-kb fragment was inserted into pCI372 (construct designated pDOT46). Challenge of eight independent transformants with φsk1 indicated that none encoded an active endonuclease and all encoded an active methyltransferase. Initially, this finding prompted us to speculate that IS982 may be essential for expression of llaKR2IR. However, closer examination of the direct repeat sequence flanking the right-hand side of the IS element identified a putative extended −10 promoter sequence (TGNTATAAT) which may originally have been responsible for expression of llaKR2IR. One nucleotide within this −10 promoter motif and three directly downstream were altered during the introduction of the SpeI site in pDOT46, and the absence of restriction may have been linked to this change rather than to the removal of IS982. Therefore, we used a second strategy whereby the only expected change was the precise deletion of the IS element without any nucleotide alterations. This strategy utilized two PCR primers directing synthesis outward from IS982; one primer initiated immediately after the left-hand direct repeat (primer C), and the other included the right-hand direct repeat at it’s 5′ terminus (primer D) (Fig. 6). With pDOT31 as the template, these primers allowed the amplification of a fragment containing the entire shuttle vector sequence, pCI372, and the R-M genes without IS982. Efforts to amplify this 8.7-kb fragment with Pfu DNA polymerase failed. However, use of the Expand high-fidelity PCR system, which utilizes a combination of Taq DNA polymerase and the proofreading Pwo DNA polymerase from Pyrococcus woesei, proved successful. This fragment was then treated with polynucleotide kinase, its ends were ligated, and it was transformed into L. lactis subsp. cremoris LM0230. Analysis of 20 transformants revealed that 13 were R+ M+, 6 were R− M+, and 1 was R− M−. These data indicated that expression of llaKR2IR could occur independent of IS982, and furthermore, since the products of the two strategies should differ only by the 4-bp changes introduced to create an SpeI site in one of these constructs, these changes were responsible for the absence of restriction in pDOT46. This finding strongly suggests that the extended −10 promoter sequence, which was modified during the construction of the SpeI site, presumably served as the original llaKR2IR promoter prior to insertion of IS982 in pKR223. No appropriately spaced −35 consensus promoter sequence was observed proximal to this sequence, suggesting that the endonuclease promoter may require only an extended −10 promoter for expression.

FIG. 6.

FIG. 6

Diagrammatic representation of the LlaKR2I R-M system and the effect of removing IS982. Inverted repeat sequences at the left and right termini of IS982 (arrows labeled IR-L and IR-R, respectively) are flanked by directly repeated sequences (DR) depicted as hashed boxes. Putative promoters are represented by P with arrows indicating the direction of transcription. Sequences equivalent to −10 and −35 consensus sequences are labeled accordingly and represented by a bar above the sequence. A Sau3AI site overlapping the putative −35 llaKR2IM promoter and which may have a role in regulation of R-M expression is highlighted below the sequence. Short facing arrows represent a putative stem-loop transcriptional terminator structure located immediately after llaKR2IM. PCR fragments cloned in pCI372 during this study demonstrating the effect of the presence or absence of IS982 on the R-M phenotype are depicted below the sequence. The inclusion of an SpeI restriction site in primers A and B during the construction of pDOT46 contributed to an R− phenotype, presumably due to alterations to an extended −10 promoter sequence overlapping this site. pDOT70* is a representative of 20 transformants harboring a plasmid with IS982 specifically deleted by using primers C and D as PCR primers and pDOT31 as the template. RBS, ribosome binding site.

The degree of restriction varied for the 13 R+ clones obtained. Relative to the restriction mediated by pDOT31 or pGBK17, both of which have IS982 within the R-M locus, the degree of restriction was either similar (nine clones), diminished (two clones), or noticeably improved (two clones, represented by pDOT70) (Table 1). These data indicate that the LlaKR2I R-M system can operate at least as effectively without IS982.

DISCUSSION

The organization of the LlaKR2I R-M system is unique for type II R-M systems, having an IS element inserted between divergently transcribed endonuclease and methyltransferase genes. These elements are prevalent in lactococci and have been associated with a variety of important cellular processes, including phage resistance, proteinase activity, nisin production, and ability to utilize lactose, sucrose, and citrate (8, 14, 44). The proximity of these mobile, transposable elements to many of these important traits presumably reflects the evolutionary role of IS elements in helping cells adapt to their environment. To date, five classes of lactococcal IS elements have been characterized: ISS1 (38), IS904 (9), IS981 (37), IS905 (10), and IS982 (60). IS982 was first identified between the oligopeptide permease gene cluster and origin of replication in the lactose-utilizing plasmid pSK11L from L. lactis subsp. cremoris SK11 (60). In addition to the two IS982 elements identified in this study, the sequences of three further complete highly homologous IS982 elements have been reported for the citrate utilization plasmid pCIT264 (8), the exopolysaccharide encoding plasmid pNZ4000 (57), and the chromosome of the phage resistance strain L. lactis subsp. lactis biovar diacetylactis S94 (40). All six fully characterized IS982 elements and a partially sequenced element from L. lactis subsp. lactis WG2 (60) contained identical perfect inverted repeats at the ends. Many of these inverted repeats were flanked by direct repeats. However, the lengths of the observed direct repeats vary from between 2 and 8 bp (Fig. 5), indicating that unlike for many other lactococcal IS elements, the length of the duplicated region is not conserved for this IS family.

Why IS982 is located in the LlaKR2I R-M system of pKR223 is unclear, as the system can operate independent of this element and originally may even have been more efficient at restricting phage proliferation when this element was absent. It is conceivable that the transposition of IS982 between llaKR2IR and llaKR2IM may have been an evolutionary response to stress imposed on the cell by aberrant restriction or modification activity. It is plausible that if methylation activity was diminished in the presence of an active functional endonuclease, autodigestion of the hosts genomic DNA may have ensued, provoking the insertion of IS982 and permitting either an enhancement of modification activity and/or a reduction in endonuclease activity. Therefore, the insertion of IS982 may have been an induced temporal control mechanism.

The restriction and modification components of LlaKR2I shared 32.9 and 54.6% identity with the equivalent proteins of the Sau3AI R-M system (48). While all DNA methyltransferases share some common sequence motifs (28), no recurring primary sequence motifs exist for the type II endonucleases despite similar catalytic functions and cofactor requirements, preventing any systematic grouping of these heterogeneous proteins (reviewed in references 1, 42, and 59). To date only some isoschizomeric type II endonucleases exhibit homology. Therefore, while the degree of homology observed among the Sau3AI and LlaKR2I endonucleases was not quite as high as that observed for their methyltransferases, the similarities nevertheless are quite significant and presumably highlight the likely common sequence specificities of these proteins. These similarities point to a common evolutionary origin for the Sau3AI and LlaKR2I R-M systems. Neither of the endonucleases of these systems shared any significant sequence similarity with DpnI, DpnII, MboI, or LlaDCHI, all of which are GATC endonucleases but differ markedly with respect to the ability to be affected by DNA methylation. DpnII, MboI, and LlaDCHI all resemble each other (32) and are prevented from digesting their host DNA by a cognate N6-methyladenine methyltransferase, whereas the methylation-dependent endonuclease DpnI cleaves GATC sites only when the adenine has been modified to N6-methyladenine (24). Therefore, primary sequence comparisons of these GATC-specific systems indicated that one of the factors which appears to have had a pronounced influence on how the endonuclease evolved was the type of accompanying methyltransferase, or the absence of one in the case of DpnI. While many type II endonucleases lack discernible similarity at the primary sequence level, recent X-ray crystallography data indicate that despite the absence of primary sequence similarity, these proteins may share similar tertiary structures especially throughout the catalytic active-site residues (1, 5, 36). Therefore, originally all six endonucleases may have had a common ancient progenitor but then divergently evolved into enzymes which are compatible with their accompanying methylation requirements. The MutH proteins of E. coli and H. influenzae appear to be more closely related to Sau3AI and LlaKR2I than other type II GATC-specific endonucleases. In E. coli, MutH has a role in postreplicative mismatch repair, where it creates a nick 5′ of the guanine in a GATC site in a newly synthesized DNA strand harboring a mismatched base (58) and requires the GATC specific N6-methyladenine methyltransferase, Dam, to discriminate the nascent DNA strand harboring the mismatch (reviewed in reference 33). The homology observed among these sequence-specific endonucleases is in agreement with a previous proposal that the MutH mismatch repair proteins evolved from an ancient R-M system where the mutH gene originally accompanied a GATC-specific methyltransferase gene but evolved into a mismatch correction process (29). The similarities between LlaKR2I and the MutH homologs maybe further evidence of this common ancestry.

Extensive studies of a range of 5-methylcytosine methyltransferases, particularly the Bacillus phage-encoded multispecific methyltransferases, have demonstrated that TRDs reside toward the C-terminal end of the variable region and generally contain the dipeptide T(L,I,V) (reviewed in reference 33). Furthermore, X-ray crystallography data for the 5-methylcytosine methyltransferases M · HhaI and M · HaeIII complexed with their specific substrates revealed that along with the catalytic active site, residues toward the C-terminal end of the variable region form the majority of base-specific contacts with the target sequence (22, 41). The homology observed between M · Sau3AI and M · LlaKR2I extended through the C-terminal end of the variable region and included a conserved TL dipeptide (Fig. 4). These data suggest that similar to TRDs of the other 5-methylcytosine methyltransferases, the TRDs of M · Sau3AI and M · LlaKR2I reside toward the C-terminal end of the variable region and that these two proteins methylate similar or identical sequences.

Resistance to phage infection is an industrially important trait in lactococcal starter cultures. In this respect R-M systems are potentially of immense benefit to the dairy fermentation industry, as they are more versatile than other bacteriophage resistance mechanisms which are often specific for certain phage groups or species. Theoretically R-M systems require only one target site in the phage to be effective, with a greater degree of restriction observed with an increasing number of sites (32). However, the relative ease at which fully methylated phage develop, the ability of phage to eliminate certain restriction sites from the genome, and the presence of phage antirestriction mechanisms requires R-M systems to be used in conjunction with other compatible, complementary resistance mechanisms. A number of strategies combining multiple R-M systems either in a single strain or in a strain rotation strategy have been devised for dairy starter cultures and shown to be effective in counteracting phage proliferation (11, 19, 49). Localization of the determinants of the LlaKR2I R-M system and characterization of its sequence specificity provide an additional tool for devising rational strategies to counteract phage infection and proliferation. In a complex milk habitat, the association of R-M systems and other phage resistance mechanisms with IS elements may facilitate their dissemination throughout other lactococcal strains via transposition or homologous recombination, permitting phage-insensitive variants to evolve. However, in a defined starter rotation strategy, the evolution of variants may not be desired and may even be detrimental if certain critical traits are disrupted. Furthermore, the close association of an IS element with an R-M system may allow phage to acquire the modification component more readily due to the increased mobility of these elements. Indeed, it is interesting to speculate that the acquisition of a functional domain of the LlaI methyltransferase (M · LlaI) by a phage may have been mediated by an IS element (IS946) located upstream of llaIM, when the LlaI R-M system was introduced into a commercial dairy fermentation environment (17). Therefore, removal of IS982 from the LlaKR2I R-M system should provide it with an extra element of stability and may enhance the chances of the integrity of the resistance mechanism being maintained during the fermentation process.

ACKNOWLEDGMENTS

This work was supported in part by the Minnesota-South Dakota Dairy Foods Research Center, Dairy Management Inc., and the Minnesota Agricultural Experimental Station (project 18-055).

Footnotes

†

Paper no. 981180025 of the Scientific Journal Series of the Minnesota Agricultural Experiment Station.

REFERENCES

  • 1.Aggarwal A K. Structure and function of restriction endonucleases. Curr Opin Struct Biol. 1995;5:11–19. doi: 10.1016/0959-440x(95)80004-k. [DOI] [PubMed] [Google Scholar]
  • 2.Altschul S F, Gish W, Miller W, Myers E W, Lipman D J. Basic local alignment search tool. J Mol Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  • 3.Anderson J E. Restriction endonucleases and modification methylases. Curr Opin Struct Biol. 1993;3:24–30. [Google Scholar]
  • 4.Anderson D G, McKay L L. Simple and rapid method for isolating large plasmid DNA from lactic streptococci. Appl Environ Microbiol. 1983;46:549–552. doi: 10.1128/aem.46.3.549-552.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ban C, Yang W. Structural basis for MutH activation in E. coli mismatch repair and relationship of MutH to restriction endonucleases. EMBO J. 1998;17:1526–1534. doi: 10.1093/emboj/17.5.1526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Cluzel P J, Chopin A, Ehrlich S D, Chopin M C. Phage abortive infection mechanism from Lactococcus lactis subsp. lactis, expression of which is mediated by an iso-ISS1 element. Appl Environ Microbiol. 1991;57:3547–3551. doi: 10.1128/aem.57.12.3547-3551.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Davis R, van der Lelie D, Mercenier A, Daly C, Fitzgerald G F. ScrFI restriction-modification system of Lactococcus lactis subsp. cremoris UC503: cloning and characterization of two ScrFI methylase genes. Appl Environ Microbiol. 1993;59:777–785. doi: 10.1128/aem.59.3.777-785.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.de Felipe F L, Magni C, de Mendoza D, Lopéz P. Citrate utilisation gene cluster of Lactococcus lactis biovar diacetylactis: organization and regulation of expression. Mol Gen Genet. 1995;246:590–599. doi: 10.1007/BF00298965. [DOI] [PubMed] [Google Scholar]
  • 9.Dodd H M, Horn N, Gasson M J. Analysis of the genetic determinant for production of the peptide antibiotic nisin. J Gen Microbiol. 1990;136:555–566. doi: 10.1099/00221287-136-3-555. [DOI] [PubMed] [Google Scholar]
  • 10.Dodd H M, Horn N, Gasson M J. Characterization of IS905, a new multicopy insertion sequence identified in lactococci. J Bacteriol. 1994;176:3393–3396. doi: 10.1128/jb.176.11.3393-3396.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Durmaz E, Klaenhammer T R. A starter rotation strategy incorporating paired restriction/modification and abortive infection bacteriophage defenses in a single Lactococcus lactis strain. Appl Environ Microbiol. 1995;61:1266–1273. doi: 10.1128/aem.61.4.1266-1273.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Efstathiou J D, McKay L L. Inorganic salts resistance associated with a lactose-fermenting plasmid in Streptococcus lactis. J Bacteriol. 1977;130:257–265. doi: 10.1128/jb.130.1.257-265.1977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fleischmann R D, Adams M D, White O, Clayton R A, Kirkness E F, Kerlavage A R, Bult C J, Tomb J-F, Dougherty B A, Merrick J M, McKenney K, Sutton G, FitzHugh W, Fields C A, Gocayne J D, Scott J D, Shirley R, Liu L-I, Glodek A, Kelley J M, Weidman J F, Phillips C A, Spriggs T, Hedblom E, Cotton M D, Utterback T R, Hanna M C, Nguyen D T, Saudek D M, Brandon R C, Fine L D, Fritchman J L, Fuhrmann J L, Geoghagen N S M, Gnehm C L, McDonald L A, Small K V, Fraser C M, Smith H O, Venter J C. Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science. 1995;269:496–512. doi: 10.1126/science.7542800. [DOI] [PubMed] [Google Scholar]
  • 14.Gasson M J, Fitzgerald G F. Gene transfer systems and transposition. In: Gasson M J, de Vos W, editors. Genetics and biotechnology of lactic acid bacteria. London, England: Chapman and Hall; 1994. pp. 1–51. [Google Scholar]
  • 15.Grafstrom R H, Hoess R H. Nucleotide sequence of the Escherichia coli mutH gene. Nucleic Acids Res. 1987;15:3073–3084. doi: 10.1093/nar/15.7.3073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hayes F, Daly C, Fitzgerald G F. Identification of the minimal replicon of Lactococcus lactis subsp. lactis UC317 plasmid pCI305. Appl Environ Microbiol. 1990;56:202–209. doi: 10.1128/aem.56.1.202-209.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hill C, Miller L A, Klaenhammer T R. In vivo genetic exchange of a functional domain from a type II A methylase between lactococcal plasmid pTR2030 and a virulent bacteriophage. J Bacteriol. 1991;173:4363–4370. doi: 10.1128/jb.173.14.4363-4370.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Holo H, Nes I F. High frequency transformation by electroporation of L. lactis subsp. cremoris strains grown in glycine in osmotically stable media. Appl Environ Microbiol. 1989;55:3119–3123. doi: 10.1128/aem.55.12.3119-3123.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Josephsen J, Klaenhammer T R. Stacking of three different restriction and modification systems in Lactococcus lactis by cotransformation. Plasmid. 1990;23:71–75. doi: 10.1016/0147-619x(90)90046-f. [DOI] [PubMed] [Google Scholar]
  • 20.Klaenhammer T R, Fitzgerald G F. Bacteriophages and bacteriophage resistance. In: Gasson M J, de Vos W, editors. Genetics and biotechnology of lactic acid bacteria. London, England: Chapman and Hall; 1994. pp. 106–168. [Google Scholar]
  • 21.Klimasauskas S, Nelson J L, Roberts R J. The sequence specificity domain of cytosine-C5 methylases. Nucleic Acids Res. 1991;19:6183–6190. doi: 10.1093/nar/19.22.6183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Klimasauskas S, Kumar S, Roberts R J, Cheng X. HhaI methyltransferase flips its target base out of the DNA helix. Cell. 1994;76:357–369. doi: 10.1016/0092-8674(94)90342-5. [DOI] [PubMed] [Google Scholar]
  • 23.Kumar S, Cheng X, Klimausaukas S, Mi S, Pósfai J, Roberts R J, Wilson G G. The DNA (cytosine-5) methyltransferases. Nucleic Acids Res. 1994;22:1–10. doi: 10.1093/nar/22.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lacks S A, Greenberg B. A deoxyribonuclease of Diplococcus pneumoniae specific for methylated DNA. J Biol Chem. 1975;250:4060–4066. [PubMed] [Google Scholar]
  • 25.Laible N J, Rule P L, Harlander S K, McKay L L. Identification and cloning of plasmid deoxyribonucleic acid coding for abortive infection from Streptococcus lactis ssp. diacetylactis KR2. J Dairy Res. 1987;70:2211–2219. [Google Scholar]
  • 26.Madsen A, Josephsen J. Characterization of LlaCI, a new restriction-modification system from Lactococcus lactis subsp. cremoris W15. Biol Chem. 1998;379:443–449. doi: 10.1515/bchm.1998.379.4-5.443. [DOI] [PubMed] [Google Scholar]
  • 27.Madsen A, Josephsen J. Cloning and characterization of the lactococcal plasmid-encoded type II restriction/modification system, LlaDII. Appl Environ Microbiol. 1998;64:2424–2431. doi: 10.1128/aem.64.7.2424-2431.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Malone T, Blumenthal R M, Cheng X. Structure-guided analysis reveals nine sequence motifs conserved among DNA amino-methyltransferases, and suggests a catalytic mechanism for these enzymes. J Mol Biol. 1995;253:618–632. doi: 10.1006/jmbi.1995.0577. [DOI] [PubMed] [Google Scholar]
  • 29.Maranelli B M, Balganesh T S, Greenberg B, Springhorn S, Lacks S A. Nucleotide sequence of the DpnII methylase gene of Streptococcus pneumoniae and its relationship with the dam gene of Escherichia coli. Proc Natl Acad Sci USA. 1985;82:4468–4472. doi: 10.1073/pnas.82.13.4468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.McKay L L, Bohanon M J, Polzin K M, Rule P L, Baldwin K A. Localization of separate genetic loci for reduced sensitivity towards small isometric-headed bacteriophage sk1 and the prolate-headed phage c2 on pGBK17 from Lactococcus lactis subsp. lactis KR2. Appl Environ Microbiol. 1989;55:2702–2709. doi: 10.1128/aem.55.10.2702-2709.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Mi S, Roberts R J. How M · MspI and M · HpaII decide which base to methylate. Nucleic Acids Res. 1992;18:4811–4816. doi: 10.1093/nar/20.18.4811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Moineau S, Walker S A, Vedamuthu E R, Vandenbergh P A. Cloning and sequencing of LlaDCHI restriction/modification genes from Lactococcus lactis and relatedness of this system to the Streptococcus pneumoniae DpnII system. Appl Environ Microbiol. 1995;61:2193–2202. doi: 10.1128/aem.61.6.2193-2202.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Noyer-Weidner M, Trautner T A. Methylation of DNA in prokaryotes. In: Jost J P, Saluz H P, editors. DNA methylation: molecular biology and biological significance. Basel, Switzerland: Birkhäuser Verlag; 1993. pp. 39–108. [Google Scholar]
  • 34.Nyengaard N R, Falkenberg-Klok J, Josephsen J. Cloning and analysis of the restriction-modification system LlaBI, a bacteriophage resistance system from Lactococcus lactis subsp. cremoris W56. Appl Environ Microbiol. 1996;62:3494–3498. doi: 10.1128/aem.62.9.3494-3498.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.O’Sullivan D J, Zagula K, Klaenhammer T R. In vivo restriction by LlaI is encoded by three genes, arranged in an operon with llaIM, on the conjugative Lactococcus plasmid pTR2030. J Bacteriol. 1995;177:134–143. doi: 10.1128/jb.177.1.134-143.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Pingoud A, Jeltsch A. Recognition and cleavage of DNA by type-II restriction endonucleases. Eur J Biochem. 1997;246:1–22. doi: 10.1111/j.1432-1033.1997.t01-6-00001.x. [DOI] [PubMed] [Google Scholar]
  • 37.Polzin K M, McKay L L. Identification, DNA sequence and distribution of IS981, a new high-copy-number insertion sequence in lactococci. Appl Environ Microbiol. 1991;57:734–743. doi: 10.1128/aem.57.3.734-743.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Polzin K M, Shimizu-Kadota M. Identification of a new insertion element, similar to gram-negative IS26, on the lactose plasmid of Streptococcus lactis ML3. J Bacteriol. 1987;169:5481–5488. doi: 10.1128/jb.169.12.5481-5488.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Pósfai J, Bhagwat A S, Pósfai G, Roberts R J. Predictive motifs derived from cytosine methyltransferases. Nucleic Acids Res. 1989;17:2421–2435. doi: 10.1093/nar/17.7.2421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Prévots F, Daloyau M, Bonin O, Dumont X, Tolou S. Cloning and sequencing of the novel abortive infection gene abiH of Lactococcus lactis ssp. lactis biovar diacetylactis S94. FEMS Microbiol Lett. 1996;142:295–299. doi: 10.1111/j.1574-6968.1996.tb08446.x. [DOI] [PubMed] [Google Scholar]
  • 41.Reinisch K M, Chen L, Verdine G L, Lipscomb W N. Crystallization and preliminary crystallographic analysis of a DNA (cytosine-5)-methyltransferase from Haemophilus aegyptius bound covalently to DNA. J Mol Biol. 1994;238:626–629. doi: 10.1006/jmbi.1994.1319. [DOI] [PubMed] [Google Scholar]
  • 42.Roberts R J, Halford S E. Type II restriction endonucleases. In: Linn S M, Lloyd R S, Roberts R J, editors. Nucleases. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1993. pp. 35–88. [Google Scholar]
  • 43.Romero D A, Klaenhammer T R. Abortive phage infection and restriction/modification activities directed by pTR2030 are enhanced by recombination with conjugal elements in lactococci. J Gen Microbiol. 1990;136:1817–1824. [Google Scholar]
  • 44.Romero D A, Klaenhammer T R. Transposable elements in lactococci: a review. J Dairy Res. 1993;76:1–19. doi: 10.3168/jds.S0022-0302(93)77318-X. [DOI] [PubMed] [Google Scholar]
  • 45.Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory; 1989. [Google Scholar]
  • 46.Schouler C, Clier F, Lerayer A L, Ehrlich S D, Chopin M-C. A type IC restriction-modification system in Lactococcus lactis. J Bacteriol. 1998;180:407–411. doi: 10.1128/jb.180.2.407-411.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Schouler C, Gautier M, Ehrlich S D, Chopin M-C. Combinational variation of restriction modification specificities in Lactococcus lactis. Mol Microbiol. 1998;28:169–178. doi: 10.1046/j.1365-2958.1998.00787.x. [DOI] [PubMed] [Google Scholar]
  • 48.Seeber S, Kessler C, Götz F. Cloning, expression and characterization of the Sau3AI restriction and modification genes in Staphylococcus carnosus TM300. Gene. 1990;94:37–43. doi: 10.1016/0378-1119(90)90465-4. [DOI] [PubMed] [Google Scholar]
  • 49.Sing W D, Klaenhammer T R. A strategy for rotation of different bacteriophage defenses in a lactococcal single-strain starter culture system. Appl Environ Microbiol. 1993;59:365–372. doi: 10.1128/aem.59.2.365-372.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Szybalski W, Blumenthal R M, Brooks J E, Hattmann S, Raleigh E A. Nomenclature for bacterial genes coding for class-II restriction endonucleases and modification methyltransferases. Gene. 1988;74:279–280. doi: 10.1016/0378-1119(88)90303-4. [DOI] [PubMed] [Google Scholar]
  • 51.Terzaghi B E, Sandine W E. Improved medium for lactic streptococci and their bacteriophage. Appl Microbiol. 1975;29:807–813. doi: 10.1128/am.29.6.807-813.1975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Timiniskas A, Butkus V, Janulaitis A. Sequence motifs characteristic of DNA [cytosine-N4] and DNA [adenine-N6] methyltransferases. Classification of all DNA methyltransferases. Gene. 1995;157:3–11. doi: 10.1016/0378-1119(94)00783-o. [DOI] [PubMed] [Google Scholar]
  • 53.Tinoco I, Jr, Borer P N, Dengler B, Levine M D, Uhlenbeck O C, Crothers D M, Gralla J. Improved estimation of secondary structure in ribonucleic acids. Nat New Biol. 1973;246:40–41. doi: 10.1038/newbio246040a0. [DOI] [PubMed] [Google Scholar]
  • 54.Twomey D P, Davis R, Daly C, Fitzgerald G F. Sequence of the gene encoding a second ScrFI m5C methyltransferase of Lactococcus lactis. Gene. 1993;136:205–209. [Google Scholar]
  • 55.Twomey D P, Gabillet N, Daly C, Fitzgerald G F. Molecular characterization of the restriction endonuclease gene (scrFIR) associated with the ScrFI restriction/modification system from Lactococcus lactis subsp. cremoris UC503. Microbiology. 1997;143:2277–2286. doi: 10.1099/00221287-143-7-2277. [DOI] [PubMed] [Google Scholar]
  • 56.Twomey, D. P., L. L. McKay, and D. J. O’Sullivan. Unpublished results.
  • 57.van Kranenburg R, Marugg J D, van Swam I I, Willem N J, de Vos W M. Molecular characterization of the plasmid-encoded eps gene cluster essential for exopolysaccharide biosynthesis in Lactococcus lactis. Mol Microbiol. 1997;24:387–397. doi: 10.1046/j.1365-2958.1997.3521720.x. [DOI] [PubMed] [Google Scholar]
  • 58.Welsh K M, Lu A-L, Clark S, Modrich P. Isolation and characterization of the Escherichia coli mutH gene product. J Biol Chem. 1987;262:15625–15629. [PubMed] [Google Scholar]
  • 59.Wilson G G, Murray N E. Restriction and modification systems. Annu Rev Genet. 1991;25:585–627. doi: 10.1146/annurev.ge.25.120191.003101. [DOI] [PubMed] [Google Scholar]
  • 60.Yu W, Mierau I, Mars A, Johnson E, Dunny G, McKay L L. Novel insertion sequence-like element IS982 in lactococci. Plasmid. 1995;33:218–225. doi: 10.1006/plas.1995.1023. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES