TABLE 1.
E. coli strains, phages, plasmids, and oligonucleotides
| Strain, phage, plasmid, or oligonucleotide | Relevant genotype, description, or sequence | Reference or source |
|---|---|---|
| Strains | ||
| SP1312 | F−zah-735::Tn10 Δ(argF-lac)U169 | 18 |
| SP1313 | F−zah-735::Tn10 Δ(argF-lac)U169 ΔtyrR | 18 |
| SP1626 | As SP1312 but with Δcrp-39 rpsL136 | This work |
| SP1627 | As SP1313 but with Δcrp-39 rpsL136 | This work |
| SP1628 | As SP1312 but with himD::Cm | This work |
| SP1629 | As SP1313 but with himD::Cm | This work |
| SP1630 | As SP1626 but with himD::Cm | This work |
| SP1631 | As SP1627 but with himD::Cm | This work |
| NK5031 | Δ(lacIZY)MS265 gyrA supF | 34 |
| CA8439 | λ−relA1 rpsL136 Δcrp-39 spoT1 ΔcyaA854 thi-1 | 44 |
| CA8445 | Δcrp-45 Δcya-854 strA (=rpsL) thi | 44 |
| CSH26(λRZ11) | ara Δ(lac-pro) thi (λplac5 cI857 Sam7) | 63 |
| BW12848 | lac-169 hip(himD)::cat pho-510 thi | B. Wanner |
| XL1-Blue | recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZΔM15 Tn10 (Tetr)] | Stratagene |
| BL21(DE3) | F−ompT (lon) hsdSB (rB− mB−) with DE3, a λ prophage carrying the T7 RNA polymerase gene | 52 |
| Phages | ||
| λHQS10 | tpl-lacZ reporter; Ptpl-lacZ+ | 50 |
| λHQS10mut1 | tpl-lacZ reporter with G→A mutation in box A | 50 |
| λHQS10mut2 | tpl-lacZ reporter with G→A mutation in box B | 50 |
| λHQS10mut3 | tpl-lacZ reporter with G→A and C→T mutations in box C | This work |
| λHQS10mut2,3 | tpl-lacZ reporter with G→A mutation in box A and with G→A and C→T mutations in box C | This work |
| λHQS10Δ64 | tpl-lacZ reporter with 64-nucleotide deletion | 50 |
| λHQS10Δ130 | tpl-lacZ reporter with 130-nucleotide deletion | 50 |
| λHQS10Δ64C | tpl-lacZ reporter with 64-nucleotide deletion; box C replaced by box A | This work |
| λHQS10Δ179C | tpl-lacZ reporter with 179-nucleotide deletion; box C replaced by box A | This work |
| λHQS10IHFmut | tpl-lacZ reporter; T→C and A→C mutations in IHF site | This work |
| Plasmids | ||
| pHA5 | Derived from pBR322; insert of 3.6-kb BamHI fragment containing crp gene and promoter | R. Ebright |
| pXZCRP | Derived from pHA5 by inserting an EcoRI fragment of 500 bp containing the f1 origin | R. Ebright |
| pJC100 | pET3a-tyrR+ | 51 |
| pJC136 | pACYC184-tyrR+ | This work |
| pET3a | T7 vector | 43 |
| pHNβα | Derivative of pHX3-8 by conditional digestion of HindIII which yield incomplete digests | 28 |
| pHNβ2α | Derivative of pHNβα, containing two copies of himD gene | 28 |
| pUC19 | Cloning vector | 63 |
| pUC19tpl | Wild-type tpl promoter in pUC19 | 50 |
| pUC19tplmut1 | G→A change in box A of the tpl promoter in pUC19 | 50 |
| pUC19tplΔ64 | 64-nucleotide deletion derivative of pUC19tpl | This work |
| pUC19tplΔ64C | 64-nucleotide deletion; box C is replaced by box A of tpl promoter in pUC19tpl | This work |
| pUC19tplΔ179 | 179-nucleotide deletion derivative of pUC19-tpl | 50 |
| pUC19mut3 | G→A and C→T changes in box C of tpl promoter | This work |
| pUC19mut1,3 | G→A in box A; G→A and C→T changes in box C of tpl promoter | This work |
| pUC19mut2,3 | G→A in box B; G→A and C→T changes in box C of tpl promoter | This work |
| pUC19tplIHFmut | T→C and A→C mutations in IHF site | This work |
| pMLB1034 | Promoterless lacZ | 6 |
| pMLB1034tplmut3 | G→A and C→T changes in box C of tpl promoter in pMLB1034 | This work |
| pMLB1034tplmut2,3 | G→A in box B; G→A and C→T changes in box C of tpl promoter in pMLB1034 | This work |
| pMLB1034tplIHFmut | T→C and A→C mutations in IHF site | This work |
| pMLB1034tplΔ64C | 64-nucleotide deletion; box C is replaced by box A of tpl promoter in pMLB1034 | This work |
| pMLB1034tplΔ179C | 179-nucleotide deletion; box C is replaced by box A of tpl promoter in pMLB1034 | This work |
| Oligonucleotides | ||
| 351K | GCTGTAAATATAGGTGATGCAAATTACACGTC | |
| 352K | GACGTGTAATTTGCATCACCTATATTTACAGC | |
| 488K | CGGGTAAAAAAATGACGTGTGTAAAGCATCATTTACATTTACAGC | |
| 489K | GCTGTAAATGTAAATGATGCTTTACACACGTCATTTTTTTACCCG | |
| IHFc | CACGCAAAAAAAAACTTGTCGACTATGAACGGG | |
| IHFd | CCCGTTCATAGTCGACAAGTTTTTTTTTGCGTG |