Antibodies |
|
CD8a, BV711, clone RPA-T8 |
Biolegend |
301044; RRID:AB_11218793 |
CD11c, PE/Dazzle 594, clone 3.9 |
Biolegend |
301642; RRID:AB_2564083 |
CD16, BV570, clone 3G8 |
Biolegend |
302036; RRID:AB_2632790 |
CD19, AF488, clone HIB19 |
Biolegend |
302219; RRID:AB_389313 |
CD25, PerCP/Cy5.5, clone BC96 |
Biolegend |
302626; RRID:AB_2125479 |
CD45RA, AF488, clone HI100 |
Biolegend |
304114; RRID:AB_528816 |
CD123, BV711, clone 6H6 |
Biolegend |
306030; RRID:AB_2566353 |
HLA-DR, PE/Cy5, clone L243 |
Biolegend |
307608; RRID:AB_314686 |
HLA-DR, BV570, clone L243 |
Biolegend |
307638; RRID:AB_2650882 |
CD24, PerCP/Cy5.5, clone ML5 |
Biolegend |
311116; RRID:AB_10962689 |
IgM, BV421, clone MHM-88 |
Biolegend |
314516; RRID:AB_2561443 |
CD3, BV510, clone OKT3 |
Biolegend |
317332; RRID:AB_2561943 |
CD4, BV605, clone OKT4 |
Biolegend |
317438; RRID:AB_11204077 |
CD279 (PD1), PE, clone EH12.2H7 |
Biolegend |
329906; RRID:AB_940481 |
CD1c, AF647, clone L161 |
Biolegend |
331510; RRID:AB_1186032 |
CD161, PE, clone HP-3G10 |
Biolegend |
339904; RRID:AB_1501086 |
TCR Vα24-Jα18, BV421, clone 6B11 |
Biolegend |
342916; RRID:AB_2564004 |
CD141, PE/Cy7, clone M80 |
Biolegend |
344110; RRID:AB_256122 |
IgD, PE, clone IA6-2 |
Biolegend |
348204; RRID:AB_10553900 |
CD127, BV650, clone A019D5 |
Biolegend |
351326; RRID:AB_2562095 |
TCR Vα7.2, PE/Cy7, clone 3C10 |
Biolegend |
351712; RRID:AB_2561993 |
CCR7, BV421, clone G043H7 |
Biolegend |
353208; RRID:AB_10915137 |
CCR6, BV650, clone G034E3 |
Biolegend |
353426; RRID:AB_2563869 |
CXCR3, PE/Dazzle 594, clone G025H7 |
Biolegend |
353736; RRID:AB_2564287 |
CD38, PE/Cy7, clone HB-7 |
Biolegend |
356608; RRID:AB_2561903 |
CCR4, PE/Dazzle 594, clone L291H4 |
Biolegend |
359420; RRID:AB_2564094 |
CD57, PerCP/Cy5.5, clone HNK-1 |
Biolegend |
359622; RRID:AB_2565930 |
CD56, Pacific Blue, clone 5.1H11 |
Biolegend |
362520; RRID:AB_2564096 |
CD56, BV510, clone 5.1H11 |
Biolegend |
362534; RRID:AB_2565633 |
CD14, Pacific Blue, clone 63D3 |
Biolegend |
367122; RRID:AB_2687385 |
CD45, PerCP, clone 2D1 |
Biolegend |
368506; RRID:AB_2566358 |
CD45, BV605, clone 2D1 |
Biolegend |
368524; RRID:AB_2715826 |
Zombie NIR |
Biolegend |
423105 |
CD4, PE-AF610, clone S3.5 |
Thermofisher |
MHCD0422; RRID:AB_10371763 |
|
Biological samples |
|
Human blood samples |
Patients and healthy donors |
This paper |
Human blood samples |
Etablissement Francais du Sang |
This paper |
Human PBMC |
PromoCell |
434Z036 |
|
Chemicals, peptides, and recombinant proteins |
|
Recombinant human IFN-β |
PBL assay |
11410 |
ADUS100 |
Sanofi compound |
RA14447001A |
JAK1/2-inhibitor (baricitinib) |
Sanofi compound |
RA14836171 |
Ficoll |
Eurobio Scientific |
Cat#CMSMSL01-01 |
Fetal Bovine Serum |
Gibco, Thermo Fisher Scientific |
Cat#10270106 |
DMSO |
Sigma Aldrich |
Cat#D2650 |
Fc Block |
Miltenyi Biotec |
130-059-901 |
TruStain FcX |
Biolegend |
4422302 |
PierceTM 16% Formaldehyde (w/v), Methanolfree |
Thermo Fisher Scientific |
Cat# 28906 (10∗1 mL) |
Cell ID Intercalator |
Standard BioTools |
201325 |
pBSSVD2005 |
Addgene |
21826 |
EQ Beads |
Standard BioTools |
Cat# 201078 |
|
Critical commercial assays |
|
Maxpar Direct Immune Profiling Assay |
Standard BioTools |
Cat# 201325 |
Chromium Single Cell 3′ Library & Gel Bead Kit v2 |
10X Genomics |
Not available anymore |
Chromium Single Cell 3′ Library & Gel Bead Kit v3 |
10X Genomics |
1000075 |
Chromium Single Cell 3′ Library & Gel Bead Kit v3.1 |
10X Genomics |
1000268 |
Proximity extension assay Inflammation |
Olink |
Targeted 96 inflammation |
|
Oligonucleotides |
|
EIF2AK3 primers: Forward TCAGATATGAACAGCCTTCAGTGT Reverse AACCAAAATTTCACAAGTGGCT |
Eurofins Genomics |
N/A |
|
Deposited data |
|
Single-Cell RNA-sequencing data – SAVI dataset |
This paper |
GSE226598 |
Single-Cell RNA-sequencing data – IFN dataset |
This paper |
GSE226572 |
|
Software and algorithms |
|
CellRanger V6 |
10x Genomics |
https://support.10xgenomics.com/single-cell-gene-expression/software/downloads/latest |
R V3.6.1 |
R-project |
https://www.r-project.org/ |
Seurat v4 |
Hao et al.51
|
https://satijalab.org/seurat/ |
FlowJo v10 |
BD |
https://www.flowjo.com/solutions/flowjo |
EnrichR |
Chen et al.52
|
https://maayanlab.cloud/Enrichr/ |
Spotfire® v.10.3.2.7 |
TIBCO® |
https://www.tibco.com/products/tibco-spotfire |
CyTOF software version 8.0.14050 |
Standard BioTools |
https://go.fluidigm.com/cytofsw/v8 |
MaxPar Pathsetter V.2.0.45.4 |
Standard BioTools |
https://www.standardbio.com/products/software/maxpar-pathsetter |
Ingenuity pathway analysis v57662101 |
Qiagen |
https://www.qiagen.com/us/products/discovery-and-translational-research/next-generation-sequencing/informatics-and-data/interpretation-content-databases/ingenuity-pathway-analysis |