Identifying Qingkailing (清开灵) ingredients-dependent mesenchymal-epithelial transition factor-axiation “π” structuring module with angiogenesis and neurogenesis effects

Abstract

OBJECTIVE:

To explore the functional role of the drug-dependent mesenchymal-epithelial transition (Met)-axiation "π" structural module of neurogenesis after processing by three components of Qingkailing injection in neurogenesis and angiogenesis in cerebral ischemia.

METHODS:

We used a Glutathione S-transferase (GST)-pull down assay, isothermal titration calorimetry assay, and other related methods to identify the relationships among Met, inositol polyphosphate phosphatase like 1 (Inppl1), and death associated protein kinase 3 (Dapk3) in this allosteric module. The biological effects of the modules of neurons generation composed of Met, Inppl1, and Dapk3 were measured through Western blot, apoptosis analysis, and double immunofluorescence labeling.

RESULTS:

The GST-pull down assay revealed that proline-serine-threonine rich domain of Met binds to the Src homology domain of Inppl1 to form a protein-protein complex; Dapk3 with a C-terminal domain interacts weakly with the protein kinase C domain of Met in the intracellular region. Thus, we obtained a “π” structuring module considered a neural regeneration module. The biological effects of angiogenesis and neurogenesis modules composed of Met, Inppl1, and Dapk3 were also verified.

CONCLUSION:

The study suggested that understanding the functional modules that contribute to pharmaceutics might provide novel signatures that can be used as endpoints to define disease processes under stroke or cerebral ischemia conditions.

1. INTRODUCTION

Modularity is a fundamental property of biology and disease networks, as genes and proteins interact with each other in the biological network to execute specific functions.^1,⇓-3 Since a module is a closely connected unit that performs functions in the biological network, modular targeting exceeding individual genes is critical to clarify the flexible mechanisms of drugs from a systematic point of view.⁴ Considering the modular basis of drug intervention networks, changes in the modular structure may reflect the actions of drugs better.^5,6 Furthermore, a module gene’s connected structure and functions usually correlate positively in a co-expression network.⁷ Therefore, it is essential to clarify the structure and functional relationships of the targeted modules.

Ischemic stroke is a leading cause of long-term disability, and it is estimated that over 800 000 Chinese people suffer from this life-threatening disease each year, with 40% of these cases being fatal.⁸ In addition, an ischemic stroke leads to several neurotoxic events, including oxidative stress, inflammation, and calcium overload, which ultimately results in the death of neurons and other cell types within the brain.^9,10 However, challenges in recognizing and evaluating relevant pharmacological processes and responses to combination therapy from vast quantities of experimental data have made it quite difficult for us to obtain new pharmacological insights to manage this disease.

Baicalin (BA), jasminoidin (JA), and cholic acid (CA) were 3 bioactive compounds extracted from Qingkailing (清开灵, QKL) injection, which has been reported to protect the brain against ischemia-reperfusion (I/R) injury.¹¹ In our previous study, according to the comparison with the I/R model on the topological variations of the functional modules identified from the targeted networks in the 3 compounds treatment group, we discovered an overlapping Met-axiation allosteric module (AM) as a potential therapeutic target for brain ischemia, which has enriched with a gene ontology (GO) function linked to neural generation, including 3 proteins: inositol polyphosphate phosphatase-like 1 (Inppl1), mesenchymal-epithelial transition (Met) proto-oncogene receptor tyrosine kinase and death associated protein kinase 3 (Dapk3).¹² However, the detail protein-protein interaction (PPI) structure and relationship among these 3 proteins in the Met-axiation AM remains unclear. Identifying the PPI structure of a druggable module may help to reveal the disease mechanisms and develop approaches to cure this disease. Therefore, in this study, we aimed to investigate the detail PPI structure among the 3 proteins in the QKL-ingredients-dependent Met-axiation module using structural biology methods, and identify the important role of Met in this module for the effects on angiogenesis and neurogenesis based on clustered regularly interspaced short palindromic repeats-associated protein 9 system (CRISPRs/Cas 9, Genechem Co., Ltd., Shanghai, China).

2. MATERIALS AND METHODS

2.1. Macromolecule production

The cDNAs encoding the structural domains of Inppl1, Met, and Dapk3 were amplified by polymerase chain reaction (PCR) using full-length rat complementary DNA, which was cloned using reverse transcription of the messenger RNA extracted from Rattus norvegicus cerebral tissues, using TRIzol reagent (Invitrogen, Waltham, MA, USA) as a template. Information on the constructed prokaryotic recombinant plasmids is summarized in supplementary Table 1. Each plasmid was transferred into Escherichia coli BL21 (DE3) cells. Escherichia coli cells were grown in Luria-Bertani (LB) medium at 310 K until the optical density (OD₆₀₀) reached 0.5-0.6. Recombinant protein expression was induced by adding 0.5 mM isopropyl-L-thiogalactopyranoside (IPTG), and Escherichia coli cells were cultivated at 289 K for 20 h.

Purifications of the N-terminal His-tagged proteins were carried out at 277 K. Escherichia coli cells were harvested by centrifugation, resuspended in a loading buffer containing 20 mM Tris-HCl (pH 8.0), 500 mM NaCl, and 20 mM imidazole, and then lysed by sonication. After the cell debris was removed by centrifugation at 35 000 × g for 30 min, the supernatant was loaded onto a HisTrap column (5 mL) equilibrated with this loading buffer. A wash containing 20 mM Tris-HCl buffer (pH 8.0), 500 mM NaCl, and 30 mM imidazole was used to wash the column and remove weakly bound proteins. The His-tagged protein was eluted with 20 mM Tris-HCl buffer (pH 8.0) containing 500 mM NaCl and 200 mM imidazole. The His-tag was cleaved using thrombin (GE Healthcare) at 295 K overnight. To remove the His-tag and the uncleaved His-tagged protein, the sample was buffer changed to the loading buffer using dialysis and was loaded onto a HisTrap column as described above. The flow-through fractions were collected, and the buffer was changed into an IP buffer containing 50 mM Tris-HCl (pH7.4), 150 mM NaCl, 1% tergitol-type NP-40 (NP)-40, 0.1% sodium dodecyl sulfate (SDS), 1 mM dithiothreitol (DTT), and 1 mM sodium fluoride (NaF) using the ultrafiltration method.

2.2. Glutathione S-transferase (GST)-pull down assay

The GST-pull down assay was carried out at 277 K. Escherichia coli BL21 (DE3) cells, transformed with the GST-fusion protein vector (supplementary Table 1), were harvested by centrifugation, resuspended in phosphate buffer saline (PBS), and then lysed by sonication. After the cell debris was removed by centrifugation at 35 000 × g for 20 min, the supernatant was loaded into glutathione-sepharose 4 B beads equilibrated with PBS. The column was washed using PBS solution first, followed by an Immunoprecipitation (IP) buffer. Then, one of the purified His-tagged fusion proteins listed in supplementary Table 1 was incubated at 277 K for 2 h with the GST-fusion protein-coupled to glutathione-sepharose 4B beads. Finally, the column was washed four times with IP buffer and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

2.3. Isothermal titration calorimetry (ITC) assay

ITC assay was carried out using a MicroCaliTC200 instrument at 298 K. For the ITC assay, concentrations of the protein kinase C (PKC) domain of Met, the PCK domain of Dapk3, and the C-terminal fragment of Dapk3 were determined by measuring the absorption at 280 nm to be 0.5 µM. ITC experiments were performed by injecting 200 μL of a small volume of the PKC domain of Met solution, the PCK domain of Dapk3 solution (or the C-terminal fragment of Dapk3 solution) in the sample cell. A total of 20 injections were performed, the first of 0.5 μL followed by 19 injections of 2 μL. The first two injections were separated at 180 s, and all subsequent injections were separated at 120 s. Integrated raw data analysis was performed using Origin9 software with the single-site binding model to determine the values of K_D, H, S, and stoichiometry.

2.4. Biological effects of the modules of a neural generation composed of Met, Inppl1, and Dapk3

2.4.1. Animals

Adult male Sprague-Dawley rats (220-230 g), provided by the Animal Facility of Peking University Health Science Center (Beijing, China), were housed in a laboratory animal room and maintained at (25 ± 1) ℃ with 65% ± 5% humidity on a 12-hour light/dark cycle (lights were on from 07:30 to 19:30) for at least 1 week before the experiments. The animals were provided food and water ad libitum. All experimental protocols described in this study were approved by the Ethics Review Committee for Animal Experimentation of Xiyuan Hospital, China Academy of Chinese Medical Sciences. All methods in this study were performed in accordance with the relevant guidelines.

2.4.2. Transient middle cerebral artery occlusion (MCAO)

Rats were subjected to transient focal cerebral ischemia induced by right MCAO as previously described.¹³ In brief, rats were anesthetized with 10% chloral hydrate (360 mg/kg, i.p.), and arterial blood samples were collected via a femoral catheter to measure PO₂, PCO₂, and pH using an AVL 998 Blood Gas Analyzer (Roche Co., Basel, Switzerland). Rectal temperature was maintained at (37.0 ± 0.5) ℃ during MCAO using a temperature-regulated heating lamp. A fiber-optic probe was attached to the parietal bone overlying the middle cerebral artery, 5 mm posterior and 5 mm lateral to the bregma and connected to a laser Doppler flowmeter (Perimed, Stockholm, Sweden) for continuous monitoring of cerebral blood flow (CBF). A 4-0 nylon monofilament suture with a heat-blunted tip was introduced into the internal carotid artery through the stump of the external carotid artery, then gently advanced for a distance of 18 mm from the common carotid artery bifurcation to block the origin of the middle cerebral artery for 90 min, and then withdrawn to allow reperfusion. Only animals that exhibited > 85% CBF reduction during right MCAO and > 80% CBF recovery after 10 min of reperfusion were included in the study. After the wound had closed, animals could recover from anesthesia before returning to their home cages. The survival rate of I/R rats is respectively over 95% or 65% at 24 h or 7 d after reperfusion.

2.4.3. Drug administration

BA, JA, CA were isolated by chromatography in the Chemistry Lab, Institute of Basic Medical Sciences, Xiyuan Hospital, Beijing. Stock solutions were prepared from 100 mM Dimethyl sulfoxide to yield concentrations of 150 mg BA/kg body weight, 750 mg JA/kg body weight, 210 mg CA/kg body weight, or 50 mg BA + 250 mg JA + 70 mg CA /kg body weight (BA + CA + JA group) during treatment. AS1949490, a 30-fold more potent inhibitor of Src homology 2 domain-containing inositol 5'-phosphatase 2 (SHIP2) than SHIP1, was obtained from Tocris Biosciences (Minneapolis, MN, USA) and was used at a 300 mg/kg dose. Unless otherwise indicated, all other chemicals used were of analytical grade and were purchased from Sigma-Aldrich (sigma-aldrich, Burlington, VT, USA).

To determine the expressions of Met, Inppl1, and Dapk3, rats were randomly divided into different groups (20 rats for each group). These groups were empty vector + sham group, empty vector + I/R group, empty vector + BA + JA + CA group, Crispr/cas9 Met (Crispr Met) + sham group, Crispr Met + I/R group, Crispr Met + BA + JA + CA group; Crispr Met + I/R + BA group, Crispr Met + I/R + JA group, Crispr Met + I/R + CA group, Crispr Met + I/R + BA + JA + CA group. Rats were sacrificed 24 h after reperfusion.

To determine whether the modules of neuron generation were composed of Met, rats were randomly divided into different groups (20 rats for each group). These groups were Sham group, I/R group, I/R + BA + JA + CA group, I/R + BA + JA + CA + Crispr Met group, I/R + BA + JA + CA + AS1949490 (300 mg/kg), I/R + BA + JA + CA + Crispr Met + AS1949490 group. Rats were sacrificed 7 d after reperfusion.

BA, JA, CA, BA + JA + CA, and AS1949490 were delivered by duodenal administration between ischemia and reperfusion (normal saline was administered for sham and I/R groups). These medicines were orally administered once daily for six days after MCAO/reperfusion for chronic treatment.

2.4.4. Lentiviral vectors and Crispr/cas9 Met injection

The Crispr/cas9 Met design was supplied by Genechem Co. (Genechem Co., Ltd., Shanghai, China). Lentiviral vectors U6-sgRNA-EF1a-Cas9-FLAG-P2A-EGFP were generated. The SgRNA Met sense oligonucleotide sequence 5-CACCg- ATGCCAGGTGCCAGCGCGGT-3 was annealed and cloned into a GV393 plasmid. One unrelated sequence (CGCTTCCGCGGCCCGTTCAA) showing no significant homology to any known rat gene analyzed using a basic local alignment search tool search was used as a control. Three days before MCAO, 1.5 μL of the concentrated viral solution was stereotaxically delivered into the ipsilateral lateral ventricle (coordinates from bregma: AP-0.8 mm, ML 1.4 mm, DV-3.6 mm from the pial surface).

2.4.5. Analysis of apoptosis

The cells were collected from the ischemic cortex, diluted to 10⁶/mL in PBS, and then double-stained with fluorescein isothiocyanate (FITC)-conjugated Annexin-V (25 μg/mL) and propidium iodide (PI) (50 μg/mL) 142 (Beckman Coulter, Pasadena, CA, USA) for 20 min in the dark. The cells were then collected on an Epic XL flow cytometer equipped with a 488-nm 143 argon laser and analyzed using Expo32 flow cytometry software (Beckman Coulter, Pasadena, CA, USA).

2.4.6. Immunofluorescence confocal imaging

To label angiogenesis, bromodeoxyuridine (BrdU) (100 mg/kg) (Sigma, St Louis, MO, USA) was administered (i. p.) daily for four consecutive days starting on the third day after stroke. Rats were sacrificed seven days after MCAO with an overdose of 3.5% chloral hydrate and were transcardially perfused with 0.9% saline solution followed by 4% ice-cold paraformaldehyde (PFA). The brains were removed and post-fixed overnight. Coronal sections, 1.0 to 0.2 mm from bregma, were used for immunohistochemical staining and were cut on a freezing microtome (Leica, Vizsla, Germany) at a thickness of 25 μm. Cerebral sections were double-stained for immunofluorescence, and cell phenotypes were identified by colocalization of phenotypic markers with BrdU, as previously described, using the following primary antibodies (and their concentrations): BrdU mouse mAb (1:100; Cell Signaling, Danvers, CO, USA); rabbit anti-CD31 or anti-NeuN antibody (1:50; Cell Signaling, Danvers, CO, USA); secondary antibodies: anti-mouse and rabbit IgG-FITC and IgG-Cy3 (1:200; Chemicon, Temecula, CA, USA). Confocal images were captured using a Zeiss LSM-510 microscope (Zeiss, Oberkochen, Germany).

2.4.7. Western Blotting

Rats were sacrificed 24 h or 7 d after reperfusion with an overdose of 3.5% chloral hydrate. Cortical sections (1.0 to 2.0 mm) from the infarcts were used for western blot analysis. Rat cerebral homogenates were collected and centrifuged for 4 min at 3000 × g, and the resulting supernatants spun at 10 000 × g for 30 min. Supernatants were diluted to a 0.5 mg/mL protein concentration to measure Inppl1, Dapk3, and Met expression. Protein content was determined using bovine serum albumin as a standard, according to Bradford.¹⁴ Protein samples (20 μg/lane) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA) through electroblotting. Blots were stained with mouse Met (25H2) mAb antibody (CST), Met antibody (CST), and Dapk3/ZIPK antibody (CST). Blots were then developed by enhanced chemiluminescence using SuperSignal West Femto maximum sensitivity substrate (Pierce, Rockford, IL, USA, Bio-Rad Image LabTMVersion 3.0 software).

2.4.8. VEGF and BDNF assay

The supernatants of brain tissue which get from 0.1 mm of ischemic area were centrifuged (5000 × g, 10 min, 4 ℃) and the concentrations of VEGF and BDNF were measured with ELISA kits (R & D systems, Minneapolis, MN, USA). Sample and standard dilutions were made with the experimental media, and the results are expressed as the mean ± standard deviation.

2.5. Statistical analysis

The results of the experiments were analyzed using several statistical methods such as paired or unpaired t-tests and analysis of variance (ANOVA) using commercial Prism software (GraphPad Prism, San Diego, CA, USA). Data are presented as mean ± standard deviation. For comparisons between two groups, significance was determined using Student’s t-test parametric analysis. In addition, multifactorial ANOVA was used to compare multiple groups and determine statistical significance. A threshold of the P value of 0.05 was considered statistically significant in all conditions.

3. RESULTS

3.1. Identification of the “π” structuring PPIs between two domains in Met, Inppl1, and Dapk3 in the module

The interactions among these 3 proteins Met, Inppl1, and Dapk3 were a modular structure. The ectodomain exposed on the cell surface has an N-terminal Semaphorins (SEMA) domain, followed by the proline-serine-threonine rich domain, four immunoglobulin-plexin-transcription (IPT) domains (IPT domain 1-4), a transmembrane region, and a PKC domain. Inppl1 contains an N-terminal Src homology 2 (SH2) domain, an endonuclease-exonuclease-phosphatase domain. SH2 domains play an essential role in cellular signal transduction by binding to phosphorylated Tyr residues. Although Tyr phosphorylation is a prerequisite for binding to all SH2 domains, different SH2 domains prefer specific sequence motifs. It can be determined that the Plexin-semaphorin-integrin domain (PSI) domain of Met can bind to the SH2 domain of Inppl1 to form a protein-protein complex (Figure 1A). The IPT 1 and 2 domains of Met were not expressed as the GST-fusion protein in Escherichia coli cells. GST-IPT domain 4 of Met was expressed in Escherichia coli. IPT domain 4 cannot bind to the SH2 domain of Inppl1 to form a protein-protein complex, suggesting that none of the IPT domains of Met bind to the SH2 domain of Inppl1 (supplementary Figure 1A). The SEMA domain and the PKC domain of Met, the PKC domain, and the C-terminal fragment of Dapk3 cannot bind to the SH2 domain of Inppl1, forming a stable protein-protein complex (supplementary Figure 1B, 1C). As Dapk3 exists in the cell nucleus and cytoplasm, Inppl1 and Dapk3 may not form a protein-protein complex in the intracellular region. If Dapk3 interacts with Met, the Met interface must be in the PKC domain. However, the PKC domain of Met cannot form a protein-protein complex with the PKC domain of Dapk3 or with the C-terminal fragment of Dapk3 (supplementary Figure 1D). The results of the pull-down assays suggested that the N-terminal SH2 domain of Inppl1 binds to the PSI domain of Met to form a Met-Inppl1 complex in the extracellular region, but whether Dapk3 with Met forms a protein-protein complex remains uncertain.

Figure 1. Effects of Met, Inppl1 and Dapk3 interaction models.

A: results of GST-pull down assays for GST-PSI domain of Met binding to the SH2 domain of Inppl1. The eluted and input proteins were subjected to SDS-PAGE and stained with Coomassie Brilliant Blue (CBB); B: ITC experiments with met and Dapk3; B1: results of ITC experiments of PKC domain of Dapk3 were titrated into PKC domain of Met; B2: C-terminal domain of Dapk3 was titrated into PKC domain of Met; Top panel: raw data obtained for a representative experiment from 19 injections. Bottom panel: the integrated data with a best-fit curve for the representative experiment generated using the Origin software package for a single-site binding model; C: interaction model among Met, Inppl1, and Dapk3. Inppl1: inositol polyphosphate phosphatase like 1; SH2: src homology; EEP: endonuclease-exonuclease-phosphatase; SAM: sterile alpha motif; Met: mesenchymal-epithelial transition; SEMA: semaphorins; PSI: plexin-semaphorin-integrindomain; IPT: immunoglobulin-plexins-transcription; Dapk3: death associated protein kinase 3; PKC: protein kinase c; Met: mesenchymal-epithelial transition; N-ter: N-terminus; C-ter: C-terminus; GST: glutathione-s-transferase; SDS-PAGE: sodium dodecyl sulfate-polyacrylamide gel electrophoresis; ITC: isothermal titration calorimetry.

The results of ITC assays revealed that while the PKC domain of Met was loaded into the PKC domain of Dapk3, the thermal effect of the interaction between the two PKC domains from different proteins was not observed. In contrast, while the PKC domain of Met was loaded into the C-terminal fragment of Dapk3, a steady increase in the concentration of the PKC domain of Met led to a steady increase in the thermal effect and energy exchange between the PKC domain of Met and the C-terminal fragment of Dapk3 (Figure 1B). Although K_D could not be determined, the PKC domains of Met interacted weakly with the C-terminal fragment of Dapk3. The N-terminal SH2 domain of Inppl1 binds to the PSI domain of Met to form a Met-Inppl1 complex in the extracellular region. Dapk3, with a C-terminal fragment, interacts weakly with the PKC domain of Met in the intracellular region. Therefore, an interaction model could be developed between Met, Inppl1, and Dapk3 (Figure 1C), we obtain a “π” structuring module, considered a neural regeneration module. Therefore, we need to verify the function of neurogenesis and angiogenesis in cerebral ischemia.

Therefore, an interaction model could be developed between Met, Inppl1, and Dapk3 (Figure 1C).

3.2. Crispr/cas9 Met inhibited Dapk3, Inppl1, and Met expressions in cerebral homogenates

To further explore whether brain functions changed with Met, specific inhibitors, Crispr Met, respectively, were utilized. Western blot analysis of Dapk3, Inppl1, and Met was performed to confirm that treatment with Crispr Met can sufficiently block the effects of BA + JA + CA on Inppl1, but not Dapk3 (Figure 2A). Furthermore, BA + JA + CA increased Dapk3 and Inppl1 expression blocked by Met Crispr, while BA, JA, and CA did not have such effects (Figure 2B). This indicated that the functional modules, including Dapk3, Met, and Inppl1, were activated by BA + JA + CA. The above results are presented in a bar chart (Figure 2C-2E).

Figure 2. Crispr/cas9 Met inhibits Dapk3, Inppl1 and Met expression in brain homogenates.

A: immunoblots of Dapk3, Inppl1, and Met expressions in cerebral homogenates showed that treatments of Crispr Met can sufficiently block the effects of BA + JA + CA on Inppl1, but not Dapk3; B: immunoblots of Dapk3, Inppl1, and Met expressions showed that BA + JA + CA could increase Dapk3 and Inppl1 expressions blocked by Met crispr, while BA, JA, CA had no effects; C: bar graphs showed quantitative evaluation of A; D: bar graphs showed quantitative evaluation of B; E: bar graphs showed quantitative evaluation of B. BA: 750 mg JA/kg body weight, 210 mg CA/kg body weight, or 50 mg BA + 250 mg JA + 70 mg CA /kg body weight (BA+JA+CA group) during treatment. AS1949490 was used at a 300 mg/kg dose. BA: baicalin; CA: cholic acid; JA: jasminoidin; I/R: ischemia-reperfusion; Crispr: crispr/cas9; Met: mesenchymal-epithelial transition; Inppl1: inositol polyphosphate phosphatase like 1 ; Dapk3: death associated protein kinase 3. All data are expressed as mean ± standard deviation (n = 3). Statistical significance between multiple groups was determined in this study primarily using one-way or two-way analysis of variance. ^aP < 0.05, compared to the Sham group.

3.3. Inhibition of biological effects of the neurons generation modules composed of Met, Inppl1, and Dapk3 impaired BA + JA + CA-induced angiogenesis and neurogenesis

To further explore whether the modules of neuron generation were composed of Met, Inppl1, and Dapk3 functions, specific SHIP2 inhibitors, AS1949490, were utilized. Confocal microscopic analysis of CD31/ NeuN and BrdU stained tissues revealed that the angiogenesis and neurogenesis were associated with I/R injury. As measured by CD31, NeuN, and BrdU staining, angiogenesis and neurogenesis dramatically increased in rats treated with BA + JA + CA. (Figure 3A, 3B)

Figure 3. Inhibition of biological effects of the modules of neurons generation composed of Met, Inppl1, and Dapk3 impaired BA + JA + CA-induced angiogenesis and neurogenesis.

A: co-treatment with SHIP2 inhibitors AS1949490 and/or Crispr-Met impaired BA + JA + CA-induced angiogenesis as demonstrated by CD31 and BrdU immunostaining (× 40 magnification, each sample was repeated three times, use of immunofluorescence staining). A1: Sham Group; A2: I/R group; A3: I/R + BA + JA + CA group; A4: I/R + BA + JA + CA + AS group; A5: I/R + BA + JA + CA + CrisprMet group; A6: I/R + BA + JA + CA + CrisprMet + AS group; Arrows point to co-localisation of CD31 and BrdU indicate angiogenesis. B: co-treatment with SHIP2 inhibitors AS1949490 and/or Crispr-Met impaired BA + JA + CA-induced neurogenesis as demonstrated by NeuN and BrdU immunostaining (× 40 magnification, each sample was repeated three times, use of immunofluorescence staining); B1: Sham Group; B2: I/R group; B3: I/R + BA + JA + CA group; B4: I/R + BA + JA + CA + AS group; B5: I/R + BA + JA + CA + CrisprMet group; B6: I/R + BA + JA + CA + CrisprMet + AS group. The arrows point to the co-localisation of NeuN and BrdU, suggesting that neuronal biogenesis. C: contents of BDNF in brain tissues; D: contents of VEGF in brain tissues; E: bar graphs showed quantitative evaluation of A; F: bar graphs showed quantitative evaluation of B. 750 mg JA/kg body weight, 210 mg CA/kg body weight, or 50 mg BA + 250 mg JA + 70 mg CA /kg body weight (BA + JA + CA group) during treatment. AS1949490 was used at a 300 mg/kg dose. BA: baicalin; CA: cholic acid; JA: jasminoidin; I/R: ischemia-reperfusion; Crispr: Crispr/cas9; Met: mesenchymal-epithelial transition; Inppl1: inositol polyphosphate phosphatase like 1; Dapk3: death associated protein kinase 3; SHIP2: src homology 2 domain-containing inositol 5'-phosphatase 2; BrdU: bromodeoxyuridine; AS: Clustered Regularly Interspaced Short Palindromic Repeats; BDNF: brain-derived neurotrophic factor; VEGF: vascular endothelial growth factor. Statistical significance between multiple groups was determined in this study primarily using one-way or two-way analysis of variance. All data are expressed as mean ± standard deviation (n = 5). ^aP < 0.05, compared with sham + empty vector group; ^bP < 0.05, compared with I/R group; ^cP < 0.05, compared with I/R + BA + JA + CA group; ^dP < 0.05, compared with sham + I/R + BA + JA + CA + Crispr Met + AS group.

Next, the growth factor including nerve growth factor and angiogenic growth Factor: VEGF and BDNF, which evaluate the chronic repair process of MCAO/reperfusion model were evaluated. VEGF is one of the growth factors, and BDNF is one of the neurotrophic factors that are related to neurogenesis. As expected, the expression of VEGF and BDNF was enhanced after BA + JA + CA treatment as compared with the I/R group. After co-treated with either Crispr Met or AS1949490, the levels of VEGF and BDNF have a significant reduction compared with those treated with BA + JA + CA (Figure 3C, 3D).

Furthermore, Rats that were co-treated with either Crispr Met or AS1949490 displayed a significant reduction in angiogenesis and neurogenesis compared with those treated with BA + JA + CA, while treatment with both inhibitors resulted in deficits that were most significantly reduced (Figure 3E, 3F). These findings strongly indicate that both Met and SHIP2 are essential for the recovery process induced by BA + JA + CA.

However, Crispr Met had no effects in the roles of BA, CA, JA, or BA + JA + CA on neural apoptosis (Figure 4). These findings indicate that the BA + JA + CA-dependent Met-axiation module is a functional module for neuron generation.

Figure 4. Effects of Crispr-Met on BA + JA + CA-induced apoptosis of neurons as demonstrated by PI and Annexin-FITC V staining.

A: neuronal apoptosis in Met Crispr animals; A1: Sham group; A2: I/R group; A3: I/R + BA group; A4: I/R + CA group; A5: I/R + JA group; A6: I/R + BA + CA + JA group; B: neuroapoptosis in non-Met Crispr animals; B1: Sham group; B2: I/R group; B3: I/R + BA group; B4: I/R + CA group; B5: I/R + JA group; B6: I/R + BA + CA + JA group; C: percentages of apoptotic cells are indicated; D: percentages of apoptotic cells are indicated; E: percentages of apoptotic cells are indicated. 750 mg JA/kg body weight, 210 mg CA/kg body weight, or 50 mg BA + 250 mg JA + 70 mg CA /kg body weight (BA + JA + CA group) during treatment. AS1949490 was used at a 300 mg/kg dose; Met: mesenchymal-epithelial transition; PI: propidine iodide; FITC: fluorescein isothiocyanate; BA: baicalin; CA: cholic acid; JA: jasminoidin; I/R: ischemia-reperfusion. All data are expressed as mean ± standard deviation (n = 3). Statistical significance between multiple groups was determined in this study primarily using one-way or two-way analysis of variance. ^aP < 0.05, compared with I/R.

4. DISCUSSION

Multiple-target drugs may overcome the many limitations of single-target drugs and achieve more effective and safer disease control. Numerous high-throughput experiments and computational algorithms or approaches, such as multiple target optimal intervention, flow of molecules, diversity modeling and simulation, network component analysis, and state-of-the-art, may identify single targets within a network context.^{14,⇓,⇓-17} To reduce the complexity of networks in target stratification and functional analysis, we define an active unit as a module to describe the subnetworks by taking multiple nodes as a circuit or loop, which can be classified as a feedback and feed-forward loop, and connecting nodes as a subset or module of the network. As previously described, a module is the minimal functional unit of a pharmacological profile. Such a unit may be constructed with a single node (target) or many related targets in a broad spectrum, but the change of a module must result in an altered outcome.⁴

SHIP1 and SHIP2 share a high percentage of amino acid identity and contain multiple protein-protein interaction domains such as SH2 domain, NPXY motifs, and proline-rich sequences. Although SHIP2 has a high degree of homology with SHIP1 in its SH2 domain and catalytic region, the molecules are largely divergent in the C-terminal region. It has been reported that the FcgRIIb-SHIP2 axis links Ab neurotoxicity to tau pathology by dysregulating PtdIns (3, 4) P2 metabolism, providing insights into the therapeutic potential against Alzheimer’s disease.¹⁸ Hepatocyte growth factor (HGF/SF) and its receptor, Met tyrosine kinase, are among the most predominant systems described to date that have been developed to help elucidate the molecular events leading to lamellipodium formation and epithelial cell migration.¹⁹ Recently, evidence has been accumulating that SHIP2 binds directly to the HGF/SF receptor c-Met via phosphotyrosine 1356.²⁰ Death-associated protein kinase 3 (Dapk3) is a Ca²⁺ /calmodulin-regulated serine/threonine kinase that mediates cell death.²¹ However, there have been few reports on the effects and mechanisms of SHIP2, Met, and Dapk3 on cerebral ischemia.

Pevious studies on Met-mediated signaling pathway, which is mostly consider as an important oncogenic pathway related to antitumor drug resistance,²² and relatively rarely reported with effect in neurogenesis,^23,24 were mostly focus on the changes of the hub proteins as HGF, Met in the pathway and hardly to find the close PPI relationship with the proteins in other pathways. However, in the view of modular pharmacology, a close relationship exists between the structure and function of the modules.^4,25,26 In the present study, the neural regeneration module activated by BA, JA, and CA, the most important ingredients of QKL, is a “π” structure that may reflect the neurogenesis and angiogenesis processes. In the interaction model between Met, Inppl1, and Dapk3, Inppl1 with the N-terminal SH2 domain binds to the PSI domain of Met in the extracellular region. In contrast, Dapk3, with a C-terminal domain, interacts weakly with the PKC domain of Met in the intracellular region.

To determine whether the functional modules mediate neural regeneration, brain slices from sham control rats, I/R rats, and I/R rats treated with BA + JA + CA were stained with antibodies targeting Brdu/NeuN and Brdu/CD31, the neurogenesis and angiogenesis indicator. The number of cells positive for BrdU/NeuN and Brdu/CD31 was significantly higher in the BA + JA + CA-treated group than in the I/R group. In addition, rats co-treated with either lentiviral vector-mediated Crispr/cas9-Met or AS1949490 displayed weaker neurogenesis and angiogenesis than those treated with BA + JA + CA alone. Simultaneously, treatment with both inhibitors resulted in the most significant reduction in neurogenesis and angiogenesis stimulated by BA + JA + CA. These results strongly indicate that both Met and SHIP2 are essential for the recovery process induced by BA + JA + CA.

In conclusion, the present study indicated that the model is drug (QKL)-dependent rather than disease (cerebral ischemia)-dependent. Nevertheless, it is believed that understanding the functional modules that contribute to pharmaceutical mechanisms might provide novel signatures that can be used as endpoints to define disease processes or the effects of “Fangji” under stroke or cerebral ischemia conditions.

5. SUPPORTING INFORMATION

Supporting data to this article can be found online at http://journaltcm.com.