TABLE 1.
Efficiencies of electroporation of int-attP plasmids into wild-type M. xanthus (strain DK1622).
| Plasmid | Refer-ence | Size (kb) | Marker(s)a | EOE (μg−1)b |
|---|---|---|---|---|
| pBGS18 | 25 | 3.6 | Kmr | 0 |
| pAY721 | 23 | 5.8 | Kmrint-attP region | 2.6 ± 104 |
| pGB2 | 6 | 4.0 | Spr Smr | 1.6 ± 102 |
| pAY952 | 17 | 6.2 | Spr Smrint-attP region | 3.6 ± 104 |
Plasmids carry either the npt! gene (Kmr determinant) from transposon Tn903 or the aadA gene (Spr Smr determinant) from conjugative plasmid R100; a subset of plasmids also encode the int-attP site-specific recombination functions from temperate M. xanthus phage Mx8.
Efficiencies of electroporation (EOE) were determined from the average results of at least four independent experiments, in which 100 to 200 ng of DNA was used to electroporate 109 wild-type cells as described previously (10). The value of 1.6 ± 102electroporants/μg for pGB2 DNA represents the background of spontaneous Spr Smr mutants; all of these (23 of 23 tested) did not repurify as resistant colonies. Spontaneous resistant mutants can be also distinguished from recombinants carrying integrated plasmids by amplifying purified M. xanthus DNA from resistant strains with the primers TM5 (CCCCAAGCTTGGTACCACTAGTTATTTGCCGACTACCTTGGTGA) and TM6 (AAAAAAGCTTCCATGGTTTCATGGCTTGTTATGACTG), specific for the aadA gene and its promoter, respectively. In addition, these primers permit amplification of the aadA gene and its promoter from plasmid templates for direct cloning into sites within M. xanthus genes.