Skip to main content
NCBI home page
Journal of Animal Science logoLink to Journal of Animal Science
. 2023 Dec 23;102:skad418. doi: 10.1093/jas/skad418

Ageratina adenophora damages the rumen epithelium via inducing the expression of inflammatory factors in goats

Xiaoxuan Wang 1, Jianchen Wang 2, Samuel Kumi Okyere 3,4, Ruya Huang 5, Chenyang Shao 6, Muhammad Yousif 7, Junliang Deng 8, Yanchun Hu 9,✉
PMCID: PMC10781442  PMID: 38142130

Abstract

The aim of this experiment was to investigate the effects of Ageratina adenophora on the expression of epithelium tight junction proteins and inflammatory factors in the rumen of goats. Twelve goats were randomly divided into three groups. The first group was the blank control group (n = 3, C) which was fed normal diet. The second group was fistulas control group (n = 3, RFC), which was fitted with rumen fistulas, and fed normal diet. The third group was the A. adenophora test group (n = 6, AA), which was fitted with rumen fistulas and fed a mixture of 60% of normal diet and 40% of A. adenophora grass powder. The feeding experiment lasted for 90 d, after which all goats were sacrificed and samples were collected from the rumen dorsal sac and ventral sac. The relative expression of mRNA of inflammatory factors in the rumen epithelium (tumor necrosis factor alpha [TNF-α], interferon gamma [IFN-γ], interleukin 1 beta [IL-1β], IL-2, IL-4, IL-6, and IL-10) and tight junction protein genes (occludin, claudin-1, and ZO-1) was measured by quantitative real-time fluorescence PCR. Expression of tight junction proteins in the rumen epithelium was measured by Western blot. A correlation was established between the expression of inflammatory factors and tight junction protein genes using Graph Pad Prism. The results showed that A. adenophora caused a significant increase in the mRNA expression levels of TNF-α, IFN-γ, IL-1β, IL-2, IL-6, and IL-10 in the rumen epithelial (P < 0.05 or P < 0.01). The expression of tight junction proteins at both gene and protein levels was significantly decreased (P < 0.05 or P < 0.01). Furthermore, the correlation analysis revealed that the changes in tight junction protein expression in the test group were closely related to the upregulation of the expression of inflammatory factors TNF-α and IFN-γ in rumen epithelial cells. In conclusion, the expression of inflammatory factors was increased and the expression of tight junction proteins was decreased in goats after feeding on A. adenophora, which caused some damage to the rumen epithelium.

Keywords: Ageratina adenophora, goats, inflammatory factors, rumen epithelial cells, tight junction proteins

1.Ageratina adenophora feeding causes damage to the rumen epithelium via increasing inflammatory factors and reducing tight junction proteins.

2.There is a close correlation between the increased expression of inflammatory factors and decreased expression of tight junction proteins in goat rumen epithelial cells after feeding goats with A. adenophora.

Introduction

Ageratina adenophora (Spreng.) is a perennial herb in the composite family. It was first introduced to China from Southeast Asia in the 1940s (Giri et al., 2022). In 2003, the State Environmental Protection Administration ranked this plant as the most invasive among the first blacklist of 16 alien plant species identified (Zhang et al., 2008). Ageratina adenophora has a strong capacity for invasion and ecological adaptation, and its leaves can release chemosensitive substances to inhibit the growth of other plants (Zhang et al., 2012), which has caused irreversible damage to the ecological environment and biodiversity in southwest China, as well as severe economic losses for livestock production in China’s grasslands.

Livestock that accidentally ingests A. adenophora shows toxicity symptoms such as contact dermatitis, mental depression, diarrhea, hair removal, wasting, and muscle tremor (Zhang, 2014; Jamloki et al., 2022), as well as showing different degrees of pathological changes mainly inflammatory damage. At present, more than 100 chemical substances have been isolated and identified from A. adenophora, among which the sesquiterpenoid compound 9-oxo-10,11-dehydroageraphorone (Euptox A) is considered to be the main toxic substance of this plant (Liu et al., 2021). A number of studies have shown that it has significant hepatotoxicity and immunotoxicity in different animals (such as mice, rats, rabbits, horses, and sheep; Katoch et al., 2000; O’sullivan, 1979; He et al., 2015a; Sun et al., 2019; Okyere et al., 2020).

With the aim of investigating the toxic effects of A. adenophora on the parenchymal organs of ruminants, our laboratory previously fed different proportions of A. adenophora leaf powder to Saneng dairy goats, and the results showed increased hepatocyte degeneration and necrosis, enlarged and congested spleen, and renal tissue hemorrhage and degeneration, indicating that A. adenophora can damage the parenchymal organs of goats such as liver, spleen, and kidneys (Jie et al., 2018; Sun et al., 2018; Ren et al., 2021). At present, there are few studies on the toxic effect of A. adenophora on the digestive system of ruminants. Rumen, as a unique digestive organ of ruminants, is the first place where food reaches through the esophagus, therefore in this experiment, we investigated the effect of A. adenophora on the expression of rumen epithelial tight junction protein and inflammatory factor by feeding A. adenophora grass powder to goats to lay the foundation for investigating the mechanism of A. adenophora poisoning and to provide new ideas for the control of A. adenophora poisoning disease.

Materials and Methods

Statement of Institutional Animal Care and Use committee

This study was approved by the Animal Care and Use Committee of Sichuan Agricultural University (Approval No.: 2012-024). All animal operations and procedures were conducted according to the approved guidelines and were in accordance with the International Guide for the Care and Use of Laboratory Animals.

Plant samples, test animals, and feeds

Ageratina adenophora was collected from Hatu Village, Huangliangguan Town, Liangshan Prefecture, Sichuan Province, China. The samples identification and powder preparation were performed as described in our previous studies by Cui et al. (2022).

Chengdu Ma Goat was selected as the experimental animal. Twelve castrated goats weighing 22.5 ± 2 kg aged 5 to 6 mo were purchased from the National Chengdu Ma Goat breeding farm of Xiling Snow Agricultural Development Co., Ltd, Chengdu, Sichuan Province.

Fresh ryegrass and alfalfa pastures were supplied by the National Chengdu Ma Goat breeding farm of Xiling Snow Agricultural Development and G03 goat concentrate supplement was purchased from Sichuan Hengfeng Feed Co., Ltd. These two types of feed were orally consumed by goats.

Experimental design

Experiment animals were randomly assigned to three groups, the blank control group C (n = 3), rumen fistula control group (RFC; n = 3), and experimental group AA (n = 6), and each goat in each group was kept in a different section of the pen (Figure 1). The RFC group was included to demonstrate that the damage to the rumen epithelium was not due to rumen fistulas, but was due to feeding A. adenophora. The pen was thoroughly cleaned daily and 15% bleach solution was used to disinfect the goat pen floor, fences, food troughs, and water troughs by spraying. Goats were injected subcutaneously with the anthelmintic abamectin at a dose of 0.2 mg/kg, and were kept in their respective pens for one week for acclimatization. After the 1-wk adaptation period, goats in the fistula control and the experimental groups underwent rumen fistulation and began feeding test after recovery. The blank control group was fed fresh forage and concentrate feed per day. The rumen fistula control group was fed fresh forage and concentrate feed per day, and the rumen fistula was opened for 10 min/d, in order to be consistent with the experimental group or prevent bias as the fistula of the test group was opened daily for the administration of A. adenophora powder. The experimental group was fed fresh forage and concentrate feed normally, and was fed 40% A. adenophora powder through rumen fistula. This dose was selected based on our previous experiments, which showed that goats were affected when they were fed fresh A. adenophora 400 g/kg (40%) of the fresh forage (He et al., 2015b). The A. adenophora powder is prepared by drying, grinding, and sieving freshly harvested A. adenophora leaves. See Table 1 for the individual feed ratio. During the experiment, the feed was controlled as each goat received 2.5 kg of total feed plus 250 g of concentrate each day. However, water was given ad libitum.

Figure 1.

Figure 1.

Open in a new tab

Goat pen environment and goats kept in separate pens.

Table 1.

Individual rations for each experimental group

Feed, g Control group (C) Rumen fistula control group (RFC) A. adenophora group (AA)
Fresh forage 2,500 g/day/goat 2,500 g/day/goat 1,500 g/day/goat
Concentrate feed 250 g/day/goat 250 g/day/goat 250 g/day/goat
A. adenophora 0 g/day/goat 0 g/day/goat 1,000 g/day/goat
Open in a new tab

Sample collection

After 90 d of feeding, all goats were sacrificed and blood and tissues were collected. Clinical body surface examinations were performed before dissection, including developmental status, nutritional status, mental status, sensory organs, respiratory system, digestive system, coat, and skin. After dissection, internal examination was conducted to check whether there were pathological changes under the skin, the condition of subcutaneous fat, and the rumen color and pathological damage were observed.

After the goat was dissected, the digestive tract was separated to obtain the rumen, and the rumen dorsal and ventral sac tissues were collected. The sample size was 3 cm × 3 cm, the mucosa was separated, and the samples were rinsed with PBS, then divided into sterile freeze-storage tubes without enzymes. The tubes were then frozen in liquid nitrogen, and stored at −80 °C for the determination of the expression levels of tight junction proteins and inflammatory factors.

Detection of inflammatory factors and tight junction protein gene mRNA

Total RNA extraction and reverse transcription

Samples of rumen dorsal and ventral sac tissues frozen in liquid nitrogen were collected, quickly placed in a mortar, and ground to powder. Total RNA was extracted from the sample according to the instructions of Trizol (Shengong Bioengineering Co., Ltd, Shanghai, China). The purity and concentration of RNA were determined using an ultraviolet spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The extracted total RNA was then reverse transcribed according to the instructions of the reverse transcription premix kit (Hunan Ecoray Bioengineering Co., Ltd., Hunan, China), and the resulting cDNA was stored at −20 °C for testing.

Primer design

According to the mRNA sequences of goats tumor necrosis factor alpha (TNF-α), interferon gamma (IFN-γ), interleukin 1 beta (IL-1β), interleukin 2 (IL-2), interleukin 4 (IL-4), interleukin 6 (IL-6), interleukin 10 (IL-10), occludin, claudin-1, zonula occluden 1 (ZO-1), β-Actin, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) collected in National Center for Biotechnology Information (NCBI) database, Primer Premier 5.0 software was used to design primers and sent to Shanghai Shengong Biology for primer synthesis. The specificity of the synthesized primers was tested using the NCBI BLAST tool and conventional PR. Specific primer sequences and sizes of amplified products are shown in Table 2.

Table 2.

Primers used for the real-time PCR analysis

Genes Primer sequence (5ʹ→3ʹ) Product length, bp Annealing temperature, °C Gene ID
TNF-α F:CAGGGCTCCAGAAGTTGCT 183 56.1 100861232
R:TGAGGCTTGAGAAGATGACC
IFN-γ F:CAAGTAACCCAGATGTAGC 101 48.9 100860815
R:GACAATTTGGCTCTGAATAA
IL-1β F:GGCAACCGTACCTGAACCC 205 59.7 100860816
R:CACGATGACCGACACCACC
IL-2 F:ATGCCCAAGGTTACCGCTAC 213 60.5 102183089
R:CTCTGGTGTTCAGGTTTTTGCT
IL-4 F:ATGTACCAGCCACTTCGTC 202 51.2 100860814
R:GTGGTTCCTGTAGATACGC
IL-6 F:GATGACTTCTGCTTTCCCTAC 199 53.4 100860785
R:TTCTGCCAGTGTCTCCTTG
IL-10 F:TCTGTTGCCTGGTCTTCCT 170 53.5 100860746
R:GCTGTTCAGTTGGTCCTTC
Occludin F:CGGAGGAAGTGCCTTTGGT 102 61.1 102185782
R:CCCTTTGCCGCTCTTGGAT
Claudin-1 F:CCCGTGCCTTGATGGTGAT 104 59.7 102189710
R:CTGTGCCTCGTCGTCTTCC
ZO-1 F:CCAGCCAGTCCAGACCAAG 204 58.1 102178667
R:AGGCGAATAATGCCAGAGC
GAPDH F:CACTGCCACCCAGAAGACT 193 56.2 100860872
R:CAGATCCACAACGGACACG
β-actin F:ATCCTGCGGCATTCACGAAA 153 60.4 102179831
R:GCCAGGGCAGTGATCTCTTT
Open in a new tab

Quantitative real-time fluorescence-polymerase chain reaction

Quantitative real-time fluorescence polymerase chain reaction was performed by SYBR green fluorescent dye method. The CFX96 PCR assay system (Bio-Rad, Hercules, CA, USA) was used for PCR amplification. The reaction conditions were as follows: pre-denature at 95 °C for 30 s; denature at 95 °C for 5 s, annealing at 60 °C for 30 s, and cycling 40 times. This was repeated three times for each sample. Each reaction system was 12.5 μL, which contained 6.25 μL SYBR Green Taq (Hunan Ecori Biological Engineering Co., Ltd), upstream and downstream primes 0.5 μL each, 4.25 μL ddH2O (Beijing Soleibao Technology Co., Ltd., Beijing, China), and 1 μL cDNA. GAPDH and β-actin were used as internal reference genes. The gene expression was corrected using double-reference gene method, and mRNA relative expression of the target gene was calculated by the 2−ΔΔCt method (Li et al., 2022). All samples were repeated three times. The calculation formula is as follows:

Cqinternalreference=CqGAPDH⋅Cq β -actin

Determination of relative expression of tight junction protein

Total protein was extracted from rumen dorsal and ventral sac tissue samples using a total protein extraction kit (Beijing Solaibao Technology Co., Ltd), and the concentration of extracted protein was determined using a BCA protein concentration assay kit (Beijing Solaibao Technology Co., Ltd.). After the extracted protein concentration was normalized, 5× loading buffer was added (Biyuntian Biotechnology Co., Ltd., Shanghai, China). The sample was prepared, and the packaged protein sample was denatured in 100 °C water bath for 15 min. The target protein was isolated by 12.5% SDS-PAGE electrophoresis, and the protein was transferred to polyvinylidene fluoride membrane by wet transfer method. After 1 h closure with triethanolamine-buffered saline solution + 0.1% Tween20 (TBST) + 5% BSA, primary antibodies (GAPDH [Affinity Biosciences, Jiangsu, China], occludin, claudin-1, and ZO-1 [Proteintech, Wuhan, China]) were added and incubated at 4 °C overnight. After incubation, TBST was used for cleaning three times, rabbit (or mouse) Proteintech containing horseradish peroxidase (HRP) was incubated for 1 h, and after TBST washing five times, enhanced chemiluminescence (ELC) reagent (Thermo Fisher Scientific) was used for color development. The chemiluminescence was analyzed and photographed in the ChemiDOC MPimaging system (Bio-Rad), and Image J (National Institutes of Health, Bethesda, MD, USA) was used to analyze and calculate the relative expression of the target protein based on gray scale value analysis.

Data analysis

The experimental data were preliminarily sorted in Excel sheets. For gene expression evaluation, the 2−ΔΔCt method was used and the results were statistically evaluated using SPSS Statistics 20.0 (SPSS Inc., Chicago, IL) for one-way ANOVA and multiple comparison tests (LSD comparisons or Dunnett T3 comparisons). Origin (OriginLab, Northampton, MA, USA) was used to plot the results from the SPSS analysis whereas Graphpad Prism 9 (GraphPad Software., CA, USA) was used to analyze the correlation between inflammatory factor expression and tight junction protein expression, as well as plot the graphs. Different lowercase letters indicate significant differences (P < 0.05), and different uppercase letters indicate highly significant differences (P < 0.01). Data are expressed as mean ± SD.

Result

Clinical body surface and internal examinations

There were no abnormal changes in the clinical body surface examinations of the goats in the two control groups, and no abnormalities were found on internal examinations after autopsy. Compared with the two control groups, goats in the experimental group had lower body weight, often stood or crouched against the wall, had mouth foaming occasionally, reduced rumination, and rough fur coats without luster. In addition, after dissection, we observed that the goats in the test group had reduced subcutaneous fat, darker rumen epithelium with black-green attachments, and sparse rumen papillae.

Effect of A. adenophora on mRNA expression of rumen epithelial inflammatory factors in goats

In the rumen dorsal sac (Figure 2), there were no differences in the expression of inflammatory factor IL-4 in experimental groups compared with the two control groups (P > 0.05). TNF-α, IFN-γ, IL-1β, IL-2, IL-6, and IL-10 mRNA expressions in the experimental group were higher compared with two control groups (P < 0.01). However, there were no differences between the two control groups (P > 0.05).

Figure 2.

Figure 2.

Open in a new tab

mRNA expression of inflammation factors in rumen dorsal sac of goats fed A. adenophora. (A–E) Relative mRNA expression level of pro-inflammatory factors; (F, G) Relative mRNA expression level of anti-inflammatory factors. Bar graphs indicate mean ± standard deviation, and different upper and lower case letters indicate statistically significant differences (P < 0.05, P < 0.01). C: Control group; RFC: Rumen fistula control group; AA: A. adenophora experimental group.

In the ventral sac of the rumen (Figure 3), there were no changes in IL-4 expression between the experimental groups compared with the two control groups (P > 0.05). The mRNA expressions of TNF-α, IL-1β, IL-2, IL-6, and IL-10 in experimental groups were increased compared with those in control groups (P < 0.01). IFN-γ expression in the experimental group was higher compared with that in the blank control (P < 0.01) and the fistula control group (P < 0.05), but no difference was observed between the two control groups (P > 0.05).

Figure 3.

Figure 3.

Open in a new tab

mRNA Expression of inflammation factors in rumen ventral sac of goats fed A. adenophora. (A–E) Relative mRNA expression level of pro-inflammatory factors; (F, G) Relative mRNA expression level of anti-inflammatory factors. Bar graphs indicate mean ± standard deviation, and different upper and lower case letters indicate statistically significant differences (P < 0.05, P < 0.01). C: Control group; RFC: Rumen fistula control group; AA: A. adenophora experimental group.

Effect of A. adenophora on mRNA and protein expression of rumen epithelium in goats

Effect of A. adenophora on tight junction mRNA expression on rumen epithelium of goat

For rumen dorsal sac (Figure 4), the mRNA expression of the tight junction protein occludin and claudin-1 in the test group were lower than in the two control groups (P < 0.01); ZO-1 expression in the test group was reduced compared to the blank control (P < 0.01) and the fistula control (P < 0.05); however, there was no difference between the two controls (P > 0.05).

Figure 4.

Figure 4.

Open in a new tab

mRNA Expression of TJ proteins in rumen dorsal sac of goats fed A. adenophora. (A) Relative mRNA expression level of occludin; (B) relative mRNA expression level of claudin-1; (C) relative mRNA expression level of ZO-1. Bar graphs indicate mean ± standard deviation, and different upper and lower case letters indicate statistically significant differences (P < 0.05, P < 0.01). C: Control group; RFC: Rumen fistula control group; AA: A. adenophora experimental group.

In the rumen ventral sac (Figure 5), the mRNA expression of occludin, claudin-1, and ZO-1 tight junction proteins in the test group was lower than in the two control groups (P < 0.01). There were no differences between the two control groups (P > 0.05).

Figure 5.

Figure 5.

Open in a new tab

mRNA Expression of TJ proteins in rumen ventral sac of goats fed A. adenophora. (A) Relative mRNA expression level of occludin; (B) relative mRNA expression level of claudin-1; (C) relative mRNA expression level of ZO-1. Bar graphs indicate mean ± standard deviation, and different upper and lower case letters indicate statistically significant differences (P < 0.05, P < 0.01). C: Control group; RFC: Rumen fistula control group; AA: A. adenophora experimental group.

Effect of A. adenophora on tight junction protein expression on rumen epithelium of goats

The expression of tight junction proteins in the ventral sac of the goat rumen was examined by Western blotting. As shown in Figure 6, the expression of occludin in the experimental group decreased compared with the blank control group (P < 0.01), and the fistula control group (P < 0.05), but no difference was observed between the two controls (P > 0.05). The expression of claudin-1 protein in experimental groups was lower compared to the two control groups (P < 0.01). ZO-1 protein expression in the experimental group was decreased compared with the blank control group (P < 0.05), and the fistula control group (P < 0.01), but no difference existed between the two control groups (P > 0.05).

Figure 6.

Figure 6.

Open in a new tab

Effect of A. adenophora on TJ proteins expression in rumen epithelium. (A) The expression of occludin, claudin-1, and ZO-1 in rumen ventral sac by Western blot; (B–D) relative protein expression of occludin, claudin-1, and ZO-1 in rumen ventral sac. Bar graphs indicate mean ± standard deviation, and * indicates statistically significant differences (*P < 0.05, **P < 0.01, ****P < 0.0001). C: Control group; RFC: Rumen fistula control group; AA: A. adenophora experimental group.

The correlation between the expression level of tight junction protein and inflammatory factors after feeding A. adenophora in goats

Further correlation analysis of tight junction protein and inflammatory factor mRNA expression showed that (Figure 7), occludin correlated negatively with TNF-α mRNA expression in both dorsal and ventral sacs (rumen dorsal sac: r = −0.8217, P < 0.0001; rumen ventral sac: r = −0.8628, P < 0.0001). ZO-1 also showed a negative correlation with TNF-α mRNA expression in both dorsal and ventral sacs (rumen dorsal sac: r = −0.7120, P < 0.0001; rumen ventral sac: r = −0.8000, P < 0.0001), whereas claudin-1 showed no significant correlation with TNF-α mRNA expression (P > 0.05) for both dorsal and ventral sacs. Occludin (rumen dorsal sac: r = −0.8198, P < 0.0001; rumen ventral sac: r = −0.5428, P = 0.0019), claudin-1 (rumen dorsal sac: r = −0.8634, P < 0.0001; rumen ventral sac: r = −0.4786, P = 0.0075), and ZO-1 (rumen dorsal sac: r = −0.5668, P = 0.0006; rumen ventral sac: r = −0.5295, P = 0.0026) all showed negative correlation with IFN-γ mRNA expression both in dorsal and ventral sacs. Expression of the three tight junction proteins did not correlate with the expression of other inflammatory factors (P > 0.05). The above results indicate that A. adenophora induces increased expression of inflammatory factors in the rumen epithelium, and the increased expression of the pro-inflammatory factors TNF-α and IFN-γ is closely correlated with the expression of specific tight junction proteins in the rumen epithelium.

Figure 7.

Figure 7.

Open in a new tab

Correlation between inflammation factors and TJ proteins mRNA expression of rumen sacs in goats fed A. adenophora. (A–E) Correlation between inflammatory factors mRNA expression and TJ proteins mRNA expression in rumen dorsal sac, (F–J) correlation between inflammatory factors mRNA expression and TJ proteins mRNA expression in rumen ventral sac.

Discussion

The invasion of A. adenophora has posed a serious threat to animal husbandry in southwest China, and many studies have shown that its toxic components (Euptox A) can cause a variety of animal poisoning and inflammatory damage to animal substantive organs (Liu et al., 2021). Oxidative stress and elevated levels of pro-inflammatory factors in the liver of mice fed with A. adenophora cause structural and functional disorders in mitochondria, which activate the cellular death signaling pathway and ultimately result in inflammatory injury to the liver. The rate of apoptosis and mortality of splenocytes increased significantly when fed at high doses (Sun et al., 2019). Rabbits were reported dead 6 to 9 d after eating A. adenophora and the autopsy showed a swollen liver (Li, 2001). In addition, the authors found that the gallbladder was swollen and filled with bile, spalling of the gastric mucosa, and blood spot in the submucosa. Postmortem examination of the dead horses after eating A. adenophora showed chronic lung infection, the visceral pleura on the lung surface was white and thickened, and there was local adhesion in the parietal layer of the pleura (Li, 2001; O’sullivan, 1979). Our laboratory previously conducted an experiments were different doses of A. adenophora powder was fed to Saanen goats, and found that the liver, kidney, and spleen were affected. We observed that the spleen and kidney of the goats were enlarged, the liver and spleen had bruises, the hepatocytes were degenerated, and the kidney tissues were accompanied by hemorrhage, necrosis, and degeneration (He et al., 2015b).

Rumen is one of the most important places for digestion, absorption, and nutrient metabolism of ruminants. The internal environment of the rumen must be stable for digestion, absorption, and metabolic functions to function properly, with the rumen epithelium playing an important role in maintaining the stability of the internal environment, and cells relying on cell adhesion and cell communication for the coordinated performance of various functions (Ye et al., 2016). Cell junctions are basically divided into tight junctions, adhesive junctions, desmosomal junctions, and gap junctions, each of which has a different structure and distribution that gives them specific functions. The tight junctions form the basic structure of the mechanical barrier and are essential for maintaining the normal structure and function of the rumen epithelium (Marchiando et al., 2010). Tight junctions include transmembrane proteins occludin, claudin family, intracellular protein ZO, and junction adhesion factor JAMs. Currently, occludin, claudins, and ZO-1 are believed to be major functional regulatory proteins of tight junctions, and claudin is the most important functional molecule in tight junctions of epithelial cells. Its distribution is tissue-specific, and claudin-1, claudin-4, and claudin-7 are predominantly present in rumen epithelial tissue and form tight junctions in various combinations, contributing to the structural and functional diversity of tight junctions (Harhaj and Antonetti, 2004; Krause et al., 2009). Occludin is one of the functional molecules that form tight junction structure, and its presence affects the expression of claudin protein (Stumpff et al., 2011). ZO plays an intermediary role, connecting occludin, claudin, and intracellular skeleton together to form a stable structure, and ZO-1 exists in almost all vertebrates (Saitou et al., 1998). When tight junctions are disrupted, the expression and distribution of these proteins are altered, resulting in epithelial barrier damage. In this experiment, we found that the expression of occludin, claudin-1, and ZO-1 in the rumen epithelium was significantly reduced at both the gene and protein levels after feeding goats grass powder from A. adenophora, indicating that A. adenophora can reduce the expression of tight junction protein by decreasing the mRNA expression of tight junction protein, leading to disruption of tight junctions between rumen epithelial cells and thus impairment of rumen epithelial structure and function.

When a large amount of harmful substances accumulate in the gastrointestinal tract, the gastrointestinal barrier gets damaged, and a spontaneous protective response is produced by the body, immune cells and rumen epithelial cells which stimulates the release inflammatory factors and then destroy the tight connection between epithelial cells (Musch et al., 2006; Lambert, 2009). In 1989, Madara proposed for the first time that the inflammatory factor IFN-γ has a regulatory effect on the tight junction barrier (Madara and Stafford, 1989). Subsequently, numerous studies have shown that changes in tight junction protein expression, tight junction protein deletion and degradation, and cytoskeletal changes are closely related to the regulatory role of inflammatory factors. It has been shown that activation of the NF-κB pathway to release TNF-α can increase tight junction permeability by decreasing the expression of occludin and ZO-1 (Peeters et al., 2015), as well as the release of claudin-1 from tight junctions (Ma et al., 2004; Guo et al., 2019), thereby impairing gastrointestinal barrier function. IFN-γ can increase cell permeability to macromolecules by decreasing occludin expression and increasing claudin-1 expression to selectively increase cell permeability to macromolecules (Amasheh et al., 2010). The expression changes of other inflammatory factors in digestive tract injury have also been reported (Zhou et al., 2006; Al-Sadi et al., 2007; Smyth et al., 2011; Coccia et al., 2012). The inflammatory factors TNF-α and IFN-γ disrupt epithelial barrier function by disrupting the expression and distribution of tight junction proteins, and disruption of barrier function leads to increased translocation of bacterial endotoxins and other substances, elicit local inflammatory responses, and activate the expression of inflammatory factors, which in turn further damage the dense epithelial barrier, leading to a vicious cycle and causing local inflammation in the gastrointestinal tract and other digestive and metabolic diseases (Plaizier et al., 2012; Jing et al., 2019). In this experiment, we found that the expression of inflammatory factors except IL-4 was significantly increased in the rumen epithelial cells of goats treated with A. adenophora, which proved that A. adenophora could cause inflammatory damage to rumen epithelium of goats. Correlation analysis of tight junction protein gene expression and inflammatory factor expression showed that the expression of occludin and ZO-1 genes in rumen epithelium was negatively correlated with TNF-α expression, and expression of the three tight junction protein genes correlated significantly negatively with IFN-γ expression. The negative correlation between claudin-1 gene expression and IFN-γ was contrary to the results of previous studies. It was speculated that the possible reason was that the feeding experiment lasted for 90 d, and the rumen epithelium caused sustained inflammatory damage, which resulted in a significant increase in the expression of TNF-α and IFN-γ. However, these two inflammatory factors have opposite regulatory effects on claudin-1, resulting in a negative correlation between claudin-1 gene expression and IFN-γ in the results of this experiment.

Conclusion

Ageratina adenophora serves as a feed alternative for ruminants during the dry season, however, in this study, we observed that continued feeding of A. adenophora to goats resulted in damage to the rumen epithelium, which was characterized by a decrease in rumen epithelial tight junction protein expression and an increase in the expression of inflammatory factors. Therefore, farmers who feed their livestock with this plant should have proper feeding strategies such as processing the plant or feeding the plant with other supplements to reduce the toxicity associated with the ingestion of this plant. In addition, this study only presented the toxic effect of the plant powder on the rumen therefore, there is a need for further studies on the toxic effects of A. adenophora on the entire intestinal compartment and microbiota of the ruminants, as well as their underlying mechanism in inducing intestinal toxicity. Furthermore, this study has demonstrated a need for further investigation of other substances (dietary supplements) that can help attenuate the toxic activity of A. adenophora as it serves as an alternative feed resource for farmers during the dry or famine seasons due to its invasive nature.

Acknowledgments

I would like to thank all authors for their hard work in making this study publishable. I also extend my sincere gratitude to the teaching staff of the College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, for their guidance and criticisms in writing this paper. This research was supported by the Sichuan Province Science and Technology Support Program (grant no. 2020YFS0337).

Glossary

Abbreviations

AA

A. Adenophora test group

C

blank control group

IFN

interferon

IL

interleukin

JAMs

junction adhesion molecules

NCBI

National Center for Biotechnology Information

NF-κB

nuclear-factor κB;

PBS

phosphate buffered saline

RFC

fistulas-control group

SDS-PAGE

sodium dodecyl sulfate polyacrylamide gel electrophoresis

TBST

tris-buffered-saline with Tween

TJ

tight junction

TNF

tumor necrosis factor

ZO

zonula occludens

Contributor Information

Xiaoxuan Wang, Key Laboratory of Animal Disease and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, People’s Republic of China.

Jianchen Wang, Key Laboratory of Animal Disease and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, People’s Republic of China.

Samuel Kumi Okyere, Key Laboratory of Animal Disease and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, People’s Republic of China; Department of Pharmaceutical Sciences, School of Medicine, Wayne State University, Detroit, MI 48201, USA.

Ruya Huang, Key Laboratory of Animal Disease and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, People’s Republic of China.

Chenyang Shao, Key Laboratory of Animal Disease and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, People’s Republic of China.

Muhammad Yousif, Key Laboratory of Animal Disease and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, People’s Republic of China.

Junliang Deng, Key Laboratory of Animal Disease and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, People’s Republic of China.

Yanchun Hu, Key Laboratory of Animal Disease and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, People’s Republic of China.

Author Contributions

X.W., J.W., and S.K.O.: conceptualization, methodology, and software. X.W., J.W., S.K.O., R.H., C.S., and M.Y.: data collection, writing, and original draft preparation. S.K.O., J.D., and Y.H.: validation and investigation, funding, review and editing, and supervision. All authors have read and agreed to the published version of the manuscript.

Conflict of interest statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Al-Sadi R.M., Ma T.Y.. 2007. IL-1 Causes an Increase in Intestinal Epithelial Tight Junction Permeability. The Journal of Immunology. 178(7):4641–4649.  doi: 10.4049/jimmunol.178.7.4641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Amasheh, M., Fromm A., Krug S. M., Amasheh S., Andres S., Zeitz M., Fromm M., and Schulzke J. D... 2010. TNF alpha-induced and berberine-antagonized tight junction barrier impairment via tyrosine kinase, Akt and NFkappaB signaling. J. Cell Sci. 123:4145–4155. doi: 10.1242/jcs.070896 [DOI] [PubMed] [Google Scholar]
  3. Coccia, M., Harrison O. J., Schiering C., Asquith M. J., Becher B., Powrie F., and Maloy K. J... 2012. IL-1 beta mediates chronic intestinal inflammation by promoting the accumulation of IL-17A secreting innate lymphoid cells and CD4(+) Th17 cells. J. Exp. Med. 209:1595–1609. doi: 10.1084/jem.20111453 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cui, Y. J., Gao P., Wen J., Okyere S. K., and Hu Y... 2022. The effect of Ageratina adenophora on the structure of various intestinal segments and on intestinal mucosal immune barrier function in rats. Acta Prataculturae Sin. 31:211–220. doi: 10.11686/cyxb2021171. [DOI] [Google Scholar]
  5. Giri, S., Sahu R., Paul P., Nandi G., and Dua T. K... 2022. An updated review on Eupatorium adenophorum Spreng [Ageratina adenophora (Spreng)]: traditional uses, phytochemistry, pharmacological activities and toxicity. Pharmacol. Res. Mod. Chin. Med. 2:100068. doi: 10.1016/j.prmcm.2022.100068 [DOI] [Google Scholar]
  6. Guo, Y., Li H., Liu Z., Li C., Chen Y., Jiang C., Yu Y., and Tian Z... 2019. Impaired intestinal barrier function in a mouse model of hyperuricemia. Mol. Med. Rep. 20:3292–3300. doi: 10.3892/mmr.2019.10586 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Harhaj, N. S., and Antonetti D. A... 2004. Regulation of tight junctions and loss of barrier function in pathophysiology. Int. J. Biochem. Cell Biol. 36:1206–1237. doi: 10.1016/j.biocel.2003.08.007 [DOI] [PubMed] [Google Scholar]
  8. He, Y., Mo Q., Hu Y., Chen W., Luo B., Wu L., Qiao Y., Xu R., Zhou Y., Zuo Z.,. et al. 2015a. E. adenophorum induces cell cycle arrest and apoptosis of splenocytes through the mitochondrial pathway and caspase activation in Saanen goats. Sci. Rep. 5:15967. doi: 10.1038/srep15967 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. He, Y., Chen W., Hu Y., Luo B., Wu L., Qiao Y., Mo Q., Xu R., Zhou Y., Ren Z.,. et al. 2015b. E. adenophorum induces cell cycle and apoptosis of renal cells through mitochondrial pathway and caspase activation in Saanen goat. PLoS One 10:e0138504. doi: 10.1371/journal.pone.0138504 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Jamloki, A., Trivedi V. L., Nautiyal M. C., Semwal P., and Cruz-Martins N... 2022. Poisonous plants of the Indian Himalaya: an overview. Metabolites 12:540. doi: 10.3390/metabo12060540 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Jie, F., Hu Y. C., Chen W. H., Weng J. H., Hu L. W., Zhen S., He Y. J., Quan M., Wang Y., and Ren Z. H... 2018. Dosage-dependent effects of Eupatorium adenophorum on Saanen goat blood levels and the histopathology of several organs. Pratacul. Sci. 35:434–440. doi: 10.11829/j.issn.1001-0629.2017-0214. [DOI] [Google Scholar]
  12. Jing, L., Yu Z., Gao X., Liu C., Lv X., and Zheng S... 2019. Inhibition of tumor necrosis factor alpha and increased of interleukin 10 by Lactobacillus: a molecular mechanism protection against TNBS-induced ulcerative colitis in chicks. Immunopharmacol. Immunotoxicol. 41:1–6. doi: 10.1080/08923973.2019.1566360 [DOI] [PubMed] [Google Scholar]
  13. Katoch, R., Sharma O. P., Dawra R. K., and Kurade N. P... 2000. Hepatotoxicity of Eupatorium adenophorum to rats. Toxicon 38:309–314. doi: 10.1016/s0041-0101(99)00151-8 [DOI] [PubMed] [Google Scholar]
  14. Krause, G., Winkler L., Piehl C., Blasig I., Piontek J., and Müller S. L... 2009. Structure and function of extracellular claudin domains. Ann. N. Y. Acad. Sci. 1165:34–43. doi: 10.1111/j.1749-6632.2009.04057.x [DOI] [PubMed] [Google Scholar]
  15. Lambert, G. P. 2009. Stress-induced gastrointestinal barrier dysfunction and its inflammatory effects. J. Anim. Sci. 87:E101–E108. doi: 10.2527/jas.2008-1339 [DOI] [PubMed] [Google Scholar]
  16. Li, F. Z. 2001. A report on the death of rabbits from poisoning caused by consumption of Ageratina adenophora. Guizhou Anim. Husb. Vet. 02:18–19. doi: 10.3969/j.issn.1007-1474.2001.02.011. [DOI] [Google Scholar]
  17. Li, S., Ma T., Yang J., An Y., Zhang Y., Yang X., and Wang H... 2022. Effect of bitter bean seeds on c-Jun amino-terminal protein kinase/p38 mitogen-activated protein kinase signalling pathway and tight junction protein expression in the rumen epithelium of fattening lambs under high-concentrate ration conditions. Chin. J. Anim. Nutr. 34:13. doi: 10.3969/j.issn.1006-267x.2022.06.053 [DOI] [Google Scholar]
  18. Liu, Y., Luo S. H., Hua J., Li D. S., Ling Y., Luo Q., and Li S. H... 2021. Characterization of defensive cadinenes and a novel sesquiterpene synthase responsible for their biosynthesis from the invasive Eupatorium adenophorum. New Phytol. 229:1740–1754. doi: 10.1111/nph.16925 [DOI] [PubMed] [Google Scholar]
  19. Ma, T. Y., Iwamoto G. K., Hoa N. T., Akotia V., Pedram A., Boivin M. A., and Said H. M... 2004. TNF-α-induced increase in intestinal epithelial tight junction permeability requires NF-κB activation. Am. J. Physiol. Gastrointest. Liver Physiol. 286:G367–G376. doi: 10.1152/ajpgi.00173.2003 [DOI] [PubMed] [Google Scholar]
  20. Madara, J. L., and Stafford J... 1989. Interferon-gamma directly affects barrier function of cultured intestinal epithelial monolayers. J. Clin. Invest. 83:724–727. doi: 10.1172/JCI113938 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Marchiando, A. M., Graham W. V., and Turner J. R... 2010. Epithelial barriers in homeostasis and disease. Annu. Rev. Pathol. 5:119–144. doi: 10.1146/annurev.pathol.4.110807.092135 [DOI] [PubMed] [Google Scholar]
  22. Musch, M. W., Walsh-Reitz M. M., and Chang E. B... 2006. Roles of ZO-1, occludin, and actin in oxidant-induced barrier disruption. Am. J. Physiol. Gastrointest. Liver Physiol. 290:G222–G231. doi: 10.1152/ajpgi.00301.2005 [DOI] [PubMed] [Google Scholar]
  23. O’sullivan, B. M. 1979. Investigations into Crofton weed (Eupatorium adenophorum) toxicity in horses. Aust. Vet. J. 55:19–21. doi: 10.1111/j.1751-0813.1979.tb09538.x. [DOI] [PubMed] [Google Scholar]
  24. Okyere, S. K., Mo Q., Pei G., Ren Z., Deng J., and Hu Y... 2020. Euptox A induces G0/GI arrest and apoptosis of hepatocyte via ROS, mitochondrial dysfunction and caspases-dependent pathways in vivo. J. Toxicol. Sci. 45:661–671. doi: 10.2131/jts.45.661 [DOI] [PubMed] [Google Scholar]
  25. Peeters, P. M., Wouters E. F., and Reynaert N. L... 2015. Immune homeostasis in epithelial cells: evidence and role of inflammasome signaling reviewed. J. Immunol. Res. 2015:828264. doi: 10.1155/2015/828264 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Plaizier, J. C., Khafipour E., Li S., Gozho G. N., and Krause D. O... 2012. Subacute ruminal acidosis (SARA), endotoxins and health consequences. Anim. Feed Sci. Technol. 172:9–21. doi: 10.1016/j.anifeedsci.2011.12.004 [DOI] [Google Scholar]
  27. Ren, Z., Gao P., Okyere S. K., Cui Y., Wen J., Jing B., Deng J., and Hu Y... 2021. Ageratina adenophora inhibits spleen immune function in rats via the loss of the FRC network and Th1-Th2 cell ratio elevation. Toxins (Basel). 13:309. doi: 10.3390/toxins13050309 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Saitou, M., Fujimoto K., Doi Y., Itoh M., Fujimoto T., Furuse M., Takano H., Noda T., and Tsukita S... 1998. Occludin-deficient embryonic stem cells can differentiate into polarized epithelial cells bearing. J. Cell Biol. 141:397–408. doi: 10.1083/jcb.141.2.397 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Smyth, D., Phan V., Wang A., and McKay D. M... 2011. Interferon-γ-induced increases in intestinal epithelial macromolecular permeability requires the Src kinase Fyn. Lab. Invest. 91:764–777. doi: 10.1038/labinvest.2010.208 [DOI] [PubMed] [Google Scholar]
  30. Stumpff, F., Georgi M. I., Mundhenk I. L., Rabbani I., Fromm M., Martens H., and Günzel D... 2011. Sheep rumen and omasum primary cultures and source epithelia: barrier function aligns with expression of tight junction proteins. J. Exp. Biol. 214:2871–2882. doi: 10.1242/jeb.055582 [DOI] [PubMed] [Google Scholar]
  31. Sun, W., Zeng C., Liu S., Fu J., Hu L., Shi Z., Yue D., Ren Z., Zhong Z., Zuo Z.,. et al. 2018. Ageratina adenophora induces mice hepatotoxicity via ROS-NLRP3-mediated pyroptosis. Sci. Rep. 8:16032. doi: 10.1038/s41598-018-34492-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sun, W., Zeng C., Yue D., Liu S., Ren Z., Zuo Z., Deng J., Peng G., and Hu Y... 2019. Ageratina adenophora causes spleen toxicity by inducing oxidative stress and pyroptosis in mice. R. Soc. Open Sci. 6:190127. doi: 10.1098/rsos.190127 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Ye, Y. L., Yang Z. J., Fu S., Zhao Z. J., Shi Y. Q., and Xiao X.. 2016. Effect of Eupatorium adenophorum on liver and kidney function of horse. J Chinese Vet. Med. 35:47–48. doi: 10.13823/j.cnki.jtcvm.2016.04.014. [DOI] [Google Scholar]
  34. Zhang, C.X. 2014. Analyses of the damage, distribution and control measures of Eupatorium adenophorum Spreng. Practical Forestry Technology. 1:32-35. doi: 10.13456/j.cnki.lykt.2014.01.013. [DOI] [Google Scholar]
  35. Zhang, F., Liu W. -X., Wan F. -H., and Ellison C. A... 2008. Sustainable management based on biological control and ecological restoration of an alien invasive weed, Ageratina adenophora (Asteraceae) in China. ISBCW 12:669–704. doi: 10.1079/9781845935061.0699. [DOI] [Google Scholar]
  36. Zhang, F., Guo J., Chen F., Liu W., and Wan F... 2012. Identification of volatile compounds released by leaves of the invasive plant Croftonweed (Ageratina adenophora, Compositae), and their inhibition of rice seedling growth. Weed Sci. 60:205–211. doi: 10.1614/ws-d-11-00156.1 [DOI] [Google Scholar]
  37. Zhou, Y. H., Yu J. P., Liu Y. F., Teng X. J., Ming M., Lv P., An P., Liu S. Q., and Yu H. G... 2006. Effects of Ginkgo biloba extract on inflammatory mediators (SOD, MDA, TNF-α, NF-κBp65, IL-6) in TNBS-induced colitis in rats. Mediators Inflamm. 2006:1–9. doi: 10.1155/mi/2006/92642 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES