REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-human CD4-BUV395 (clone SK3) (dilution used 1:100)	BD Biosciences	Cat. Num. 563550; RRID:AB_2738273
Anti-human CD8-FITC (clone RPA-T8) (dilution used 1:20)	BD Biosciences	Cat. Num. 561947; RRID: AB_10894003
Anti-human CD14-Alexa Fluor 488 (clone MφP9) (dilution used 1:100)	BD Biosciences	Cat. Num. 562689; RRID: AB_2737723
Anti-human CD19-BB515 (clone HIB19) (dilution used 1:100)	BD Biosciences	Cat. Num. 564456; RRID: AB_2744309
Anti-human CD56-BB515 (clone B159) (dilution used 1:100)	BD Biosciences	Cat. Num. 564488; RRID: AB_2744428
Anti-human CD45RA-Qdot655 (clone MEM-56) (dilution used 1:400)	Thermo Fisher Scientific	Cat. Num. Q10069; RRID: AB_2556451
Anti-human CCR7-BV711 (clone 150503) (dilution used 1:100)	BD Biosciences	Cat. Num. 566602; RRID: AB_2739758
Anti-human CD25-PE (clone BC96) (dilution used 1:200)	BioLegend	Cat. Num. 302605; RRID: AB_314275
Anti-human ICOS-PE-Cy7 (clone DX29) (dilution used 1:100)	BD Biosciences	Cat. Num. 567395; RRID: AB_2916579
Biological samples
Human blood draws from patients with mild COVID-19	Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico, Infectious Diseases Unit, Milan, Italy. Notarbartolo et al.	N/A
Human serum	Swiss Blood Center Basel	N/A
Chemicals, peptides, and recombinant proteins
Ficoll-Paque PLUS	Cytiva	Cat. Num. 17144003
DPBS 1X, no calcium, no magnesium	Thermo Fisher Scientific Gibco	Cat. Num. 14190094
RPMI 1640 medium, no glutamine	Thermo Fisher Scientific Gibco	Cat. Num. 31870025
RPMI 1640 medium, HEPES, no glutamine	Thermo Fisher Scientific Gibco	Cat. Num. 42401018
GlutaMAX supplement (100X)	Thermo Fisher Scientific Gibco	Cat. Num. 35050038
MEM non-essential amino acids (NEAA) solution (100X)	Thermo Fisher Scientific Gibco	Cat. Num. 11140035
Sodium pyruvate (100 mM)	Thermo Fisher Scientific Gibco	Cat. Num. 11360039
Penicillin-Streptomycin (5,000 U/mL)	Thermo Fisher Scientific Gibco	Cat. Num. 15070063
Kanamycin sulfate	Thermo Fisher Scientific Gibco	Cat. Num. 15160054
2-Mercaptoethanol (50 mM)	Thermo Fisher Scientific Gibco	Cat. Num. 31350010
Ethylenediaminetetraacetic acid (EDTA) disodium salt solution, 0.5 M	Merck Sigma-Aldrich	Cat. Num. E7889-100ML
Recombinant SARS-CoV-2 RBD and N proteins	Fondazione Istituto Nazionale Genetica Molecolare, Milan, Italy. Notarbartolo et al.	N/A
Recombinant human interleukin-2 (IL-2)	Miltenyi Biotec	Cat. Num. 130-097-744
Phytohemagglutinin (PHA)	Thermo Fisher Scientific Remel	Cat. Num. R30852801
BD Horizon brilliant stain buffer	BD Biosciences	Cat. Num. 566349
Nuclease-free water (not DEPC-treated)	Thermo Fisher Scientific Invitrogen	Cat. Num. AM9937
Triton X-100	Merck Sigma-Aldrich	Cat. Num. X100-100ML
RiboLock RNase inhibitor (40 U/μL)	Thermo Fisher Scientific	Cat. Num. EO0381
Ethanol, for molecular biology	Merck Sigma-Aldrich	Cat. Num. 51976-500ML-F
Tris buffer, 1.0 M, pH 8.0, molecular biology grade	Merck Millipore	Cat. Num. 648314-100ML
Critical commercial assays
CD14 MicroBeads UltraPure, human	Miltenyi Biotec	Cat. Num. 130-118-906
CD4 MicroBeads, human	Miltenyi Biotec	Cat. Num. 130-045-101
MS columns	Miltenyi Biotec	Cat. Num. 130-042-201
CellTrace Violet Cell Proliferation Kit, for flow cytometry	Thermo Fisher Scientific	Cat. Num. C34557
Maxima H minus reverse transcriptase (200 U/μL)	Thermo Fisher Scientific	Cat. Num. EP0752
KAPA HiFi HotStart PCR Kit (250 U)	Roche	Cat. Num. 07958897001
SPRIselect beads	Beckman Coulter	Cat. Num. B23317
Qubit dsDNA high-sensitivity (HS) kit	Thermo Fisher Scientific Invitrogen	Cat. Num. Q32854
Oligonucleotides
Oligo(dT)20 primer	Thermo Fisher Scientific Invitrogen	Cat. Num. 18418020
Template-switch oligo (TSO): 5′-AAGCAGTGG TATCAACGCAGAGTACATrGrG+G-3’. Note: at the 3′ end of the oligo, there are two riboguanosines (rG) and one LNA-modified guanosine (+G) to facilitate template switching. The TSO bears the same adapter sequence present in the SMART-TRAC, SMART-TRBC, and ISPCR oligos.	QIAGEN; Picelli et al.	N/A
SMART-TRAC oligo: AAGCAGTGG TATCAACGCAGAGTACACACATCA GAATCCTTACTTTG. Note: this oligo specifically anneals to the TRAC gene, which codes for the constant region of the TCR alpha chain. It also bears the same adapter sequence present in the TSO and the ISPCR oligos.	QIAGEN; This paper	N/A
SMART-TRBC oligo: AAGCAGTGGTAT CAACGCAGAGTACCAGTATCTGG AGTCATTGA. Note: this oligo specifically anneals to the TRBC1 and TRBC2 genes, which code for the constant region of the TCR beta chain. It also bears the same adapter sequence present in the TSO and the ISPCR oligos.	QIAGEN; This paper	N/A
ISPCR oligo: 5′-AAGCAGTGGTAT CAACGCAGAGT-3’. Note: this oligo guides the unbiased amplification of the TCR cDNA. It works both as a forward and reverse PCR primer by binding to the adapter sequence present in the TSO, SMART-TRAC, and SMART-TRBC oligos.	Eurofins; Picelli et al.	N/A
qPCR primers. See Table 1.	Eurofins; This paper	N/A
Software and algorithms
Cell Ranger v7.1	10× Genomics	https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger; RRID: SCR_017344
Primer3web v4.1.0	Untergasser et al.	https://primer3.ut.ee/; RRID: SCR_003139
FlowJo v10.8	BD Biosciences	https://www.flowjo.com/solutions/flowjo; RRID: SCR_008520
Prism v10	GraphPad Software	https://www.graphpad.com/; RRID: SCR_000306
Python v3.10.5	Python Software Foundation	https://www.python.org/psf-landing/; RRID: SCR_008394
Other
MACS MultiStand	Miltenyi Biotec	Cat. Num. 130-042-303
MiniMACS separator	Miltenyi Biotec	Cat. Num. 130-090-312
MACSmix tube rotator	Miltenyi Biotec	Cat. Num. 130-090-753
40 μm cell strainer	Corning	Cat. Num. 352340
BD FACSAria III SORP cell sorter	BD Biosciences	RRID: SCR_016695
PCR thermal cycler (e.g., Biometra TRIO)	Analytik Jena GmbH	Cat. Num. 846-2-070-724
DNA LoBind tubes, 1.5 mL	Eppendorf	Cat. Num. 0030108051
DynaMag-2 magnet	Thermo Fisher Scientific Invitrogen	Cat. Num. 12321D
Qubit fluorometer (2.0 or later)	Thermo Fisher Scientific Invitrogen	Cat. Num. Q32866; RRID: SCR_020553
Axygen 96-well PCR microplates	Corning	Cat. Num. PCR-96-LP-AB-C
Axygen 70 μm ultra clear pressure sensitive sealing film for real-time PCR	Corning	Cat. Num. UC-500
Fast SYBR green master mix	Thermo Fisher Scientific Applied Biosystems	Cat. Num. 4385612
Real-time PCR system (e.g., QuantStudio 5 or StepOnePlus)	Thermo Fisher Scientific Applied Biosystems	RRID: SCR_020240; RRID: SCR_015805