REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
TotalSeq™-C0159 anti-human HLA-DR	BioLegend	307663; RRID: AB_2800795
TotalSeq™-C0080 anti-human CD8	BioLegend	301071; RRID: AB_2800730
TotalSeq™-C0391 anti-human CD45	BioLegend	304068; RRID: AB_2800762
TotalSeq™-C0064 anti-human CD123	BioLegend	306045; RRID: AB_2800789
TotalSeq™-C0367 anti-human CD2	BioLegend	309231; RRID: AB_2810464
TotalSeq™-C0034 anti-human CD3	BioLegend	300479; RRID: AB_2800723
TotalSeq™-C0124 anti-human CD31	BioLegend	303139; RRID: AB_2800757
TotalSeq™-C0072 anti-human CD4	BioLegend	300567; RRID: AB_2800725
TotalSeq™-C0050 anti-human CD19	BioLegend	302265; RRID: AB_2800741
TotalSeq™-C0139 anti-human TCRgd	BioLegend	353747; RRID: AB_2800949
TotalSeq™-C0140 anti-human CD183 (CXCR3)	BioLegend	331231; RRID: AB_2814199
TotalSeq™-C0125 anti-human CD44	BioLegend	338827; RRID: AB_2800900
TotalSeq™-C0176 anti-human CD39	BioLegend	328237; RRID: AB_2800853
TotalSeq™-C0063 anti-human CD45RA	BioLegend	304163; RRID: AB_2800764
TotalSeq™-C0224 anti-human TCRab	BioLegend	306743; RRID: AB_2800793
TotalSeq™-C0061 anti-human CD117	BioLegend	313243; RRID: AB_2810474
TotalSeq™-C0161 anti-human CD11b	BioLegend	301359; RRID: AB_2800732
TotalSeq™-C0145 anti-human CD103	BioLegend	350231; RRID: AB_2749996
TotalSeq™-C0147 anti-human CD62L	BioLegend	304851; RRID: AB_2800770
TotalSeq™-C0123 anti-human EpCAM	BioLegend	324247; RRID: AB_2814181
TotalSeq™-C0058 anti-human HLA-ABC	BioLegend	311449; RRID: AB_2800816
TotalSeq™-C0154 anti-human CD27	BioLegend	302853; RRID: AB_2800747
TotalSeq™-C0006 anti-human CD86	BioLegend	305447; RRID: AB_2800786
TotalSeq™-C0138 anti-human CD5	BioLegend	300637; RRID: AB_2800726
TotalSeq™-C0146 anti-human CD69	BioLegend	310951; RRID: AB_2800810
TotalSeq™-C0160 anti-human CD1c	BioLegend	331547; RRID: AB_2800871
TotalSeq™-C0158 anti-human CD134	BioLegend	350035; RRID: AB_2800932
TotalSeq™-C0402 anti-human CD1a	BioLegend	300135; RRID: AB_2814107
TotalSeq™-C0088 anti-human CD279	BioLegend	329963; RRID: AB_2800862
TotalSeq™-C0028 anti-human CD30	BioLegend	333919; RRID: AB_2800883
TotalSeq™-C0151 anti-human CD152	BioLegend	369621; RRID: AB_2801015
TotalSeq™-C0148 anti-human CD197 (CCR7)	BioLegend	353251; RRID: AB_2800943
TotalSeq™-C0171 anti-human ICOS	BioLegend	313553; RRID: AB_2800823
TotalSeq™-C0410 anti-human CD38	BioLegend	356637; RRID: AB_2820007
TotalSeq™-C0144 anti-human CD185 (CXCR5)	BioLegend	356939; RRID: AB_2800968
TotalSeq™-C0156 anti-human CD95	BioLegend	305651; RRID: AB_2800787
TotalSeq™-C0053 anti-human CD11c	BioLegend	371521; RRID: AB_2801018
TotalSeq™-C0366 anti-human CD184 (CXCR4)	BioLegend	306533; RRID: AB_2800791
TotalSeq™-C0181 anti-human CD21	BioLegend	354923; RRID: AB_2800953
TotalSeq™-C0090 anti-human IsoIgG1	BioLegend	400187; RRID: AB_2888921
TotalSeq™-C0091 anti-human IsoIgG2A	BioLegend	400293; RRID: AB_2888922
TotalSeq™-C0027 anti-human CD70	BioLegend	355119; RRID: AB_2800955
TotalSeq™-C0071 anti-human CD194 (CCR4)	BioLegend	359425; RRID: AB_2800988
TotalSeq™-C0396 anti-human CD26	BioLegend	302722; RRID: AB_2810435
TotalSeq™-C0007 anti-human CD274	BioLegend	329751; RRID: AB_2800860
TotalSeq™-C0386 anti-human CD28	BioLegend	302963; RRID: AB_2800751
TotalSeq™-C0166 anti-human CD66b	BioLegend	392909; RRID: AB_2801027
TotalSeq™-C0081 anti-human CD14	BioLegend	301859; RRID: AB_2800736
TotalSeq™-C0390 anti-human CD127	BioLegend	351356; RRID: AB_2800937
TotalSeq™-C0163 anti-human CD141	BioLegend	344125; RRID: AB_2810541
TotalSeq™-C0085 anti-human CD25	BioLegend	302649; RRID: AB_2800745
TotalSeq™-C0087 anti-human CD45RO	BioLegend	304259; RRID: AB_2800766
TotalSeq™-C0155 anti-human CD107a	BioLegend	328649; RRID: AB_2800854
TotalSeq™-C0169 anti-human CD366	BioLegend	345049; RRID: AB_2800925
TotalSeq™-C0005 anti-human CD80	BioLegend	305243; RRID: AB_2800783
TotalSeq™-C0831 anti-human CD138	BioLegend	352327; RRID: AB_2814282
TotalSeq™-C0143 anti-human CD196 (CCR6)	BioLegend	353440; RRID: AB_2810563
TotalSeq™-C0180 anti-human CD24	BioLegend	311143; RRID: AB_2800813
TotalSeq™-C0152 anti-human CD223	BioLegend	369335; RRID: AB_2814327
TotalSeq™-C0804 anti-human CD186 (CXCR6)	BioLegend	362559; RRID: AB_2801002
TotalSeq™-C0047 anti-human CD56	BioLegend	369621; RRID: AB_2801015
TotalSeq™-C0251 anti-human Hashtag 1	BioLegend	394661; RRID: AB_2801031
TotalSeq™-C0252 anti-human Hashtag 2	BioLegend	394663; RRID: AB_2801032
TotalSeq™-C0253 anti-human Hashtag 3	BioLegend	394665; RRID: AB_2801033
TotalSeq™-C0254 anti-human Hashtag 4	BioLegend	394667; RRID: AB_2801034
TotalSeq™-C0255 anti-human Hashtag 5	BioLegend	394669; RRID: AB_2801035
TotalSeq™-C0256 anti-human Hashtag 6	BioLegend	394671; RRID: AB_2820042
TotalSeq™-C0257 anti-human Hashtag 7	BioLegend	394673; RRID: AB_2820043
TotalSeq™-C0258 anti-human Hashtag 8	BioLegend	394675; RRID: AB_2820044
TotalSeq™-C0259 anti-human Hashtag 9	BioLegend	394677; RRID: AB_2820045
TotalSeq™-C0260 anti-human Hashtag 10	BioLegend	394679; RRID: AB_2820046
TotalSeq™-C Human Universal Cocktail, V1.0	Biolegend	399905; RRID: AB_2876728
HTO21 anti-human hashing antibody	Stoekus et al.79	New York Genome Center
HTO22 anti-human hashing antibody	Stoekus et al.79	New York Genome Center
HTO23 anti-human hashing antibody	Stoekus et al.79	New York Genome Center
Alexa Fluor® 488 AffiniPure Goat Anti-Human IgG, Fcγ fragment specific	Jackson ImmunoResearch	109-545-098; RRID:AB_2337840
R-Phycoerythrin AffiniPure Goat Anti-Human Serum IgA, α chain specific	Jackson ImmunoResearch	109-115-011
DyLight™ 405 AffiniPure Donkey Anti-Human IgM, Fc5μ fragment specific	Jackson ImmunoResearch	709-475-073; RRID:AB_2340551
Chemicals, peptides, and recombinant proteins
SARS-CoV-2 (2019-nCoV) Nucleocapsid-AVI & His recombinant Protein, Biotinylated	Sino Biological	40588-V27B-B
SARS-CoV-2 (2019-nCoV) Nucleocapsid-His recombinant Protein	Sino Biological	40588-V08B
SARS-CoV-2 (2019-nCoV) Spike S1-His Recombinant Protein	Sino Biological	40591-V08H
Critical commercial assays
Chromium Next GEM Single Cell 5’ Kit v1.1	10x Genomics	PN-1000165
Chromium Next GEM Single Cell 5' Kit v2	10x Genomics	PN-1000263
Single Index Kit T Set A	10x Genomics	PN-1000213
Dual Index Kit TT Set A	10x Genomics	PN-1000215
Dual Index Kit TN Set A	10x Genomics	PN-1000250
Chromium Single Cell V(D)J Enrichment Kit, Human T Cell	10x Genomics	PN-1000005
Chromium Single Cell V(D)J Enrichment Kit, Human B Cell	10x Genomics	PN-1000016
Chromium Single Cell Human TCR Amplification Kit	10x Genomics	PN-1000252
Chromium Single Cell Human BCR Amplification Kit	10x Genomics	PN-1000253
Dead Cell Removal Kit	Miltenyi Biotec	130-090-101
KAPA HiFi HotStart ReadyMix	Roche	KK2601
MultiCyt® QBeads® Streptavidin Coated panel QSAv1,2,3 and 5	Sartorius	90792
Deposited data
SARS-CoV-2 infection and vaccination ECCITE-seq data	This paper	https://cellxgene.cziscience.com/collections/ecb739c5-fe0d-4b48-81c6-217c4d64eec4
Raw and processed data	This paper	GEO: GSE247917
Haniffa COVID-19 single-cell RNA-seq dataset	Stephenson et al.3	https://www.covid19cellatlas.org/
Experimental models: Cell lines
Human: Expi293 cells	Thermo Fisher	A14527
Oligonucleotides
ADT additive: CCTTGGCACCCGAGAATTCC	Stoekus et al.79	IDT, Inc.
HTO additive: GTGACTGGAGTTCAGACGTGTGCTC	Stoekus et al.79	IDT, Inc.
Index 1 (i7) Adapter: CAAGCAGAAGACGGC ATACGAGATxxxxxxxxGTCTCGTGGGCTCGG x: Barcode or index sequence	Illumina	IDT, Inc.
D7xx_s (HTO indexing primer): CAAGCAGA AGACGGCATACGAGATxxxxxxxxGTGACTG GAGTTCAGACGTGTGC x: Barcode or index sequence	Stoekus et al.79	IDT, Inc.
Target enrichment 1 hTRDC primer (v1.1): AGCTTGACAGCA TTGTACTTCC	Mimitou et al.19	IDT, Inc.
Target enrichment 1 hTRGC primer (v1.1): TGTGTCGTTAGTCTTCATGGTGTTCC	Mimitou et al.19	IDT, Inc.
Target enrichment 2 hTRDC primer (v1.1): TCCTTCACCAGACAAGCGAC	Mimitou et al.19	IDT, Inc.
Target enrichment 2 hTRGC primer (v1.1): GATCCCAGAATCGTGTTGCTC	Mimitou et al.19	IDT, Inc.
Target enrichment forward primer (v2): GATCTACACTCTTTCCCTACACGACGC	10x Genomics	IDT, Inc.
Software and algorithms
Cell Ranger	10x Genomics	https://www.10xgenomics.com/support/software/cell-ranger; RRID:SCR_017344
Seurat	Stuart et al.80	https://satijalab.org/seurat; RRID:SCR_016341
kallisto kb-count v0.24.1	Bray et al.81	https://github.com/pachterlab/kallisto_paper_analysis/; RRID:SCR_018213
totalVI	Gayoso et al.82	https://github.com/YosefLab/scvi-tools
IgBLAST	Ye et al.36	https://www.ncbi.nlm.nih.gov/igblast/; RRID:SCR_002873
GSVA package v1.38	Hänzelmann et al.32	https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-14-7; RRID:SCR_021058
scDblFinder	Germaine et al.83	https://github.com/plger/scDblFinder; RRID:SCR_022700