Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2024 Jan 11;14:1106. doi: 10.1038/s41598-023-50084-6

Resveratrol attenuates high glucose-induced inflammation and improves glucose metabolism in HepG2 cells

Abegail Mukhethwa Tshivhase 1, Tandi Matsha 1,2, Shanel Raghubeer 1,
PMCID: PMC10784549  PMID: 38212345

Abstract

Diabetes mellitus (DM) is characterized by impaired glucose and insulin metabolism, resulting in chronic hyperglycemia. Hyperglycemia-induced inflammation is linked to the onset and progression of diabetes. Resveratrol (RES), a polyphenol phytoalexin, is studied in diabetes therapeutics research. This study evaluates the effect of RES on inflammation and glucose metabolism in HepG2 cells exposed to high glucose. Inflammation and glucose metabolism-related genes were investigated using qPCR. Further, inflammatory genes were analyzed by applying ELISA and Bioplex assays. High glucose significantly increases IKK-α, IKB-α, and NF-kB expression compared to controls. Increased NF-kB expression was followed by increased expression of pro-inflammatory cytokines, such as TNF-α, IL-6, IL-β, and COX2. RES treatment significantly reduced the expression of NF-kB, IKK-α, and IKB-α, as well as pro-inflammatory cytokines. High glucose levels reduced the expression of TGFβ1, while treatment with RES increased the expression of TGFβ1. As glucose levels increased, PEPCK expression was reduced, and GCK expression was increased in HepG2 cells treated with RES. Further, HepG2 cells cultured with high glucose showed significant increases in KLF7 and HIF1A but decreased SIRT1. Moreover, RES significantly increased SIRT1 expression and reduced KLF7 and HIF1A expression levels. Our results indicated that RES could attenuate high glucose-induced inflammation and enhance glucose metabolism in HepG2 cells.

Subject terms: Endocrine system and metabolic diseases, Cell biology, Medical research

Introduction

Diabetes Mellitus (DM) has imposed a significant burden on global healthcare systems due to its increasing incidence and prevalence, a trend projected to rise in the future1,2. Type 2 DM (T2DM) is a metabolic condition characterized by chronic hyperglycemia resulting from relative insulin deficiency3,4. It accounts for about 90–95% of all diabetes cases. Chronic hyperglycemia often results in microvascular complications, such as nephropathy, neuropathy, and retinopathy5.

To fulfil the energy needs of vital organs and maintain a healthy metabolism, glucose homeostasis is strictly regulated. In this regard, the liver plays a vital role by regulating multiple glucose metabolic pathways, including glycogenesis, glycogenolysis, glycolysis, and gluconeogenesis6. Research has demonstrated that abnormal glucose metabolism in the liver is one of the primary causes of T2DM. Individuals with diabetes often have disrupted glycogenesis and glycogenolysis, with glycogenesis playing a particularly important role7. Enzymes responsible for gluconeogenesis and glycogenesis are often elevated in hyperglycemic livers, whereas glycolysis enzymes are attenuated8. Phosphoenolpyruvate carboxylase (PEPCK) and glucose-6-phosphatase (G6Pase) are the main enzymes in the liver that regulate the conversion of non-sugar substances into glucose in the process of gluconeogenesis9. The elevated expression of these enzymes is linked to increased gluconeogenesis10. Glycolysis is the pathway by which glucose is broken down into pyruvate/lactate after glucose uptake by the cells and glucose phosphorylation. Glucokinase (GCK) is an important regulatory enzyme in glycolysis11. The reduced activity of GCK has been associated with individuals with T2DM1214. Therefore, understanding the regulation of GCK and PEPCK activity and their function in glycolysis and gluconeogenesis is essential for the development of efficient treatment for individuals with T2DM.

Previous research has shown inflammation to be a critical factor in the pathogenesis of T2DM15. Nuclear factor-kB (NF-kB) activation is linked with inflammatory response activation16. It regulates the expression of pro-inflammatory genes. Tumor necrosis factor alpha (TNF-α), interleukin (IL)-6, interleukin (IL)-8, interleukin-1 beta (IL-1β), and cyclooxygenase-2 (COX2) are mediated by NF-kB17. NF-kB is activated by high glucose levels, which activates the expression of inflammatory cytokines, including TNF-α and IL-618,19. To mitigate the ongoing inflammatory response, the strategic inhibition of pro-inflammatory cytokine production and secretion has been postulated as a prospective approach to halt the onset of diabetes20. Previous research has shown that transforming growth factor-beta 1 (TGFβ1) has demonstrated substantial regulatory characteristics within inflammation21. Prior research has established that TGFβ1 possesses anti-inflammatory characteristics by neutralizing pro-inflammatory cytokines22.

Sirtuin 1 (SIRT1), an extremely conserved NAD + -dependent deacetylase, is a critical enzyme in aging and metabolism, including adapting gene expression and metabolism to the cellular energy state23,24. Furthermore, SIRT1 functions as a suppressor of NF-kB activity. It inhibits transcription by deacetylating the NF-kB subunit RelA/p56 at lysine 31025,26. Krupple-like factor 7 (KLF7), the first discovered transcriptional factor amongst the KLF family, has been reported to play a fundamental role in regulating glucose and lipid metabolism and inflammation27. KLF7 can promote pro-inflammatory IL-6 cytokine expression and prevent glucose metabolism in human Islet and HepG2 cells28,29 Hypoxia-inducible factor 1 Alpha (HIF1A) is another transcriptional factor involved in inflammation and glucose metabolism. It is vital in regulating pro-inflammatory gene expression and cytokine production30 Therefore, a natural compound with the capability to regulate these transcriptional genes may be valuable in managing inflammatory diseases and metabolic disorders.

Currently, there exist several chemical agents for glycemic control utilized in T2MD therapy. However, they are associated with severe side effects such as hypoglycemia and weight gain or contraindications that restrict their use which necessitates the search for an effective T2DM treatment method31,32. In this regard, natural compounds with anti-diabetic activity and fewer side effects can be effective for T2DM treatment33. Several indigenous plants have been utilized for the management or treatment of diabetes. Some have been investigated, and their active ingredients have been isolated34.

Resveratrol (RES) is a polyphenol phytoalexin known as trans-3,4,5-trihydroxystilbene. Studies have shown that RES has an antihyperglycemic effect resulting in improved blood glucose parameters, inflammation, and insulin resistance35. Due to this, RES has been implicated in the management of T2DM. This study aims to evaluate the effects of resveratrol on glucose metabolism and inflammation in high glucose-induced HepG2 cells. Understanding its potential as a treatment for diabetes and comprehending the basic molecular pathway may aid in developing novel strategies to combat glucose dysregulation and inflammation in diabetes.

Results

Resveratrol reversed the increased pro-inflammatory cytokines caused by high glucose in HepG2 cells.

HepG2 cells were cultured under various conditions for 48 and 72 h, and the mRNA expression levels of TNF-α, IL-6, and COX2 were analysed using qPCR (Fig. 1). Furthermore, human TNF-α and IL-1β ELISA were performed using collected supernatant (Fig. 2). Interestingly, as shown in Fig. 1, the expression patterns of the three inflammatory cytokines were similar. In HepG2 cells cultured with LR and HR for 48 h and LR for 72 h, no statistical difference was observed in the expression levels of TNF-α, and IL-6 as compared to control cells (Fig. 1a,c,d). The TNF-α and IL-6 mRNA expression levels, were significantly reduced (p < 0.00001; p = 0.0109, respectively) when cells were cultured with HR for 72 h. When cells were cultured with LR and HR over 72 h, the expression of COX2 was significantly decreased as compared to control group (p = 0.0008 and p < 0.0001, respectively) (Fig. 1f). In ELISA results, when cells were cultured with LR and HR over 48 and 72 h, no statistical difference was observed in the concentration of TNF-α and IL-1β as compared to the control (Fig. 2). The mRNA expression levels of TNF-α, IL-6, and COX2 were increased significantly (p < 0.0001) in the HG group compared to the control group (Fig. 1). Similar to Elisa’s results, the expression levels of TNF-α and IL-1β increased significantly in the HG group as compared to control cells (p < 0.0001) (Fig. 2). These results indicate that high glucose levels can lead to an increase in pro-inflammatory cytokine expression.

Figure 1.

Figure 1

The expression levels of pro-inflammatory cytokines in HepG2 cells cultured with high glucose (40 mM) and resveratrol (25 µM AND 50 µM) over 48 and 72 h. (a) Expression of TNF-α cultured over 48 h. (b) Expression of TNF-α cultured over 72 h. (c) Expression of IL-6 cultured over 48 h. (d) Expression of IL-6 cultured over 72 h. (e) Expression of COX2 cultured over 48 h. (f) Expression of COX2 cultured over 72 h. GAPDH was utilized as the housekeeping gene. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 versus controls and #p < 0.05, ##p < 0.01, ###p < 0.001, ####p < 0.0001 versus HG. LR, Low resveratrol; HR, High resveratrol; HG, High glucose, RES, Resveratrol; TNF-α, Tumor necrosis factor alpha; IL-6, interleukin-6; COX2, Cyclooxygenase-2.

Figure 2.

Figure 2

The ELISA for TNF-α (a and b) and IL-β (c and d) after high glucose treatment (40 mM), Low resveratrol (25 µM), High resveratrol (50 µM), High glucose + Low resveratrol (40 mM + 25 µM), and High glucose + High resveratrol (40 mM + 50 µM) treatments. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 versus controls and #p < 0.05, ##p < 0.01, ###p < 0.001, ####p < 0.0001 versus HG. LR, Low resveratrol; HR, High resveratrol; HG, High glucose, RES, Resveratrol; TNF-α, Tumor necrosis alpha; IL-1β, Interleukin-1 beta.

According to our qPCR and Elisa’s findings, HG levels increased the expression of pro-inflammatory cytokines in HepG2 cells. To investigate the anti-inflammatory effect of RES, HepG2 cells were exposed to HG in the presence of RES. The mRNA expression levels of TNF-α, IL-6, and COX2 were significantly decreased (p < 0.0001) when HepG2 cells were cultured with LR + HG and HR + HG as compared to HG alone (Fig. 1). Similarly, to the qPCR results, in our Elisa results, we observe that the concentration of TNF-α and IL-1β were significantly decreased when cells were cultured with LR and HR in the presence of HG as compared to HG alone (p < 0.0001). These results suggest that RES has a potential anti-inflammatory effect on HepG2 cells exposed to HG. Furthermore, the significant decrease in TNF-α, IL-6, COX2, and IL-1β expression levels indicates that RES may have a role in mitigating the pro-inflammatory response induced by HG levels in HepG2 cells.

IL-6 and IL-1β cytokines levels

In agreement with ELISA and qPCR results, the Bio-Plex assay revealed that when HepG2 cells were cultured with HG, the concentration of IL-6 and IL-1β cytokines were significantly higher as compared to control cells over 48 h (p < 0.0001) and 72 h (p < 0.0001; p = 0.0109) (Fig. 3). IL-6 was significantly reduced when HepG2 cells were cultured with HR in the presence of HG over 48 and 72 h (p = 0.206; p = 0.0013, respectively); however, no statistical difference was observed when HepG2 cells were cultured with LR + HG over 48 and 72 h (Fig. 3a and b). We observed that IL-1β was significantly reduced when HepG2 cells were cultured with both LR and HR in the presence of HG over 48 h (p < 0.0001) and 72 h (p = 0.0435) as compared to the HG group alone (Fig. 3 c and d).

Figure 3.

Figure 3

The Bio-Plex cytokines assay. (a) IL-6 48 h, (b) IL-6 72 h, (c) IL-1β 48 h and (d) IL-1β 72 h. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 versus controls and #p < 0.05, ##p < 0.01, ###p < 0.001, ####p < 0.0001 versus HG. LR, Low resveratrol; HR, High resveratrol; HG, High glucose, RES, Resveratrol.

The expression levels of NF-kB, IKKα, and IkB-α in HepG2 cells

As shown in Fig. 4e,f, when HepG2 cells were cultured with HG, the NF-kB mRNA expression was significantly increased compared to control cells (p < 0.0001). Moreover, the mRNA expression of IKKα and IkB-α was significantly increased in the HG group (p < 0.0001; Fig. 4a–d), suggesting activation of NF-kB signaling pathway. To explore the anti-inflammatory effect of RES, HepG2 cells were cultured with LR and HR concentrations in the presence and absence of HG. Interestingly, NF-kB, IKKα, and IkB-α mRNA expressions were significantly decreased when exposed to LR and HR in the presence of HG over 48 and 72 h (p < 0.0001). When cells were exposed to LR and HG in the absence of HG, no statistical difference was observed in the expression of NF-kB as compared to control cells. IKKα and IkB-α did not show any statistical difference when cells were cultured to LR and HR over 48 h; However, IKKα was significantly decreased when cells were cultured with LR and HR (p < 0.0001; p = 0.0255, respectively). A significant decrease was also observed when cells were cultured with HR over 72 h (p < 0.0001). The decrease in NF-kB, IKKα, and IkB-α expression with RES treatment indicates its potential to modulate the NF-kB signaling pathway.

Figure 4.

Figure 4

The mRNA expression of IKKα (a and b), IkB-α (c and d), and NF-kB (e and f) after high glucose (40 mM) and resveratrol (25 µM and 50 µM) treatment over 48 and 72 h. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 versus controls and #p < 0.05, ##p < 0.01, ###p < 0.001, ####p < 0.0001 versus HG. LR, Low resveratrol; HR, High resveratrol; HG, High glucose, RES, Resveratrol; IKKα,; IkB-α,; NF-kB, Nuclear factor-kB.

Resveratrol effectively mitigated decreased expression of TGFβ1 induced by high glucose in HepG2 cells

HG levels reduced the expression of TGFβ1 in HepG2 cells. No statistically significant differences were observed when HepG2 cells were exposed to HG for 48 h compared to the control group (Fig. 5a). However, when the exposure was extended 72 h, a significant reduction in the expression of TGFβ1 was observed (p = 0.0043, Fig. 5b). The HepG2 cells were exposed to LR and HR treatment for 48 and 72 h, respectively. The levels of TGFβ1 expression exhibited a significant increase in HepG2 cells following exposure to LR (p < 0.0001) and HR (p < 0.0001; p = 0.0016) for 48 and 72 h. The expression levels of TGFβ1 were significantly increased when HepG2 cells were exposed to RES in the presence of HG for 48 and 72 h as compared to HG alone (p < 0.0001).

Figure 5.

Figure 5

The mRNA expression of TGFβ1 exposed to high glucose and resveratrol over 48 and 72 h. High glucose decreased the expression levels of TGFβ1, whereas resveratrol treatment increased the expression levels of TGFβ1. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 versus controls and #p < 0.05, ##p < 0.01, ###p < 0.001, ####p < 0.0001 versus HG. LR, Low resveratrol; HR, High resveratrol; HG, High glucose, RES, Resveratrol; TGFβ1, Transforming growth factor beta 1.

Effect of high glucose and resveratrol on the expression of GCK and PECK

The effect of HG and RES on the expression of glycogenesis and gluconeogenesis-related genes in HepG2 liver cells was evaluated. When compared to the control group, HepG2 cells cultured with HG over 48 and 72 h showed a significant decrease in the expression of GCK (p = 0.0002 and p = 0.0001, respectively) (Fig. 6a,b). A significant increase in the mRNA expression levels of PEPCK was observed in HepG2 cells culture with HG over 48 and 72 h as compared to the control group (p < 0.0001; p = 0.0003) (Fig. 6c,d). These results indicate impaired glucose metabolism in HepG2 cells. HepG2 cells were also treated with LR and HR alone. When compared to the control group, no statistical difference was observed in the expression of GCK when cells were cultured with LR and HR over 48 h and with HR over 72 h; however, a statistical difference was observed when HeG2 cells treated with LR over 72 h (p < 0.0001) (Fig. 6a,b). PEPCK showed no significant difference when HepG2 cells were cultured with HR over 48 h compared to the control group; however, a significant decrease was observed when cells were cultured with LR for 48 h (p < 0.0001) and when cultured with LR and HR for 72 h (p = 0.0034; p = 0.0003, respectively) (Fig. 6c,d).

Figure 6.

Figure 6

High glucose significantly reduced the expression of GCK and increased the expression of PEPCK in HepG2 cells. Resveratrol treatment increased GCK and decrease PEPCK expression levels. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 versus controls and #p < 0.05, ##p < 0.01, ###p < 0.001, ####p < 0.0001 versus HG. LR, Low resveratrol; HR, High resveratrol; HG, High glucose, RES, Resveratrol; GCK, Glucokinase; PEPCK, Phosphoenolpyruvate carboxylase.

To detect the efficiency of RES on the expression of GCK and PECK, HepG2 cells were cultured with RES in the presence of HG. The mRNA expression of GCK was significantly increased in HepG2 cells treated with both LR and HR in the presence of HG (p < 0.0001) (Fig. 6a,b) as compared to HG alone. Furthermore, PEPCK showed a significant decrease when HepG2 cells were treated with LR + HG and HR + HG (p < 0.0001) (Fig. 6c,d), as compared to HG group. The increased GCK and reduced PEPCK expression level may indicate the potential role of RES in regulating glucose metabolism in liver cells under HG conditions.

The expression of glucose metabolism and inflammation-related genes

KLF7, HIF1A, and SIRT1 are involved in glucose metabolism and inflammation. In this study, we explored the effect of HG on these genes (Fig. 7). The qPCR results show that when HepG2 cells were exposed to HG over 48 and 72 h, the expression levels of KLF7 and HIF1A were significantly increased (p < 0.0001) (Fig. 7a–d). The expression levels of SIRT1 were significantly decreased when cells were exposed to HG over 72 h (p = 0.0003; Fig. 7e); however, we did not observe any statistical difference when cells were exposed to HG over 48 h (Fig. 7f). To investigate the involvement of RES in the expression of these mRNAs, HepG2 cells were cultured with RES in the presence and absence of HG. When HepG2 cells were cultured with LR and HR over 48 and 72 h, no statistical difference was observed in the expression of KLF7 compared to the control; however, we observed a significant decrease when exposed to HR over 48 h (Fig. 7a,b). The expression of HIF1A was significantly decreased when cells were exposed to LR and HR over 72 h (p = 0.0001 and p < 0.0001, respectively) and when exposed to LR over 48 h (p = 0.0287); however, no statistical difference was observed when cells were exposed to HR over 48 h (Fig. 6c,d). SIRT1 showed a significant increase when cells were exposed to LR and HR over 48 h (p = 0.0004 and p < 0.0001, respectively) and HR over 72 h (p = 0.0002); however, when cells were exposed to LR for 72 h, the mRNA expression of SIRT1 decreased slightly, but no statistical difference was observed. When HepG2 cells were exposed to LR and HR in the presence of HG over 48 and 72 h, the expression levels of KLF7 and HIF1A were significantly decreased (p < 0.0001) compared to the HG group (Fig. 7a–d). SIRT1 showed a significant increase when cells were exposed to LR and HR in the presence of HG (p < 0.0001) as compared to HG alone (Fig. 7e,f).

Figure 7.

Figure 7

KLF7, HIF1A, and SIRT1 expression in HepG2 cells treated with high glucose (40 mM) and resveratrol (25 µM and 50 µM) over 48 and 72 h. High glucose significantly the expression of KLF7 and HIF1A over 48 and 72 h, whereas the expression level of SIRT1 was significantly decreased following exposure to high glucose. Resveratrol reversed the dysregulation caused by high glucose. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 versus controls and #p < 0.05, ##p < 0.01, ###p < 0.001, ####p < 0.0001 versus HG. LR, Low resveratrol; HR, High resveratrol; HG, High glucose, RES, Resveratrol; KLF7, Kruppel-like factor 7; HIF1A, hypoxia-inducible factor-1 Alpha; SIRT1, Sirtuin 1.

Discussion

Impaired glucose metabolism and associated inflammation results in chronic hyperglycemia leading to the development and progression of T2DM. Resveratrol (RES), a polyphenol phytoalexin, is a natural compound with anti-diabetic effects. In this study, the role of RES in glucose metabolism and inflammation in high glucose-induced HepG2 cells was examined.

In hyperglycemic conditions, the NF-kB signaling pathway is mainly implicated in the inflammatory response36. This study demonstrated that high glucose activates the NF-kB pathway, as evidenced by elevated mRNA expression of IKKα and IkB-α (Fig. 4). These results are consistent with those of Ramana et al. where they studied vascular smooth muscle cells37. The activation of NF-kB triggers the expression of pro-inflammatory cytokines. Herein, a significant increase was observed in the expression of TNF-α, IL-6, COX2, and IL-1β in HepG2 cells exposed to high glucose (Figs. 1, 2 and 3). Panahi et al. also reported similar results. They observed high glucose levels significantly increased the expression of TNF-α and IL-6 in HepG2 cells38. In addition, Hajibabaie et al.39 reported an increase in the expression of TNF-α and IL-β under hyperglycemic conditions of the H9c2 cell line. From these findings, it can be inferred that high glucose may induce inflammation in liver cells resulting in the development of diabetes. Furthermore, targeting the NF-kB pathway may be a therapeutic potential to manage high glucose-induced inflammation.

Interestingly, the current study revealed that RES reduced the mRNA expression of IKKα and IkB-α, thereby decreasing NF-kB activity (Fig. 4). It was also demonstrated that treating HepG2 cells with RES in the presence of high glucose significantly reduced the expression of pro-inflammatory cytokines (Figs. 1, 2 and 3). These results align with previous research. One study demonstrated a significant reduction in TNF-α and IL-6 in diabetic rats upon treatment with RES40. Another study reported similar results in diabetic mice wherein RES treatment decreased the expression of TNF-α and IL-1β while inhibiting the NF-kB activity41. These findings provide further evidence that RES has significant anti-inflammatory effects in diabetic conditions, by decreasing the expression of pro-inflammatory cytokines and preventing NF-kB activity. Therefore, RES might be a promising therapeutic agent for treating inflammation in patients with diabetes.

The expression of TGFβ1 mRNA was also investigated. TGFβ1 is a versatile cytokine that plays a role in various cellular processes, including cell growth, migration, proliferation, differentiation, and apoptosis42. In addition, studies have shown that TGFβ1 exhibits anti-inflammatory properties by inhibiting the expression of TNFα or counteracting the pro-inflammatory effects of IL-1b and IFNγ22. The present study observed that treatment with RES resulted in the upregulation of TGFβ1 expression in high glucose-induced HepG2 cells (Fig. 5). It was also correlated with the downregulation of pro-inflammatory cytokines.

This study further demonstrated that gluconeogenesis PEPCK gene was significantly increased and glycolysis gene GCK was significantly decreased in HepG2 cells treated with high glucose (Fig. 6). These findings agree with previous research by Zhu et al., which demonstrated similar results in the liver tissue of STZ-diabetic mice43. These findings imply that high glucose levels can result in elevated gluconeogenesis and reduced glycolysis in liver cells. This dysregulation of glucose metabolism may contribute to developing hyperglycemia and insulin resistance. However, when HepG2 cells were treated with RES in the presence of high glucose, the expression level of PEPCK was significantly reduced while expression of GCK increased (Fig. 6). This indicates that RES treatment can potentially restore the balance between gluconeogenesis and glycolysis in the liver cells exposed to high glucose, implying that RES could have therapeutic potential in treating hyperglycemia and insulin resistance associated with dysregulated glucose metabolism.

SIRT1, abundant in mammals, is implicated in fundamental biological processes such as stress response, glucose metabolism, and inflammation45. Patients with poor glycaemic control have consistently lower SIRT1 levels than those with good glycaemic control 46. The protein expression of SIRT1 was observed to be significantly reduced in mouse microvascular endothelial cells following high glucose exposure47. Furthermore, SIRT1 has been shown to mediate NF-kB deacetylation and inhibit its function48. This study demonstrated that high glucose significantly reduced the mRNA expression of SIRT1 in HepG2 cells (Fig. 7e,f). This further supports the role of SIRT1 in mediating the effects of high glucose on cellular processes. Additionally, the reduction of SIRT1 in HepG2 cells may have implications for NF-kB activity and its role in inflammation. Our results further demonstrate that RES treatment significantly increased the expression of SIRT1 in HepG2 cells (Fig. 7e,f), as shown by previous research49. Increased expression of SIRT1 by RES treatment highlights its potential as a therapeutic intervention for mitigating the detrimental effects of high glucose on cellular function.

This study also explored the effect of high glucose and RES on the expression of KLF7 and HIF1A in HepG2 cells. KLF7 and HIF1α play a crucial role in regulating inflammation and glucose metabolism27,50. Shao et al. found that the levels of HIF1α in serum of patients with T2DM were significantly increased compared to the control group51. Additionally, the protein and mRNA expressions of HIF1A have been shown to increase in hyperglycemic conditions52. Consistent with these findings, the current study demonstrated that high glucose significantly increased the expression of HIF1Α in HepG2 cells (Fig. 7a,b). A significant increase in the mRNA expression of KLF7 was also observed (Fig. 7c,d). Upon treatment with RES, mRNA expression of HIF1α and KLF7 was reduced. This suggests that RES may have potential therapeutic effects in reducing the expression of KLF7 and HIF1α in hyperglycemic conditions. The current findings highlight the importance of exploring the role of RES in the regulation of KLF7 and HIF1A expression and its potential implications for managing inflammatory diseases and metabolic disorders.

There are a few limitations to this study. Firstly, our research was confined to examining genes associated with inflammation and glucose metabolism. Protein expression analysis was not conducted. Future studies should consider assessing functional protein expression to establish potential correlations with gene expression. Quantifying protein expression will provide insights into the intricate process of protein synthesis and may aid in the exploration of various factors involved in protein synthesis. Secondly, this study relied on an in vitro model to establish controlled experimental conditions and enable focused analysis. It would be beneficial to extend our investigations using appropriate animal models, such as diabetes-induced mice. Thirdly, this study specifically investigated the effects of resveratrol on high glucose-induced HepG2 cells only. Previous research has investigated the influence of the herbal compound when used alongside physical activity, as well as the outcomes of combining herbal compounds with metformin53,54; therefore, future research should examine the impacts of resveratrol with exercise or metformin in diabetes-induced mice. Previous studies have also shown that a combination of herbal compounds effectively alleviated inflammation triggered by HFD-induced obesity and colitis55; therefore, future studies should consider combining resveratrol with other compounds with anti-inflammatory properties.

Conclusion

Our findings suggest that resveratrol has multifaceted therapeutic potential for diabetes. It can mitigate inflammation, restore glucose metabolism, enhance SIRT1 expression, and reduce the expression of key transcriptional factors. Although these results are promising, further research is necessary to fully understand the underlying mechanism and practical implications of using resveratrol as a treatment for diabetes and its associated disorders. The diverse effects of resveratrol on glucose metabolism and inflammation make it a valuable tool in the fight against the global diabetes epidemic.

Methods

Study design

Cells were categorized into six groups: Control (cultured in normal complete culture medium (CCM)), Low resveratrol (LR; cultured in normal CCM + 25 µM RES), High resveratrol (HR; cultured in normal CCM + 50 µM RES), High glucose (HG; cultured in normal CCM + 40 mM glucose), LR + HG (cultured in normal CCM + 25 µM RES + 40 mM glucose), and HR + HG (cultured in normal CCM + 50 µM RES + 40 mM glucose). A literature search was employed to determine the concentrations and exposure periods for glucose and resveratrol treatments. For resveratrol treatment, research conducted by Baselga-Escudero et al. and Raghubeer et al. reported the use of 50 µM and 25 µM resveratrol, respectively56,57. Similarly, several research demonstrated the use of 40 mM glucose to represent “hyperglycemic” or high glucose (HG) conditions5861. Therefore, in this study, 40 mM was used as a high glucose concentration, and for resveratrol, 25 µM, and 50 µM were used. Resveratrol was prepared in 100% dimethyl sulphoxide (DMSO).

Cell culture

The HepG2 cell line was purchased from Merck (Darmstadt, Germany; catalogue number 85011430). Eagle’s minimum essential medium (EMEM) supplemented with 10% fetal bovine serum (FBS), 1% penstrepfungizone (PSF), and 1% L-glutamine was utilized for culturing HepG2 cells in 25 cm3 flasks in a monolayer (106 cells per flask) in a 37 °C humidified incubator (5% CO2). Phosphate-buffered saline (PBS) (0.1 M) was used to wash the cells. Cells were treated with RES (25 µM and 50 µM) and HG (40 mM) upon reaching 70–80% confluent and incubated for 48 and 72 h. Afterward, trypsin was used to remove the cells, and cells were counted using the trypan blue exclusion method of cell counting. Briefly, 60 µL CCM + 20 µL cell suspension + 20 µL trypan blue solution was incubated for 5 min at room temperature. A coverslip (22 × 22 cm) was placed on a clean hemocytometer. Then 10 L of well-mixed counting solution was distributed into the middle bar of the hemocytometer. The number of living cells was then determined using a microscope. The cell viability was evaluated using the standard equation (Live cell average × 5 (dilution factor) × 10,000 = cells/mL).

RNA isolation and gene expression analysis

Total RNA was isolated using a Trizol reagent according to the manufacturer’s protocol. The isolated total RNA was quantified using Nanodrop spectrometry (Nanodrop one C, Thermo Fisher Scientific, Wilmington, DE, USA). The iScript cDNA synthesis kit (Bio-Rad) was utilized for cDNA synthesis by the manufacturer’s guidelines. Once cDNA was completed successfully, the amplification of mRNA was performed using Applied Biosystems™ QuantStudio™ 7 Flex (Thermo Fisher Scientific, USA) with the following reaction mixture: 5 μL SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad), 1.5 μL cDNA, 0.5 μL forward and reverse primers, and 2.5 µL nuclease-free water was made up to 10 µL. The primers (purchased from Inqaba Biotechnical Industries (Pretoria, South Africa)) used are shown in Table 1. Primer sequences used in this study (Table 1) were obtained from previously published articles6268); the primer sequences were confirmed against known sequences in the BLAST database (https://www.nlm.nih.gov/ncbi/workshops/2023-08_BLAST_evol/databases.html). GAPDH was utilized as a housekeeping gene, with three replicates per treatment. The mRNA expression level in each sample was determined using the 2−ΔCt method, and the 2−ΔΔCt value was used to compare the mRNA expression level in each sample to the control 69.

Table 1.

Primers used in this study.

Gene names Forward Reverse Annealing temperature °C
GAPDH 5ʹ ACCACAGTCCATGCCATCAC 3ʹ 5ʹ TCCACCACCCTGTTGCTGTA 3ʹ
SIRT1 5’ TGCCGGAAACAATACCTCCA 3ʹ 5ʹ AGACACCCCAGCTCCAGTTA 3ʹ 55
IkB-α 5ʹ TGCACTTGGCCATCATCCAT 3ʹ 5ʹ TCTCGGAGCTCAGGATCACA 3ʹ 60
NFk-B 5ʹ ATGTGGAGATCATTGAGCAGC 3ʹ 5ʹ CCTGGTCCTGTGTAGCCATT 3ʹ 58
IKKα 5ʹ GGCTTCGGGAACGTCTGTC 3ʹ 5ʹ TTTGGTACTTAGCTCTAGGCGA 3ʹ 60
COX2 5ʹ TAAGTGCGATTGTACCCGGAC 3ʹ 5ʹ TTTGTAGCCATAGTCAGCATTGT 3ʹ 55
IL-6 5ʹ ACTCACCTCTTCAGAACGAATTG 3ʹ 5ʹ CCATCTTTGGAAGGTTCAGGTTG 3ʹ 55
TNF-α 5ʹ GCTGCACTTTGGAGTGATCG 3ʹ 5ʹ TCACTCGGGTTCGAGAAGA 3ʹ 55
GCK 5ʹ TGGACCAAGGGCTTCAAGGCC 3ʹ 5ʹ CATGTAGCAGGCATTGCAGCC 3ʹ 55
PEPCK 5ʹ CTTTTTCGGTGTCGCTCCTG 3ʹ 5ʹ GACACCTGAAGCTAGCGGCT 3ʹ 55
HIF1A 5ʹ GAACGTCGAAAAGAAAAGTCTCG 3ʹ 5ʹ CCTTATCAAGATGCGAACTCACA 3ʹ 55
KLF7 5ʹ GGTGAGCCAGACAGACTGACAA 3ʹ 5ʹ GAAGTAGCCGGTGTCGTGGA 3ʹ 55
TGFβ1 5′ CTAATGGTGGAAACCCACAACG 3′ 5′ TATCGCCAGGAATTGTTGCTG 3′ 55

Enzyme-linked Immunosorbent Assay (ELISA)

The culture supernatant was collected 48 and 72 h after treatment of HGR, LR, HR, LR + HG, and HR + HG. The ELISA kits used to detect human TNF-α (CAT no: DY210-05) and IL-1β (CAT no: DY201-05) were purchased from R&D Systems Biotechnology Company (Minneapolis, Minnesota, United States). The assay was performed in accordance with the manufacturer’s protocol.

Multiplex cytokines assay

The supernatant collected after 48 and 72 h treatments were used in the Bio-Plex 200 system (Bio-Rad) to detect the concentration of the cytokines. The Bio-plex Pro Human Cytokine Grp 1 Panel 27-Plex (Bio-Rad, USA) was used per the manufacturer’s protocol. In this study, only two cytokines (IL-6 and IL-1β) were analysed using Bio-plex Manager Software.

Statistical analysis

All data analyses were conducted using GraphPad Prism version 8.0.0 (GraphPad Software, San Diego, California, USA). The statistical methods employed included the Student’s t-test and one-way analysis of variance (ANOVA). All experiments were conducted in triplicate, and statistical significance was determined at a threshold of p < 0.05.

Ethics approval

The proposal for the current study was approved by the Ethics Committee of Cape Peninsula University of Technology (CPUT/HW-REC 2021/H6).

Acknowledgements

The authors would like to thank Prof JL Marnewick for donating HepG2 cells to us for the experimental work.

Author contributions

A.M.T.: Experimental design, statistical analysis, interpretation of data, and writing original draft. S.R.: Conceptualised the study, Experimental design, Interpretation of the data, revised and proofread the manuscript, supervision. T.E.M.: Supervision, revised and proofread the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research project was supported by a grant from the South African Medical Research Council (SAMRC), with funds from National Treasury under its Economic Competitiveness and Support Package (MRC‐RFA‐UFSP‐01‐2013/VMH Study) and South African National Research Foundation (SANRF) (Grant no. 115450). Department of Science and Innovation (DSI)-) Inter-bursary Support Programme-Council for Scientific and Industrial Research (CSIR) (awarded to AMT).

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Lin CW, Tsai YH, Peng YS, Yang JT, Lu YP, Chen MY, et al. A Novel Salivary Sensor with Integrated Au Electrodes and Conductivity Meters for Screening of Diabetes. Biosensors (Basel). 2023;13(7):702. doi: 10.3390/bios13070702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Goyal, R. & Jialal, I. Diabetes mellitus type 2. (2018).
  • 3.Wu Y, Ding Y, Tanaka Y, Zhang W. Risk factors contributings to type 2 diabetes and recent advances in the treatment and prevention. Int. J. Med. Sci. 2014;11(11):1185. doi: 10.7150/ijms.10001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Mukai E, Fujimoto S, Inagaki N. Role of reactive oxygen species in glucose metabolism disorder in diabetic pancreatic β-cells. Biomolecules. 2022;12(9):1228. doi: 10.3390/biom12091228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Faselis C, Katsimardou A, Imprialos K, Deligkaris P, Kallistratos M, Dimitriadis K. Microvascular complications of type 2 diabetes mellitus. Curr. Vasc. Pharmacol. 2019;18(2):117–124. doi: 10.2174/1570161117666190502103733. [DOI] [PubMed] [Google Scholar]
  • 6.Han HS, Kang G, Kim JS, Choi BH, Koo SH. Regulation of glucose metabolism from a liver-centric perspective. Exp. Mol. Med. 2016;48(3):e218–e218. doi: 10.1038/emm.2015.122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Rines AK, Sharabi K, Tavares CDJ, Puigserver P. Targeting hepatic glucose metabolism in the treatment of type 2 diabetes. Nat. Rev. Drug Discov. 2016;15:786–804. doi: 10.1038/nrd.2016.151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhou J, Xu G, Bai Z, Li K, Yan J, Li F, et al. Selenite exacerbates hepatic insulin resistance in mouse model of type 2 diabetes through oxidative stress-mediated JNK pathway. Toxicol. Appl. Pharmacol. 2015;289(3):409–418. doi: 10.1016/j.taap.2015.10.019. [DOI] [PubMed] [Google Scholar]
  • 9.Zhu YX, Hu HQ, Zuo ML, Mao L, Song GL, Li TM, et al. Effect of oxymatrine on liver gluconeogenesis is associated with the regulation of pepck and g6pase expression and akt phosphorylation. Biomed. Rep. 2021;15(1):1–10. doi: 10.3892/br.2021.1432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Rui L. Energy metabolism in the liver. Compr. Physiol. 2014;4(1):177–197. doi: 10.1002/cphy.c130024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Guo X, Li H, Xu H, Woo S, Dong H, Lu F, et al. Glycolysis in the control of blood glucose homeostasis. Acta Pharm. Sin B. 2012;2(4):358–367. doi: 10.1016/j.apsb.2012.06.002. [DOI] [Google Scholar]
  • 12.Caro J, Triester S, Patel V, Tapscott E, Frazier N, Dohm G. Liver glucokinase: Decreased activity in patients with type II diabetes. Hormone Metab. Res. 1995;27(01):19–22. doi: 10.1055/s-2007-979899. [DOI] [PubMed] [Google Scholar]
  • 13.Clore JN, Stillman J, Sugerman H. Glucose-6-phosphatase flux in vitro is increased in type 2 diabetes. Diabetes. 2000;49(6):969–974. doi: 10.2337/diabetes.49.6.969. [DOI] [PubMed] [Google Scholar]
  • 14.Basu A, Basu R, Shah P, Vella A, Johnson CM, Jensen M, et al. type 2 diabetes impairs splanchnic uptake of glucose but does not alter intestinal glucose absorption during enteral glucose feeding. Diabetes. 2001;50(6):1351–1362. doi: 10.2337/diabetes.50.6.1351. [DOI] [PubMed] [Google Scholar]
  • 15.White, P. J. & Marette, A. Inflammation-induced insulin resistance in obesity when immunity affects metabolic control. In Physical Activity and Type 2 Diabetes (eds. Hawley, J. A. & Zierath, J. R.) 83 (2008).
  • 16.Jeon KI, Xu X, Aizawa T, Lim JH, Jono H, Kwon DS, et al. Vinpocetine inhibits NF-κB-dependent inflammation via an IKK-dependent but PDE-independent mechanism. Proc. Natl. Acad. Sci. U. S. A. 2010;107(21):9795–9800. doi: 10.1073/pnas.0914414107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Tak PP, Firestein GS. NF-κB: A key role in inflammatory diseases. J. Clin. Invest. 2001;107:7–11. doi: 10.1172/JCI11830. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yun JM, Jialal I, Devaraj S. Epigenetic regulation of high glucose-induced proinflammatory cytokine production in monocytes by curcumin. J. Nutr. Biochem. 2011;22(5):450–458. doi: 10.1016/j.jnutbio.2010.03.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Miao F, Gonzalo IG, Lanting L, Natarajan R. In vivo chromatin remodeling events leading to inflammatory gene transcription under diabetic conditions. J. Biol. Chem. 2004;279(17):18091–18097. doi: 10.1074/jbc.M311786200. [DOI] [PubMed] [Google Scholar]
  • 20.Tsalamandris S, Antonopoulos AS, Oikonomou E, Papamikroulis GA, Vogiatzi G, Papaioannou S, et al. The role of inflammation in diabetes: Current concepts and future perspectives. European cardiology review. Radcliffe Cardiol. 2019;14(1):50. doi: 10.15420/ecr.2018.33.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Li MO, Flavell RA. Contextual regulation of inflammation: A duet by transforming growth factor-β and interleukin-10. Immunity. 2008;28(4):468–476. doi: 10.1016/j.immuni.2008.03.003. [DOI] [PubMed] [Google Scholar]
  • 22.Park S, Yang WS, Lee SK, Ahn H, Park JS, Hwang O, et al. TGF-β1 down-regulates inflammatory cytokine-induced VCAM-1 expression in cultured human glomerular endothelial cells. Nephrol. Dialysis Transpl. 2000;15(5):596–604. doi: 10.1093/ndt/15.5.596. [DOI] [PubMed] [Google Scholar]
  • 23.Rai E, Sharma S, Kaul S, Jain K, Matharoo K, Bhanwer AS, et al. The interactive effect of SIRT1 promoter region polymorphism on type 2 diabetes susceptibility in the north indian population. PLoS One. 2012;7(11):e48621. doi: 10.1371/journal.pone.0048621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Takeda-Watanabe A, Kitada M, Kanasaki K, Koya D. SIRT1 inactivation induces inflammation through the dysregulation of autophagy in human THP-1 cells. Biochem. Biophys. Res. Commun. 2012;427(1):191–196. doi: 10.1016/j.bbrc.2012.09.042. [DOI] [PubMed] [Google Scholar]
  • 25.Yeung F, Hoberg JE, Ramsey CS, Keller MD, Jones DR, Frye RA, et al. Modulation of NF-κB-dependent transcription and cell survival by the SIRT1 deacetylase. EMBO J. 2004;23(12):2369–2380. doi: 10.1038/sj.emboj.7600244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Yang, H., Zhang, W., Pan, H., Feldser, H. G., Lainez, E., Miller, C. et al. SIRT1 activators suppress inflammatory responses through promotion of p65 deacetylation and inhibition of NF-κB activity. PLoS One. 7(9). (2012). [DOI] [PMC free article] [PubMed]
  • 27.Qiu T, Yang X, Wang J, Pan C, Chu X, Xiong J, et al. Obesity-induced elevated palmitic acid promotes inflammation and glucose metabolism disorders through GPRs/NF-κB/KLF7 pathway. Nutr. Diabetes. 2022;12(1):23. doi: 10.1038/s41387-022-00202-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kawamura Y, Tanaka Y, Kawamori R, Maeda S. Overexpression of kruppel-like factor 7 regulates adipocytokine gene expressions in human adipocytes and inhibits glucose-induced insulin secretion in pancreatic β-cell line. Mol. Endocrinol. 2006;20(4):844–856. doi: 10.1210/me.2005-0138. [DOI] [PubMed] [Google Scholar]
  • 29.El HM, Buelna-Chontal M, Sánchez-Muñoz F, Carbó R. Adipogenesis: A necessary but harmful strategy. Int. J. Mol. Sci. 2019;20(15):3657. doi: 10.3390/ijms20153657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Fitzpatrick SF, Gojkovic M, Macias D, Tegnebratt T, Lu L, Samén E, et al. Glycolytic response to inflammation over time: Role of myeloid HIF-1alpha. Front Physiol. 2018;22:9. doi: 10.3389/fphys.2018.01624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Bain SC, Feher M, Russell-Jones D, Khunti K. Management of type 2 diabetes: The current situation and key opportunities to improve care in the UK. Diabetes, Obes. Metab. 2016;18(12):1157–1166. doi: 10.1111/dom.12760. [DOI] [PubMed] [Google Scholar]
  • 32.Zhu X, Wu C, Qiu S, Yuan X, Li L. Effects of resveratrol on glucose control and insulin sensitivity in subjects with type 2 diabetes: Systematic review and meta-analysis. Nutr. Metab. 2017;14(1):1–10. doi: 10.1186/s12986-017-0217-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ku SK, Kwak S, Kim Y, Bae JS. Aspalathin and Nothofagin from Rooibos (Aspalathus linearis) inhibits high glucose-induced inflammation in vitro and in vivo. Inflammation. 2015;38(1):445–455. doi: 10.1007/s10753-014-0049-1. [DOI] [PubMed] [Google Scholar]
  • 34.Li, G. Q., Kam, A., Wong, K. H., Zhou, X., Omar, E. A., Alqahtani, A., et al. Herbal medicines for the management of diabetes. Insight 396–413 (2013). [DOI] [PubMed]
  • 35.Imamura H, Yamaguchi T, Nagayama D, Saiki A, Shirai K, Tatsuno I. Resveratrol ameliorates arterial stiffness assessed by cardio-ankle vascular index in patients with type 2 diabetes mellitus. Int Heart J. 2017;58(4):577–583. doi: 10.1536/ihj.16-373. [DOI] [PubMed] [Google Scholar]
  • 36.Baker RG, Hayden MS, Ghosh S. NF-κB, inflammation, and metabolic disease. Cell Metab. 2011;13(1):11–22. doi: 10.1016/j.cmet.2010.12.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ramana KV, Friedrich B, Srivastava S, Bhatnagar A, Srivastava SK. Activation of nulcear factor-κB by hyperglycemia in vascular smooth muscle cells is regulated by aldose reductase. Diabetes. 2004;53(11):2910–2920. doi: 10.2337/diabetes.53.11.2910. [DOI] [PubMed] [Google Scholar]
  • 38.Panahi G, Pasalar P, Zare M, Rizzuto R, Meshkani R. High glucose induces inflammatory responses in HepG2 cells via the oxidative stress-mediated activation of NF-κB, and MAPK pathways in HepG2 cells. Arch. Physiol. Biochem. 2018;124(5):468–474. doi: 10.1080/13813455.2018.1427764. [DOI] [PubMed] [Google Scholar]
  • 39.Hajibabaie F, Abedpoor N, Taghian F, Safavi K. A cocktail of polyherbal bioactive compounds and regular mobility training as senolytic approaches in age-dependent Alzheimer’s: The in silico analysis, lifestyle intervention in old age. J. Mol. Neurosci. 2023;73(2–3):171–184. doi: 10.1007/s12031-022-02086-8. [DOI] [PubMed] [Google Scholar]
  • 40.Prabhakar O. Cerebroprotective effect of resveratrol through antioxidant and anti-inflammatory effects in diabetic rats. Naunyn. Schmiedebergs Arch. Pharmacol. 2013;386(8):705–710. doi: 10.1007/s00210-013-0871-2. [DOI] [PubMed] [Google Scholar]
  • 41.Zhang W, Yu H, Lin Q, Liu X, Cheng Y, Deng B. Anti-inflammatory effect of resveratrol attenuates the severity of diabetic neuropathy by activating the Nrf2 pathway. Aging. 2021;13(7):10659–10671. doi: 10.18632/aging.202830. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Ghadami M, Makita Y, Yoshida K, Nishimura G, Fukushima Y, Wakui K, et al. Genetic mapping of the Camurati-Engelmann disease locus to chromosome 19q13.1–q13.3. Am. J. Human Genet. 2000;66(1):143–7. doi: 10.1086/302728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Zhu D, Zhang N, Zhou X, Zhang M, Liu Z, Liu X. Cichoric acid regulates the hepatic glucose homeostasis via AMPK pathway and activates the antioxidant response in high glucose-induced hepatocyte injury. RSC Adv. 2017;7(3):1363–1375. doi: 10.1039/C6RA25901D. [DOI] [Google Scholar]
  • 44.Zhang HH, Ma XJ, Wu LN, Zhao YY, Zhang PY, Zhang YH, et al. SIRT1 attenuates high glucose-induced insulin resistance via reducing mitochondrial dysfunction in skeletal muscle cells. Exp. Biol. Med. 2015;240(5):557–565. doi: 10.1177/1535370214557218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Lu C, Zhao H, Liu Y, Yang Z, Yao H, Liu T, et al. Novel role of the SIRT1 in endocrine and metabolic diseases. Int. J. Biol. Sci. 2023;19(2):484–501. doi: 10.7150/ijbs.78654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Balestrieri ML, Servillo L, Esposito A, D’Onofrio N, Giovane A, Casale R, et al. Poor glycaemic control in type 2 diabetes patients reduces endothelial progenitor cell number by influencing SIRT1 signalling via platelet-activating factor receptor activation. Diabetologia. 2013;56(1):162–172. doi: 10.1007/s00125-012-2749-0. [DOI] [PubMed] [Google Scholar]
  • 47.Arunachalam G, Samuel SM, Marei I, Ding H, Triggle CR. Metformin modulates hyperglycaemia-induced endothelial senescence and apoptosis through SIRT1. Br. J. Pharmacol. 2014;171(2):523–535. doi: 10.1111/bph.12496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Jia Y, Zheng Z, Wang Y, Zhou Q, Cai W, Jia W, et al. SIRT1 is a regulator in high glucose-induced inflammatory response in RAW264.7 Cells. PLoS One. 2015;10(3):e0120849. doi: 10.1371/journal.pone.0120849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Goh KP, Lee HY, Lau DP, Supaat W, Chan YH, Koh AFY. Effects of resveratrol in patients with type 2 diabetes mellitus on skeletal muscle SIRT1 expression and energy expenditure. Int. J. Sport Nutr. Exerc. Metab. 2014;24(1):2–13. doi: 10.1123/ijsnem.2013-0045. [DOI] [PubMed] [Google Scholar]
  • 50.Matoba K, Kawanami D, Okada R, Tsukamoto M, Kinoshita J, Ito T, et al. Rho-kinase inhibition prevents the progression of diabetic nephropathy by downregulating hypoxia-inducible factor 1α. Kidney Int. 2013;84(3):545–554. doi: 10.1038/ki.2013.130. [DOI] [PubMed] [Google Scholar]
  • 51.Shao Y, Lv C, Yuan Q, Wang Q. Levels of serum 25(OH)VD 3, HIF-1 α, VEGF, vWf, and IGF-1 and their correlation in type 2 diabetes patients with different urine albumin creatinine ratio. J. Diabetes Res. 2016;2016:1–7. doi: 10.1155/2016/1925424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Isoe T, Makino Y, Mizumoto K, Sakagami H, Fujita Y, Honjo J, et al. High glucose activates HIF-1-mediated signal transduction in glomerular mesangial cells through a carbohydrate response element binding protein. Kidney Int. 2010;78(1):48–59. doi: 10.1038/ki.2010.99. [DOI] [PubMed] [Google Scholar]
  • 53.Rahimi G, Heydari S, Rahimi B, Abedpoor N, Niktab I, Safaeinejad Z, et al. A combination of herbal compound (SPTC) along with exercise or metformin more efficiently alleviated diabetic complications through down-regulation of stress oxidative pathway upon activating Nrf2-Keap1 axis in AGE rich diet-induced type 2 diabetic mice. Nutr. Metab. (Lond). 2021;18(1):14. doi: 10.1186/s12986-021-00543-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Haghparast Azad M, Niktab I, Dastjerdi S, Abedpoor N, Rahimi G, Safaeinejad Z, et al. The combination of endurance exercise and SGTC (Salvia–Ginseng–Trigonella–Cinnamon) ameliorate mitochondrial markers’ overexpression with sufficient ATP production in the skeletal muscle of mice fed AGEs-rich high-fat diet. Nutr. Metab. (Lond). 2022;19(1):17. doi: 10.1186/s12986-022-00652-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Azizian-Farsani F, Osuchowski M, Abedpoor N, Forootan FS, Derakhshan M, Nasr-Esfahani MH, et al. Anti-inflammatory and -apoptotic effects of a long-term herbal extract treatment on DSS-induced colitis in mice fed with high AGEs-fat diet. Nutr. Metab. (Lond). 2021;18(1):77. doi: 10.1186/s12986-021-00603-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Baselga-Escudero L, Blade C, Ribas-Latre A, Casanova E, Suárez M, Torres JL, et al. Resveratrol and EGCG bind directly and distinctively to miR-33a and miR-122 and modulate divergently their levels in hepatic cells. Nucleic Acids Res. 2014;42(2):882–892. doi: 10.1093/nar/gkt1011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Raghubeer S, Nagiah S, Phulukdaree A, Chuturgoon A. The phytoalexin resveratrol ameliorates ochratoxin a toxicity in human embryonic kidney (HEK293) cells. J. Cell Biochem. 2015;116(12):2947–2955. doi: 10.1002/jcb.25242. [DOI] [PubMed] [Google Scholar]
  • 58.Chu HL, Chien JC, Der DuhP. Protective effect of Cordyceps militaris against high glucose-induced oxidative stress in human umbilical vein endothelial cells. Food Chem. 2011;129(3):871–876. doi: 10.1016/j.foodchem.2011.05.037. [DOI] [PubMed] [Google Scholar]
  • 59.Leinninger GM, Russell JW, van Golen CM, Berent A, Feldman EL. Insulin-like growth factor-I regulates glucose-induced mithochondrial depolarization and apoptosis in human neuroblastoma. Cell Death Differ. 2004;11(8):885–896. doi: 10.1038/sj.cdd.4401429. [DOI] [PubMed] [Google Scholar]
  • 60.Varma S, Lal BK, Zheng R, Breslin JW, Saito S, Pappas PJ, et al. Hyperglycemia alters PI3k and Akt signaling and leads to endothelial cell proliferative dysfunction. Am. J. Physiol. Heart Circ. Physiol. 2005;289:1744–51. doi: 10.1152/ajpheart.01088.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Kapoor, R. & Kakkar, P. Protective role of morin, a flavonoid, against high glucose induced oxidative stress mediated apoptosis in primary rat hepatocytes. PLoS One. 7(8). (2012) [DOI] [PMC free article] [PubMed]
  • 62.Raghubeer S, Nagiah S, Chuturgoon A. Ochratoxin A upregulates biomarkers associated with hypoxia and transformation in human kidney cells. Toxicol. In Vitro. 2019;57:211–216. doi: 10.1016/j.tiv.2019.03.016. [DOI] [PubMed] [Google Scholar]
  • 63.Vasu S, McClenaghan NH, McCluskey JT, Flatt PR. Cellular responses of novel human pancreatic β-cell line, 1.1B4 to hyperglycemia. Islets. 2013;5(4):170–7. doi: 10.4161/isl.26184. [DOI] [PubMed] [Google Scholar]
  • 64.Kawamura Y, Tanaka Y, Kawamori R, Maeda S. Overexpression of Kruppel-like factor 7 regulates adipocytokine gene expressions in human adipocytes and inhibits glucose-induced insulin secretion in pancreatic β-cell line. Mol. Endocrinol. 2006;20(4):844–856. doi: 10.1210/me.2005-0138. [DOI] [PubMed] [Google Scholar]
  • 65.He M, Zhang W, Dong Y, Wang L, Fang T, Tang W, et al. Pro-inflammation NF-κB signaling triggers a positive feedback via enhancing cholesterol accumulation in liver cancer cells. J. Exp. Clin. Cancer Res. 2017;36(1):1–13. doi: 10.1186/s13046-017-0490-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Xiao J, Gong L, Xiao M, He D, Xiang L, Wang Z, et al. LINC00467 promotes tumor progression via regulation of the NF-kb signal axis in bladder cancer. Front. Oncol. 2021;28:11. doi: 10.3389/fonc.2021.652206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Diaz-Ganete A, Quiroga-de-Castro A, Mateos RM, Medina F, Segundo C, Lechuga-Sancho AM. Toxicity induced by cytokines, glucose, and lipids increase apoptosis and hamper insulin secretion in the 1.1E7 beta cell-line. Int J Mol Sci. 2021;22(5):2559. doi: 10.3390/ijms22052559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Xiao L, Li X, Cao P, Fei W, Zhou H, Tang N, et al. Interleukin-6 mediated inflammasome activation promotes oral squamous cell carcinoma progression via JAK2/STAT3/Sox4/NLRP3 signaling pathway. J. Exp. Clin. Cancer Res. 2022;41(1):166. doi: 10.1186/s13046-022-02376-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES