Phloretin targets SIRT1 to alleviate oxidative stress, apoptosis, and inflammation in deep venous thrombosis

Abstract

Deep vein thrombosis (DVT) is a type of venous thromboembolism posing a serious threat to health on a global scale. Phloretin is a potential natural product that has a variety of pharmacological activities. Besides, some Chinese medicines reported that deacetylase sirtuin (SIRT)1 treats DVT by anti-inflammatory and anti-platelet production. However, the specific binding targets and binding modes have not been elaborated. The present study was to investigate whether phloretin attenuates DVT in model rats and oxidized low‑density lipoprotein (ox‑LDL) induced human umbilical vein endothelial cells (HUVECs), and to explore its potential target. The results revealed that the treatment of phloretin, especially pretreatment of it elevated tissue plasminogen activator (t-PA), superoxide dismutase (SOD), prothrombin time (PT), thrombin time (TT), activated partial thromboplastin time (APTT), and cell apoptosis proteins whereas it suppressed plasminogen activator inhibitor (PAI), malondialdehyde (MDA), reactive oxygen species (ROS), fibrinogen (FIB) in DVT rats and cells. Concurrently, phloretin inhibited collagen type I alpha 1 (COL1A1), transforming growth factor-β1 (TGF-β1), and inflammatory factors while it enhanced nuclear factor erythroid 2-related factor 2 (Nrf-2), heme oxygenase 1 (HO-1). In addition, 20 μM phloretin exerted powerful effective protection in HUVECs with DVT model. Later, the surface plasmon resonance (SPR) confirmed that phloretin has a high affinity with SIRT1. Furthermore, siRNA-SIRT1 transfection abolished the protective effect of phloretin against ox‑LDL‑induced DVT in HUVECs, indicating that phloretin targets SIRT1 to alleviate oxidative stress, cell apoptosis, and inflammation in DVT rats and HUVECs.

Supplementary Information

The online version contains supplementary material available at 10.1007/s43188-023-00207-y.

Introduction

Deep venous thrombosis (DVT) is caused by abnormal clotting of blood in the deep veins, resulting in lumen blockage and impaired venous return mostly in lower limb veins [1]. Recent studies have shown that 200/100,000 people in Asia suffer from DVT each year, and the incidence of symptomatic but not fatal cases is 30/100,000 [2]. The main clinical characteristics of DVT are sudden swelling of one limb, partial swelling and pain, which is aggravated when walking, and in mild cases, only partial feeling of heaviness while standing and other symptoms. If left untreated, as venous thrombosis continues to spread, it may eventually develop into pulmonary embolism, post-thrombotic syndrome, and even sudden death [3].

It has been shown that venous endothelial cells undergo excessive oxidative stress in the microenvironment of blood clots and stasis, which generates large amounts of reactive oxygen species (ROS) and eventually forms thrombi [4]. ROS are involved in the regulation of the major processes that promote the formation of venous thrombi. These processes include coagulation, platelet reactivity, and sterile inflammation during formation [5]. In other words, ROS are directly involved in oxidative damage in venous endothelial cells, apoptosis, and pathological processes such as platelet activation, adhesion, and aggregation. Typically, ROS are produced in vivo and continuously scavenged by relevant inhibitory enzymes and antioxidant molecules. However, when the organism experiences tissue hypoxia, ischemia‒reperfusion injury, blood flow stagnation, and organismal stress, a large amount of ROS will be produced, exceeding the endogenous clearance capacity and resulting in residual ROS in the blood, which induces oxidative stress damage to venous endothelial cells, and in severe cases, apoptosis may occur [6]. An increasing number of studies have shown that excessive ROS and the induced oxidative stress cascade are important pathological mechanisms that mediate DVT. Hence, regulating intracellular ROS levels are a strategy to protect venous endothelial cells from oxidative stress damage in DVT.

Sirtuin (SIRT)1 is a member of the Sirtuin family [6], and it is the first protein of this family with a crystal structure and is the most widely studied, highly conserved NAD⁺-dependent protein deacetylase. SIRT1 has several roles in oxidative stress. One of the primary ways it controls oxidative stress is by deacetylating key proteins involved in the response to oxidative stress. Deacetylation is a process where an acetyl group is removed from a molecule, changing its activity. In the case of proteins, deacetylation can change their function. Moreover, SIRT1 is known to deacetylate and activate peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α), a critical regulator of mitochondrial biogenesis and function. Since mitochondria are the primary source of ROS in cells, enhancing mitochondrial health and function can reduce ROS production and oxidative stress [7]. In addition, it is worth noting that some natural products or proprietary Chinese medicines have been used to treat DVT by inducing the expression of the deacetylase SIRT1 and inhibit inflammation and platelet production, including xanthohumol and peony blood stasis [8, 9]. A recent study of a rat model of DVT showed that SIRT1 negatively regulated the inflammatory response of nuclear factor kappa B (NF-κB) to improve DVT [10, 11]. These studies indicate that SIRT1 is a molecule that affects DVT.

Phloretin is a natural product derived from the peel and root bark of juicy fruits such as apples and pears [12]. Studies have shown that phloretin has various pharmacological activities, such as antioxidant, anti-inflammatory, and antitumor activities, and can regulate lipid metabolism, delay aging, and improve immunity and hypoglycemia [13]. Kim et al. reported that phloretin disturbed tethering and the stable adhesion of monocytes and platelets to the endothelium during thrombosis induced by thrombin [14], indicating that phloretin may have a positive effect on DVT. In previous studies on obesity-induced diseases, phloretin showed good cytoprotective effects, and SIRT1 was shown to be its direct target [10]. Therefore, SIRT1 is considered one of the key targets of phloretin for the treatment of DVT. However, whether phloretin treats DVT by affecting the SIRT1 pathway remains unclear.

Therefore, based on these findings, this study aimed to investigate the role of phloretin in DVT models and whether it targets SIRT1 to affect cell oxidative stress, apoptosis, and the inflammatory response.

Material and methods

Animals and experiments

Thirty male SD rats (10–12 weeks old) weighing 250–300 g were purchased from Zhejiang Weitong Lihua Laboratory Animal Technology Co., Ltd. (Animal Production License No: SCXK (Zhe) 2019-0001). The animals were housed with a constant temperature of 22 ± 2 °C, humidity of 50–60%, light every 12 h with alternating dark, and wind changes 15–20 times/h.

Establishment of the DVT model

The DVT model was established according to a previous publication [15]. The rats were anesthetized with isoflurane inhalation and fixed. After abdominal disinfection, the abdominal cavity was opened layer by layer along the abdominal linea albus. The small intestine and other organs were pulled out and gently placed on the left side of the rat to expose the inferior vena cava and its branches. The abdominal aorta and inferior vena cava were peeled below the renal vein, and then the inferior vena cava and branches were ligated. Finally, the intestines and other organs were placed back into the abdominal cavity, and 0.2 mL of 1% ambenzin solution was administered to prevent infection. The rats were placed in an environment of 25–28 ℃ after the operation until the rats were resuscitated. The control group underwent the same operation as the DVT group except that the inferior vena cava and its branches were not ligated.

Phloretin preparation and treatments

Phloretin (PubChem CID: 24,278,652) with a purity of 98% was purchased from Aladdin (Shanghai, China). Phloretin was prepared as previously described [10].

Group administration

The rats were randomly divided into 5 groups: control group, DVT group, DVT + phloretin pretreatment group (40 mg/kg), DVT + phloretin treatment group (40 mg/kg), and phloretin group (40 mg/kg). The dose of phloretin was chosen based on previous studies [16, 17]. There were 6 rats in each group. The phloretin pretreatment group was given phloretin by gavage 7 days in advance according to a previous study [18]. One hour after the last phloretin treatment, the DVT model was established. The rats in the phloretin treatment group were given phloretin by gavage 3 h after modeling. The rats in the phloretin pretreatment and treatment groups were given phloretin daily for 7 days after modeling. The control and DVT groups were administered the same amount of normal saline by gavage. The completely schematic diagram shows in Figure S1.

Detection of thrombus dry and wet weight and the coagulation function index

After 7 days of daily administration of phloretin in the phloretin pretreatment group and the treatment group, the inferior vena tissues were dissected and photographed after rats were euthanized by CO₂ inhalation. Then, the venous lumen was cut longitudinally, and the blood in this section of the vessel was absorbed with filter paper. After carefully removing the thrombus, the weight was recorded as the wet weight. In addition, the thrombus was placed in a drying oven at 60 ℃ for 2 h. After cooling, the thrombus was weighed to determine the dry weight. The prothrombin time (PT), activated partial thromboplastin time (APTT), thrombin time (TT) and fibrinogen (FIB) in serum were tested by a coagulation analyzer (SYSMEX, CA-550).

Enzyme-linked immunosorbent assay (ELISA)

Serum levels of tissue plasminogen activator (t-PA) (MEIMIAN, MM-0523R1), plasminogen activator inhibitor (PAI) (MEIMIAN, MM-0073R1), malonaldehyde (MDA) (JIANCHEN, A003-1-2), and superoxide dismutase (SOD) (Shanghai Biyuntian Biotechnology Co., LTD. S0101S) were tested with ELISA kits according to the manufacturer’s instructions.

Hematoxylin–eosin (HE) staining

The inferior vena cava vessels were quickly removed and fixed with 4% paraformaldehyde. The inferior vena cava vessels were dehydrated by gradient ethanol and xylene and then immersed in wax. The tissues were cut into 5 μm slices and affixed to the anti-peeling slides. The slices were baked at 60 ℃ for 1–2 h, dewaxed and hydrated by xylene and gradient ethanol, and stained with HE (SERVICEBIO, G1005). Finally, low to high concentrations of ethanol were added for dehydration. Vitrification was performed with xylene, and the slices were sealed with neutral balsam and observed under a microscope.

According to a previous study on the plaque area of inferior vena cava tissue [19], we further scored HE staining. The HE scoring system is defined as follows: Score 0: Normal; Score 1: Slight hypertrophy of smooth muscle cells; Score 2: Hypertrophy of smooth muscle cells, disordered arrangement, loose tissue, and minimal thrombus formation; Score 3: Hypertrophy of smooth muscle cells, evident dilation but intact morphology, thrombus filling the vein; and Score 4: Hypertrophy of smooth muscle cells, loose and edematous vascular wall tissue, severe tissue injury, thrombus filling the vein. The HE score provides a standardized and quantifiable measure of the pathological changes in the venous wall and the degree of thrombus formation, which are key features of DVT. Lower scores indicate less severity, while higher scores denote more significant pathological changes.

Dihydroethidium (DHE) staining

Superoxide transforms DHE into a substance that binds to DNA and increases intracellular fluorescence. Superoxide is not produced by the redox cycling of DHE. Frozen sections were treated with ROS (D7008, Sigma), incubated at 37 °C in a light-protected humidified chamber for 30 min, rinsed with PBS, and mounted with fluorescent mounting medium.

TUNEL staining

The TUNEL assay was performed according to the manufacturer’s instructions. Deparaffinized tissue sections were incubated with proteinase K (G1205, Servicebio) in a humidified chamber for 15 min, and sections were then incubated with 3% H₂O₂ for 10 min and terminal deoxynucleotidyl transferase (TdT) (G1501, Servicebio) labeling buffer at 37 °C for 1 h. Later, the sections were stained with 4′,6-diamidino-2-phenylindole (DAPI). TUNEL-positive cells were stained green; nuclei were stained with DAPI to observe TUNEL-positive cells.

Immunohistochemistry (IHC)

The prepared paraffin sections of inferior vena tissues were dewaxed with xylene, high to low concentrations of ethanol were successively added to rehydrate the tissue, and antigen repair solution was added. Then, the sections were washed with hydrogen peroxide to block endogenous peroxidase, sealed with bovine serum and incubated overnight with transforming growth factor-β1 (TGF-β1) (AF1027, Affinity) and SIRT1 (DF6033, Affinity) at 4 ℃. On the second day, the corresponding HRP-conjugated secondary antibody was added and incubated. DAB (SERVICEBIO, G1212) was added. The positive expression of DAB was brown‒yellow, and the nuclei were stained with hematoxylin. Finally, low to high concentrations of ethanol were added for dehydration, xylene was added for vitrification, and the slices were sealed with neutral balsam and observed under the microscope.

Western blotting

Pure protein was extracted from inferior vena tissue, and the protein concentration was measured by the BCA method. After loading buffer was added, the protein was boiled for denaturation. Total protein was separated by electrophoresis and transferred to a PVDF membrane. The nonspecific antigen was blocked with 5% milk, and the protein on the membrane was incubated with the target antibodies nuclear factor erythroid 2-related factor 2 (Nrf-2, AF0639), heme oxygenase 1 (HO-1, AF5393), collagen type I alpha 1 (COL1A1, AF7001), TGF-β1, (BF8012), BCL2-Associated X (BAX, AF0120), B-cell lymphoma-2 (BCL-2, AF6139), Caspase-3 (AF6311), SIRT1 (DF6033), phospho-NF-κB p65 (p-p65, BF8005), NF-κB (p65) (BF8005), acetylated-NF-κB p65 (Ace-p65, AF1017), and β-actin (AF7018), all from Affinity (USA). After incubation at 4 °C overnight, unbound antibodies were washed with TBST and then incubated with secondary antibodies (anti-rabbit IgG, HRP-linked antibody, CST, 7074, anti-mouse IgG, HRP-linked antibody, CST, 7076). Unbound antibodies were washed away and captured in an ECL luminescence imager.

Quantitative real-time PCR (qRT‒PCR)

RNA was isolated from inferior vena tissue by TRIzol (Sangon Biotech, B511311) extraction and transcribed into cDNA with a reverse transcription kit (Jiangsu Cowin Biotech CW2569). Primers, DEPC, cDNA, and SYBR Green (Takara, RR820A) were added to prepare the system for the amplification products in a PCR instrument. The sequences of the primers are listed below as Table 1. The fold changes in mRNA were calculated using the 2^−ΔΔCT method.

Table 1.

Primer sequence

Gene	Forward primer	Reverse primer
Rat Nrf2	ACTACAGTCCCAGCAGGACA	ATTGAACTCCACCGTGCCTT
Rat HO-1	GAGTTTCCGCCTCCAACCAG	GAGGTAGTATCTTGAACCAGGCT
Rat COL1A1	ACGTGGAAACCTGATGTATGCT	CACCATCGTTACCACGAGC
Rat TGF-β1	TACCTTTCCTTGGGAGACCCC	CAGCCACTCAGGCGTATCAG
Rat BAX	GATGCGTCCACCAAGAAG	CGTCAGCAATCATCCTCT
Rat BCL-2	CTTTGAGTTCGGTGGGGTCA	AAACAGAGGTCGCATGCTGG
Rat Caspase-3	TGACTGGAA AGCCGA AACT	GGGTGCGGTAGAGTA AGCAT
Rat GAPDH	AAGGTCGGTGTGAACGGATTT	CTTTGTCACAAGAGAAGGCAGC
Human SIRT1	TAGCCTTGTCAGATAAGGAAGGA	ACAGCTTCACAGTCAACTTTGT
Human GAPDH	GCACCGTCAAGGCTGAGAAC	TGGTGAAGACGCCAGTGGA

Cell culture and transfection

Icell-h111 human umbilical vein endothelial cells (HUVECs) (iCell-h110-001b) were cultured in RPMI 1640 containing 10% fetal bovine serum (FBS), 100 μg/mL streptomycin, and 100 U/mL penicillin in an incubator with 5% CO₂ at 37 ℃.

The cells in the control group without any drug treatment. The oxidized low‑density lipoprotein (ox‑LDL) group were treated with 100 μg/mL ox-LDL purchased from Beijing Solarbio Life Science Company (Cat. No. H7950, Beijing, China) according to a previous study [20], and the phloretin treatment groups were treated with ox-LDL supplemented with 5, 10, or 20 μM phloretin).

The gene sequence of the SIRT1 protein was identified by NCBI, and siRNA-SIRT1 was synthesized by Shanghai GenePharma Company. After the cells were passaged, the cell suspensions were inoculated in 6-well culture plates.

First, HUVECs were pretreated with phloretin (20 μM) for 24 h; then cells were treated with 100 μg/mL ox-LDL for 24 h. Later, the cells were plastered and transfected with lipo 3000. After 6 h of transfection with siRNA-SIRT1 and siRNA-NC, the cells were placed in normal medium and further cultured for 24 h.

Flow cytometry (FCM)

The cell suspension was seeded in a 6-well culture plate. The concentration of ROS in HUVECs was determined by FCM according to the instructions of the ROS kit (Beyotime, S0033).

The treated cells were collected, washed three times with PBS, and then resuspended in 500 μL PBS. The cells were placed in 1.5 mL EP tubes, and 5 μL Annexin V and 5 μL PI (BD, 556,547) were added to each tube in the dark and mixed, and the cells were incubated for 15 min in darkness at room temperature. The apoptosis rate was detected by FCM (BD Calibur).

Surface plasmon resonance (SPR)

The compounds were weighed precisely, prepared with dimethyl sulfoxide (DMSO) to form 10 mmol/L stock solution, and then diluted with PBS buffer to a series of solutions with different concentrations containing 5% DMSO. Six DMSO solutions were prepared containing 4. 5% and 5.8% DMSO as the solvent for the kinetic experiments. Eight different solutions of compounds containing 5% DMSO were sequentially injected into the channel, and the kinetic experiments were performed according to the preset method using a 5% DMSO-PBS-P buffer as the mobile phase. After the experiments, the chip surface was rinsed with the regeneration solution (10 mmol/L NaOH).

Statistical analysis

Statistical analysis was performed using SPSS software (16.0, IBM, USA). If the measurement data in multiple groups were in accordance with the normal distribution and homogeneity of variance test, one-way ANOVA was used, and Tukey’s test was used for further pairwise comparisons between groups. Dunnett’s T3 test or independent sample t test was used if the distribution was normal but the variance was not uniform. If the data did not conform to a normal distribution, the Kruskal‒Wallis H test was used. The significance level was α = 0.05. The data are expressed as the mean ± standard deviation. P < 0.05 was considered statistically significant.

Results

Phloretin reduced thrombus weight and influenced the indicators of the coagulation system in rats with DVT

As shown in Fig. 1a, after phloretin treatment, the thrombus dry and wet weights in deep veins were reduced (p < 0.05). Pretreatment with phloretin inhibited the thrombus dry and wet weights (p < 0.01). In addition, the results demonstrated that in DVT, a hypercoagulable state inhibited t-PA expression but enhanced PAI expression, and phloretin reversed this effect (Fig. 1b, p < 0.01). For the coagulation system in DVT, the phloretin groups had elevated PT, TT, and APTT and consumed less FIB, especially in the phloretin pretreatment group (Fig. 1c, p < 0.01). These results indicated that phloretin reduced the thrombus weight and influenced the indicators of the coagulation system in rats with DVT.

Fig. 1.

Phloretin reduced the thrombus weight, influenced the indicators of coagulation system, and restrained the expressions of sirtuin1 (SIRT1) and transforming growth factor-β1(TGF-β1) in the inferior vena in deep venous thrombosis (DVT) rats. a The dry and wet weight of thrombus in each group rats, n = 6 in each group; b The serum of tissue plasminogen activator (tPA) and plasminogen activator inhibitor (PAI) were tested by Enzyme-linked immunosorbent assay (ELISA) kit, n = 6 in each group; c The prothrombin time (PT), activated partial thromboplastin time (APTT), thrombin time (TT) and fibrinogen (FIB) were tested by coagulation analyzer, n = 6 in each group; d, e The histomorphology of the inferior vena tissues in rats was observed by hematoxylin–eosin (HE) staining (magnification × 40, 400), the HE score in each group was calculated, n = 6 in each group; f The positive expressions of SIRT1 and TGF-β1 of the inferior vena tissues in rats were examined by immunohistochemistry (magnification × 400); ^▲p < 0.05, ^▲▲p < 0.01 vs. control group. ^★p < 0.05, ^★★p < 0.01 vs. DVT group. Phl Phloretin, pre pretreatment, Phl + pre pretreatment of Phloretin

Phloretin relieved the presence of thrombi, inhibited the expression of TGF-β1 and increased SIRT1 in the inferior vena cava in rats with DVT

As shown in Fig. 1d, e, in the DVT group, a large number of thrombi formed in the lumen of the inferior vena cava with a dark red color, the thrombus was dominated by the aggregation of red blood cells, the vessel wall was loose, edema was present, and the intima was irregular. The pathological changes in DVT were improved by phloretin. Consistently, the semiquantitative HE scores of the venous tissues of rats in the DVT plus phloretin groups were significantly lower than those in the DVT group, particularly in the phloretin pretreatment group (Fig. 1d, p < 0.05 or p < 0.01). In addition, the expression of SIRT1 was increased, and TGF-β1 expression was reduced by phloretin in the pretreatment and treatment groups compared to the DVT group (Fig. 1f). These results indicated that phloretin alleviated thrombi, inhibited the expression of TGF-β1 and increased SIRT1 in the inferior vena cava in rats with DVT.

Phloretin decreased ROS expression, TUNEL-positive cells, and MDA levels but increased SOD levels in rats with DVT

The results in Fig. 2a, b showed that after phloretin pretreatment and treatment, ROS production, the fluorescence intensity of ROS, and the percentage of apoptotic cells were reduced (p < 0.05 or p < 0.01). To confirm oxidative stress, SOD and MDA were examined. As expected, phloretin pretreatment and treatment increased SOD expression and inhibited MDA expression compared to those in the DVT group (Fig. 2c, p < 0.01). These results indicated that phloretin decreased ROS expression, TUNEL-positive cells, and MDA but increased SOD in rats with DVT.

Fig. 2.

Phloretin decreased the reactive oxygen species (ROS) expression, TUNEL-positive cells, malonaldehyde (MDA), and improved superoxide dismutase (SOD) level in DVT rats. a The expression of ROS in inferior vena tissues was detected by dihydroethidium staining. TUNEL staining was used to observe the apoptosis of venous tissue in rats, (magnification, × 200, 400); b The graphs of the ROS fluorescence intensity and the percentage of the TUNEL-positive cells; n = 6 in each group; c ELISA was used to test the MDA and SOD content in inferior vena tissues of the DVT model in rats, n = 6 in each group; ^▲p < 0.05, ^▲▲p < 0.01 vs. control group. ^★p < 0.05, ^★★p < 0.01 vs. DVT group. Phl Phloretin, pre: pretreatment, Phl + pre pretreatment of Phloretin

Phloretin increased the expression of SIRT1 and antioxidant-related factors and decreased fibrosis-, apoptosis-, and inflammation-related factors in rats with DVT

As shown in Fig. 3a, the mRNA expression levels of antioxidant factors (Nrf2, HO-1) were upregulated in the inferior vena tissue by phloretin compared to those in the DVT group. As expected, phloretin suppressed the mRNA expression of fibrosis-related factors (COL1A1 and TGF-β1). Moreover, phloretin altered apoptosis; BAX and caspase-3 expression were reduced, and BCL-2 expression was increased, indicating that phloretin increased the survival of cells in rats with DVT. Moreover, pretreatment with phloretin showed improved protection (p < 0.05 or p < 0.01). We used western blotting to further detect the corresponding proteins, and the results were consistent. In addition, we showed that the expression of SIRT1 was increased after phloretin treatment, and the transcription factors associated with inflammation, such as p-p65/p65 and Ace-p65/p65, were suppressed compared to those in the DVT group (Fig. 3b, c, p < 0.05 or p < 0.01). These results indicated that phloretin increased the expression of SIRT1 and antioxidant factors and decreased fibrosis-, apoptosis-, and inflammation-related factors in rats with DVT.

Fig. 3.

Phloretin strengthened the expression of SIRT1, antioxidant-related factors, meanwhile it decreased fibrosis-, apoptosis-, and inflammatory-related factors in DVT rats. a The expression of nuclear factor erythroid 2-Related factor 2(Nrf2), heme oxygenase 1(HO-1), collagen type I Alpha1 (COL1A1), TGF-β1, BCL2-associated X(BAX), caspase-3 level in rats in each group were observed by quantitative Real-time PCR (qRT-PCR), n = 3 in each group; b, c Western blot was used to test Nrf2, HO-1, COL1A1, TGF-β1, BAX, BCL-2, caspase-3, SIRT1, phosphor- NF-κB p65 (p-p65), NF-κB (p65), and acetylated- NF-κB (Ace-p65) proteins in rats in each group, n = 3 in each group, ^▲p < 0.05, ^▲▲p < 0.01 vs. control group. ^★p < 0.05, ^★★p < 0.01 vs. DVT group. Phl Phloretin, pre pretreatment, Phl + pre pretreatment of Phloretin

Different concentrations of phloretin increased the expression of SIRT1 and antioxidant-related factors and decreased fibrosis-, apoptosis-, and inflammation-related factors in the ox-LDL-induced DVT model in HUVECs

To further study the effect of phloretin on DVT, we established a model in HUVECs. To test the oxidative stress response to ox-LDL with or without phloretin in HUVECs, we examined MDA and SOD expression. As shown in Fig. 4a, we found that MDA levels were increased after ox-LDL stimulation. Moreover, 5, 10, and 20 μM phloretin inhibited the production of MDA in a concentration-dependent manner. In contrast, SOD showed the opposite effects (p < 0.01).

Fig. 4.

Phloretin with different concentrations strengthened the expression of SIRT1, antioxidant-related factors, meanwhile it decreased fibrosis-, apoptosis-, and inflammatory-related factors in oxidized low-density lipoprotein (ox-LDL) induced DVT model in human umbilical vein endothelial cells (HUVECs). a ELISA was used to test MDA and SOD levels in each group in HUVECs, n = 6 in each group; b, c Western blot was used to test Nrf2, HO-1, COL1A1, and TGF-β1 proteins in HUVECs, n = 3 in each group; d, e Western blot was used to test BAX, BCL-2, caspase-3, SIRT1, p-p65, p65, and Ace-p65 proteins in HUVECs, n = 3 in each group, ^◆p < 0.05, ^◆◆p < 0.01 vs. control group; ^●p < 0.05, ^●●p < 0.01 vs. ox-LDL group. Phl Phloretin

As shown in Fig. 4b, e, after ox-LDL stimulation, we found that with the different concentrations of phloretins increased the expression levels of Nrf2 and HO-1, reduced COL1A1, TGF-β1, BAX and caspase-3 levels, and increased BCL-2 compared to those in the ox-LDL group. The expression of SIRT1 was increased by phloretin, and the expression of the inflammation-related factors p-p65 and Ace-p65 was decreased compared to that in the ox-LDL group. In addition, we found that 20 μM phloretin had the most beneficial effect on the ox-LDL-induced DVT model in cells (p < 0.05 or p < 0.01). These results indicated that different concentrations of phloretin increased the expression of SIRT1 and antioxidant-related factors and decreased fibrosis-, apoptosis-, and inflammation-related factors in the ox-LDL-induced DVT model in HUVECs.

Different concentrations of phloretin alleviated ROS production and apoptosis in HUVECs in the ox-LDL-induced DVT model

We further used FCM to examine ROS production in the ox-LDL-induced DVT model in HUVECs. The results showed that 20 μM phloretin treatment reduced ROS levels compared to those in the ox-LDL group (Fig. 5a, p < 0.05 or p < 0.01). Furthermore, we analyzed apoptotic cells in response to different concentrations of phloretin. The results showed that phloretin reduced the number of apoptotic cells, and 20 μM phloretin improved the survival of HUVECs in the ox-LDL-induced DVT model (Fig. 5b, p < 0.01). To confirm whether phloretin targets SIRT1 to exert its effects, SPR analysis was performed, and the results showed that different concentrations of phloretin had high affinity for SIRT1, with a K_D of 4.7 × 10^–4 (Fig. 5c, d). These results indicated that different concentrations of phloretin alleviated ROS production and apoptosis in HUVECs in the ox-LDL-induced DVT model.

Fig. 5.

Phloretin with different concentrations alleviated the production of ROS and apoptosis cells in ox-LDL induced DVT model in HUVECs. a Flow cytometry (FCM) was used to test the ROS content of each group in HUVECs, n = 3 in each group; b FCM was used to test the apoptosis cells in each group in HUVECs, n = 3 in each group; c Surface plasmon resonance was used to test the affinity of phloretin and SIRT1 in HUVECs with different concentrations of phloretin; d K_D of the phloretin and SIRT1 in HUVECs, n = 3 in each group; ^◆p < 0.05, ^◆◆p < 0.01 vs. control group, ^●p < 0.05, ^●●p < 0.01 vs. ox-LDL group. Phl Phloretin

Inhibiting SIRT1 decreased the expression of SIRT1 and antioxidants- and increased fibrosis-, apoptosis-, and inflammation-related factors after phloretin treatment in an ox-LDL-induced DVT model in HUVECs

To further confirm the relationship between SIRT1 and phloretin in DVT, we silenced the expression of SIRT1 in ox-LDL-stimulated and phloretin-treated HUVECs. The qRT-PCR was used to test the relative expression of SIRT1 in ox-LDL stimulated cells (Figure S2). The results showed that si-SIRT1 group had lower SIRT1 expression than si-NC group (p < 0.01). In addition, the results showed that silencing SIRT1 abrogated the effect of phloretin on ox-LDL-induced HUVECs, increased MDA levels and reduced SOD levels during the oxidative stress response compared to those in the ox-LDL + Phl + siRNA-NC group (Fig. 6a, p < 0.01). As shown in Fig. 6b–e, the expression levels of Nrf2 and HO-1 were reduced, COL1A1 and TGF-β1 were increased, BAX and caspase-3 expression was increased, and BCL-2 expression was reduced in the SIRT1-silenced group than in the ox-LDL + Phl + siRNA-NC group. The expression of SIRT1 was decreased after silencing SIRT1, and there was an increase in p-p65/p65 and Ace-p65/p65 compared to that in the ox-LDL + Phl + siRNA-NC group (p < 0.05 or p < 0.01). These results indicated that inhibiting SIRT1 decreased the expression of SIRT1 and antioxidants- and increased fibrosis-, apoptosis-, and inflammation-related factors after phloretin treatment in the ox-LDL-induced DVT model in HUVECs.

Fig. 6.

The inhibition of SIRT1 alleviated the expression of the SIRT1, antioxidant-, increased fibrosis-, apoptosis-, and inflammatory-related factors after the treatment of phloretin in ox-LDL induced DVT model in HUVECs. a ELISA was used to test MDA and SOD levels in each group in HUVECs, n = 6 in each group; b, c Western blot was used to test Nrf2, HO-1, COL1A1, TGF-β1, and SIRT1 proteins in HUVECs, n = 3 in each group; d, e Western blot was used to test BAX, BCL-2, caspase-3, SIRT1, p-p65, p65, and Ace-p65 in HUVECs, n = 3 in each group, ^◆p < 0.05, ^◆◆p < 0.01 vs. control group. ^●p < 0.05, ^●●p < 0.01 vs. ox-LDL group, ^#p < 0.05, ^##p < 0.01 vs. ox-LDL + Phl + siRNA-NC group. Phl Phloretin

Inhibiting SIRT1 increased ROS production and apoptosis in HUVECs after treatment with phloretin in an ox-LDL-induced DVT model

After silencing SIRT1 in ox-LDL-HUVECs treated with phloretin, we measured ROS production. The results showed that ROS levels were increased compared to those in the ox-LDL + Phl + siRNA-NC group (Fig. 7a, p < 0.01). Furthermore, we analyzed apoptotic cells. The results showed that siRNA-SIRT1 plus phloretin increased the percentage of apoptotic ox-LDL-induced HUVECs (Fig. 7b, p < 0.01). These results indicated that inhibiting SIRT1 increased ROS production and apoptosis in HUVECs after treatment with phloretin in the ox-LDL-induced DVT model.

Fig. 7.

The inhibition of SIRT1 increased the production of ROS and apoptosis cells after the treatment of phloretin in ox-LDL induced DVT model in HUVECs. a FCM was used to test the ROS content of each group in HUVECs, n = 3 in each group; b FCM was used to test the apoptosis cells in each group in HUVECs, n = 3 in each group; ^◆p < 0.05, ^◆◆p < 0.01 vs. control group. ^●p < 0.05, ^●●p < 0.01 vs. ox-LDL group, ^#p < 0.05, ^##p < 0.01 vs. ox-LDL + Phl + siRNA-NC group. Phl Phloretin

Discussion

DVT accounts for approximately 10 million thromboses per year and is the third leading cardiovascular disease (CVD) after myocardial infarction and stroke [21]. The incidence of DVT increases with age, and its complications are the leading cause of death and poor quality of life in Western countries [22]. Numerous studies have shown that both thrombus formation and dissolution can be regulated by ROS during oxidative stress [23]. In addition, research has revealed that phloretin is a potent agent for preventing thrombosis and atherosclerosis [14]. In our previous study, we showed that the direct target of phloretin was SIRT1. Thus, in this study, we further explored whether phloretin targeted SIRT1 to alleviate oxidative stress, apoptosis, and inflammation in DVT.

Kim’s research revealed that phloretin disturbed the tethering and stable adhesion of monocytes and platelets to the endothelium during thrombosis induced by thrombin [14], indicating an inhibitory effect of phloretin on thrombosis. In the present study, we showed that phloretin reduced the weight of thrombi in rats with DVT, which was consistent with their findings. T-PA is a plasminogen activator, whereas PAI is an inhibitor of t-PA in the fibrinolytic system; t-PA and PAI are in arterial equilibrium under normal conditions [24]. Our study showed that after phloretin treatment, t-PA was enhanced, whereas PAI was suppressed. In addition, PT, TT, and APTT, which indicate blood coagulative function, were increased, while FIB was shortened, revealing that the blood was not in a hypercoagulable state and was less likely to form thrombi. In addition, pathological manifestations of the inferior vena tissues improved in rats with DVT that were treated with phloretin. Moreover, pretreatment with phloretin showed better protection than phloretin treatment after injury.

Excess ROS can oxidize cell membrane structures, nucleic acids and proteins, causing structural and functional disorders. Increased ROS leads to oxidative stress, which is involved in various pathological mechanisms [25]. Ying’s study demonstrated that phloretin prevented diabetic cardiomyopathy by dissociating the Keap1/Nrf2 complex and inhibiting oxidative stress, indicating that phloretin significantly inhibited the expression of proinflammatory, hypertrophy-related, pro-oxidant-related, and fibrotic cytokines [26]. Nrf2 and HO-1 protect numerous cell types, tissues, organs and systems from the pathogenic effects of oxidative stress [27–29]. COL1A1 is the major component of an atherosclerotic vessel that promotes the formation of DVT, and TGF-β1 is necessary for the upregulation of COL1A1 expression [30]. In our study, we found that after phloretin treatment, less ROS, MDA and fibrosis-related factors (COL1A1, TGF-β1) were produced. The expression levels of antioxidant factors (Nrf2, HO-1) and SOD were increased. In apoptotic cells, the expression of the apoptotic factor BCL-2 was increased, and BAX and caspase-3 were decreased. These results indicated that phloretin inhibited the oxidative stress response, protected HUVECs from apoptosis, and reduced thrombus formation. In addition, Cui’s study [31] revealed that phloretin could effectively attenuate uric acid-induced renal injury by inhibiting NLRP3 and inflammation. Hou et al. showed that knockdown of Nrf2 abolished the effects of the compounds on ox-LDL-induced increases in ROS and the translocation of NF-κB to the nucleus [32]. Consistent with their findings, in our study, we confirmed that the relative expression of p-p65/p65 and Ace-p65/p65 was inhibited after phloretin treatment, indicating that phloretin exerted an anti-inflammatory effect on DVT.

The ox-LDL has a strong cytotoxic effect, changing the functional state of endothelial cells, prompting monocytes and low-density lipoproteins to enter the subintima, and accelerating the formation of lipid streaks and atherosclerosis [33, 34]; thus, we used it to induce a DVT model in cells. It has been demonstrated that ox-LDL increases ROS generation in HUVECs, and these effects can be reversed by vaccarin pretreatment [35]. The results were consistent with the in vivo results. Phloretin inhibited the oxidative stress response and protected HUVECs from apoptosis. In addition, phloretin exerted anti-inflammatory effects, especially at a concentration of 20 μM.

An increasing number of studies have shown that phloretin exerts a protective effect against thrombosis-related diseases. Wang et al. reported that 20 mg/kg phloretin reduced intracellular ROS production and significantly reduced neointimal formation 14 days after carotid injury in rats [36]. Thus, phloretin may be used to treat atherosclerosis and restenosis after vascular injury. In addition, our previous study [10] confirmed that phloretin suppressed high glucose-induced cardiomyocyte injury by restoring SIRT1 expression, suggesting that SIRT1 might be a target of phloretin, which is regulated in DVT. Thus, we performed SPR experiments and showed that phloretin has a high affinity for SIRT1. In addition, in vivo and in vitro experiments demonstrated that phloretin upregulated the protein expression of SIRT1 compared to that in DVT. The present study showed that silencing SIRT1 abrogated the effect of phloretin on ox-LDL-HUVECs. These results indicate that phloretin targets SIRT1 to protect against DVT.

In this study, we found that phloretin could protect rats with DVT and an ox-LDL-induced DVT model in HUVECs from severe oxidative stress, fibrosis and inflammation. Pretreatment with phloretin protected rats with DVT better than treatment afer injury, which may be related to the upregulation of SIRT1 to inhibit oxidative stress, apoptosis, and inflammation. However, further studies are needed to examine whether SIRT1 is the only target of phloretin.

In summary, phloretin can exert a protective effect against thrombosis by reducing ROS production, oxidative stress, apoptosis and the inflammatory response in rats with DVT and an ox-LDL-induced DVT model in HUVECs, which may be related to the upregulation of SIRT1. This study provides a basis for further clinical and experimental research on phloretin treatment of DVT.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

APTT

Activated partial thromboplastin time

CVD

Cardiovascular disease

DHE

Dihydroethidium

DVT

Deep vein thrombosis

FIB

Fibrinogen

HUVECs

Human umbilical vein endothelial cells

IHC

Immunohistochemistry

MDA

Malonaldehyde

ox‑LDL

Oxidized low‑density lipoprotein

PAI

Plasminogen activator inhibitor

Phl

Phloretin

PT

Prothrombin time

qRT-PCR

Quantitative Real-time PCR

ROS

Reactive oxygen species

SIRT

Sirtuin

SOD

Superoxide dismutase

SPR

Surface plasmon resonance

t-PA

Plasminogen activator

TGF-β1

Transforming growth factor-β1

TT

Thrombin time

Author contributions

YY and XW contributed to the study conception and design. Material preparation, data collection and analysis were performed by XW, JY, XN, SH, MZ. The first draft of the manuscript was written by XW, JY and XN. YY revised the manuscript. All authors read and approved the final manuscript.

Funding

This work was supported by Zhejiang Provincial Natural Science Foundation of China (No. LGF21H020002), Chinese Medical and Health Research Project of Zhejiang Province (2021ZA038) and Chinese Medical and Health Research Project of Zhejiang Province (2022ZA039).

Data availability

Data will be made upon request.

Declarations

Conflict of interest

The authors have no relevant financial or non-financial interests to disclose.

Ethical approval

The animal research was ratified by the Ethics Committee of the Animal Center of Zhejiang Eyong Pharmaceutical Research and Development Center. Animal use license number: SYXK (Zhe) 2021-0033.