Complementation Analysis of the Dichelobacter nodosus fimN, fimO, and fimP Genes in Pseudomonas aeruginosa and Transcriptional Analysis of the fimNOP Gene Region

Abstract

The causative agent of ovine footrot, the gram-negative anaerobe Dichelobacter nodosus, produces polar type IV fimbriae, which are the major protective antigens. The D. nodosus genes fimN, fimO, and fimP are homologs of the Pseudomonas aeruginosa fimbrial assembly genes, pilB, pilC, and pilD, respectively. Both the pilD and fimP genes encode prepilin peptidases that are responsible for cleavage of the leader sequence from the immature fimbrial subunit. To investigate the functional similarity of the fimbrial biogenesis systems from these organisms, the D. nodosus genes were introduced into P. aeruginosa strains carrying mutations in the homologous genes. Analysis of the resultant derivatives showed that the fimP gene complemented a pilD mutant of P. aeruginosa for both fimbrial assembly and protein secretion. However, the fimN and fimO genes did not complement pilB or pilC mutants, respectively. These results suggest that although the PilD prepilin peptidase can be functionally replaced by the heterologous FimP protein, the function of the PilB and PilC proteins may require binding or catalytic domains specific for the P. aeruginosa fimbrial assembly system. The transcriptional organization and regulation of the fimNOP gene region were also examined. The results of reverse transcriptase PCR and primer extension analysis suggested that these genes form an operon transcribed from two ς⁷⁰-type promoters located upstream of ORFM, an open reading frame proximal to fimN. Transcription of the D. nodosus fimbrial subunit was found to increase in cells grown on solid media, and it was postulated that this regulatory effect may be of significance in the infected footrot lesion.

The anaerobic bacterium, Dichelobacter nodosus, is the causative agent of ovine footrot, a contagious disease leading to severe lameness and decreased wool quality (50). D. nodosus cells produce long, polar filaments, known as type IV fimbriae, which are the basis for the serological classification of this species (12). The fimbriae are the major immunoprotective antigens and appear to be required for virulence (15, 16). Polar type IV fimbriae are found in several other bacterial pathogens and are composed of a major fimbrial subunit protein which is synthesized with a short leader peptide that is cleaved prior to assembly. The hydrophobic N terminus of the mature fimbrial subunit is highly conserved between different species and has a methylated N-terminal amino acid residue, usually phenylalanine (7). In other bacteria, type IV fimbriae have been shown to be involved in cell adhesion (17, 45, 59, 60). These structures are also associated with a form of surface translocation known as twitching motility (20). This twitching motion may play a role in the virulence of D. nodosus by allowing movement of D. nodosus cells through the footrot lesion.

Recent studies have identified three clustered genes, fimN, fimO, and fimP, that appear to be involved in the biogenesis of D. nodosus fimbriae (25). These genes have similarity to the pilB, pilC, and pilD genes, respectively, which are required for the assembly of type IV fimbriae in Pseudomonas aeruginosa (35). The P. aeruginosa pilD gene encodes a bifunctional type IV prepilin peptidase that is responsible for processing the fimbrial subunit to its mature form prior to assembly (36, 52). The D. nodosus FimP protein has been shown to possess prepilin peptidase activity when it is expressed in Escherichia coli and is most likely the enzyme responsible for cleavage of the D. nodosus fimbrial subunit in vivo (25). PilD is also required for extracellular protein secretion. Several components of the two-step protein secretion apparatus, all of which have some sequence similarity to type IV prepilins, are processed by the PilD enzyme (2, 37, 38). The precise role of the P. aeruginosa PilB and PilC proteins in fimbrial assembly is unknown. However, both PilB and its D. nodosus homolog, FimN, contain ATP binding domains and are likely to have an energy-dependent function (25, 57).

Type IV fimbrial subunits from D. nodosus are assembled into fimbriae when they are expressed in P. aeruginosa (33), suggesting that these organisms have similar biogenesis systems. As there currently are no methods available by which DNA can be introduced into D. nodosus, the analysis of D. nodosus gene function must be performed in a heterologous host. To investigate the extent of the functional conservation between the fimbrial biogenesis systems of D. nodosus and P. aeruginosa, the D. nodosus fimN, fimO, and fimP genes were examined for their ability to complement the pilB, pilC, and pilD mutants of P. aeruginosa, respectively.

MATERIALS AND METHODS

Bacterial strains and plasmids.

All E. coli strains were grown in 2YT medium (34) with the antibiotic ampicillin (100 μg/ml), streptomycin (SM) (20 μg/ml), or tetracycline (10 μg/ml). Strain DH5α (Bethesda Research Laboratories) was used as the host for most recombinant plasmids, and derivatives of strain UB5201 (Nal^r met pro recA [47]) containing the conjugative plasmid pVS520 (39) were used as the conjugative donors. P. aeruginosa strains were derivatives of strain PAK (29, 51) and were grown in 2YT medium or on 2YT plates containing egg yolk or 2% (vol/vol) skim milk for the detection of phospholipase C or protease activities, respectively, with carbenicillin (250 μg/ml) and SM (50 μg/ml) when appropriate. D. nodosus strains were grown under anaerobic conditions (80% N₂–10% H₂–10% CO₂) on hoof agar (53) or Eugon agar (BBL) or in Eugonbroth with either 5% horse blood or 10% horse serum. The properties of all recombinant plasmids are described in Table 1.

TABLE 1.

Characteristics of recombinant plasmids

Plasmid	Characteristic(s)	Reference or source
pUC18	AprlacZ′ ColE1 ori	58
pBluescriptKS+	AprlacZ′ f1 ori ColE1 ori PT7 PT3	Stratagene
pGEM7Zf(−)	AprlacZ′ f1 ori ColE1 ori PT7 PSP6	Promega
pVS520	pUB1601 derivative, Tcr Tra+ Kms	39
pMMB67EH	RSF1010 derivative, AprlacIq Ptac	19
pMMB67HE	pMMB67EH with polylinker in opposite orientation	19
p19A	pTZ19R carrying pilBCD on a 4.0-kb XbaI fragment	D. Nunn, University of Washington
pUC19Ω	pUC19 carrying Ω on a 2.0-kb SmaI fragment	29
pJIR922	pBSKS carrying the fimNOP gene region on a 4.6-kb BamHI fragment	25
pJIR1003	pBSKS carrying part of fimN on a 2.3-kb EcoRI/BamHI fragment	Recombinant
pJIR1042	pMMB67EH carrying fimP on a 2.8-kb HpaI fragment	Recombinant
pJIR1053	pBSKS carrying fimO, fimP, and ORF197 on a 3.7-kb PstI fragment	Recombinant
pJIR1068	pMMB67EH carrying fimO on a 1.8-kb insert	Recombinant
pJIR1118	pMMB67HE carrying pilC on a 2.2-kb EcoRI/BamHI fragment	Recombinant
pJIR1168	pUC18 carrying fimN on a 3.2-kb insert	Recombinant
pJIR1204	pGEM7Zf carrying fimP on a 1.7-kb insert	25
pJIR1205	pMMB67EH carrying ΔfimP and ORF197 on a 1.9-kb insert	Recombinant
pJIR1251	pUC18 carrying fimN on a 1.8-kb insert	Recombinant
pJIR1262	pMMB67EH carrying pilB on a 2.0-kb insert	Recombinant
pJIR1263	pMMB67HE carrying Ω insertion mutant of fimP on a 3.7-kb insert	Recombinant
pJIR1332	pMMB67HE carrying fimN on a 1.8-kb insert	Recombinant
pJIR1401	pUC18 carrying pilBN fusion on a 2.0-kb insert	Recombinant
pJIR1405	pMMB67EH carrying pilB183-fimN fusion on a 2.0-kb insert	Recombinant
pJIR1406	pMMB67EH carrying fimN and fimO on a 3.6-kb insert	Recombinant

Conjugation and bacteriological methods.

All E. coli strains used for conjugation were grown in 10 ml of 2YT broth for approximately 4 h at 37°C. P. aeruginosa strains were grown overnight in 50 ml of 2YT broth at 43°C without shaking, to allow for the creation of a Res⁻ phenotype (44). Intergenic broth matings were performed by incubating an equal volume of donor (E. coli) and recipient (P. aeruginosa) cultures at 37°C without shaking for 30 min. The conjugation mixtures were then vortexed, serially diluted, and plated onto 2YT agar containing carbenicillin and SM. When both donor and recipient strains were Sm^r, the IncP pilus-specific bacteriophage PR4 (49) was incubated with the serially diluted conjugation mixture for 30 min at 37°C before plating, to contraselect against the donor strain. Phage PO4 was used for phage sensitivity assays on recombinant strains of P. aeruginosa PAK (1). Twitching motility was determined by the subsurface stab assay method (1).

Electron microscopy.

P. aeruginosa strains for examination by electron microscopy were grown overnight at 37°C on 2YT plates containing 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG), washed, and resuspended in phosphate-buffered saline. The cell samples were attached to carbon-coated copper-rhodium grids, negatively stained, and examined under a Joel JEM 100S electron microscope at 60 kV.

Cloning and sequencing methods.

Recombinant DNA methods used in this study were as previously described (46). Oligonucleotide primers were synthesized with an Applied Biosystems 392 DNA/RNA synthesizer. Sequencing reactions were performed with an Applied Biosystems 373A automated DNA sequencer with a PRISM Ready Reaction DyeDeoxy terminator cycle sequencing kit. Nucleotide sequence was compiled with the DNA sequence editor SeqEd version 1.00A (Applied Biosystems). All PCRs, except for splice-overlap-extension PCR (SOE-PCR), were carried out for 30 cycles consisting of 1 min of denaturation at 95°C, 1 min of annealing at 55°C, and 1 min of extension at 72°C, immediately followed by an additional cycle with a 5-min extension time. The ORFM sequence determined in this study has been added to the existing GenBank entry U17138.

Construction of the pilB183fimN fusion.

The first 183 codons of pilB were fused to codons 179 to 564 of fimN by SOE-PCR (23). The N-terminal region of pilB was amplified with universal primer (UP) and primer no. 3000, while the fimN region was amplified with oligonucleotides 2400 and 2999 (Table 2). The products of these reactions were separated by electrophoresis on a low-melting-temperature gel, excised from the gel, melted at 70°C, and mixed. SOE-PCRs were performed with primers 2400 and UP with 1/10 of the initial PCR products as the template. The reactions were carried out for 30 cycles of 2 min of denaturation at 93°C and a 2-min annealing period at 45°C, followed by 7 min of extension at 72°C.

TABLE 2.

Oligonucleotide primers

Oligonucleotide primer no.	Sequencea	Use
1445	GCAATAAAAAAGTTCAGG	RT-PCR
1451	GCGTTGCGATGCTTGGTGG	RT-PCR
1452	GATCGCCGCAGAAAATAGG	RT-PCR
1454	GGCTCGGCGGCATGGACG	RT-PCR
1456	CCGACGAAAAAAATACCC	RT-PCR
1472	GCGGGAACTAAACTGACG	RT-PCR
1480	GGTTATTTGGGATCGATGG	RT-PCR
1481	GCCATCGACTTCCGGGTG	RT-PCR
1531	GCTTTTCACGACTGATTTGG	RT-PCR
2400	CTCTTTTTGAATCTGCCATC	SOE-PCR
2460	TGTGTCATGGAAAAGTCTC	RT-PCR
2461	CCTGAACTTTTTTATTGCG	RT-PCR
2514	CAACCAAACAACGCCGCCT	RT-PCR
2999	GCAGACGACGCTCCGGTGGTGCGTTTTGTAACG	SOE-PCR
3000	ACGCACCACCGGAGCGTCGTCTGCCTCCGCGCC	SOE-PCR
3025	ACAACACCGTTTTACCCAC	Primer extension
UP	GTAAAACGACGGCCAGT	SOE-PCR

^aAll sequences are described in the 5′-to-3′ direction. 

RNA extraction and analysis.

P. aeruginosa strains were grown overnight at 37°C on 2YT agar containing 1 mM IPTG. RNA was isolated from D. nodosus strain A198 cells grown on either Eugon agar with 5% horse blood, Eugon agar with 10% horse serum, or hoof agar or in Eugonbroth with 10% horse serum. The D. nodosus cells grown on solid medium were resuspended in 2YT broth prior to RNA extraction. RNA was isolated with TRISOLV (Biotecx) according to the manufacturer’s instructions. DNA probes constructed for Northern hybridization experiments were amplified and labelled with digoxigenin-11-dUTP (Boehringer Mannheim) in a standard PCR. Northern hybridization and RNA dot blot analysis were performed at 65°C, and the membranes were washed at high stringency as described by the manufacturer. Primer extension experiments were performed on 50 μg of total RNA with the Promega primer extension system and protocol.

Reverse transcriptase PCR (RT-PCR).

Reverse transcription reactions were performed for 1 h at 42°C on 10 μg of total RNA with avian myeloblastosis virus RT (Promega) as described by the manufacturer. cDNA products were amplified by PCR with a one-to-five dilution of the reverse transcription reaction as the template and were then separated by electrophoresis on 0.8% agarose gels. The positions of the oligonucleotide primers used in the RT-PCR experiments are indicated in Fig. 1.

FIG. 1.

Genetic organization of the fimNOP gene region. Relevant plasmids are shown to scale. Products of RT-PCR experiments and their sizes are indicated above the map. The position of the Ω insertion in pJIR1263 is shown. The two promoters, P1 and P2, are indicated. Abbreviations: B, BamHI; C, ClaI; EV, EcoRV; H, HpaI; Hf, HinfI; H2, HindII; K, KpnI; N, NarI; Nd, NdeI; Nr, NruI; P, PstI; S, SalI; Sp, SphI.

RESULTS

The D. nodosus fimP gene complements a pilD mutant of P. aeruginosa.

The 3.0-kb HpaI fragment from pJIR922, which contained fimP, was cloned into the broad-host-range vector pMMB67EH so that fimP was under the transcriptional control of the tac promoter. The resultant plasmid, pJIR1042 (Fig. 1), and pMMB67EH were used to transform E. coli strain UB5201(pVS520). Intergenic matings were performed between these E. coli transformants and the P. aeruginosa pilD mutant, PAKDΩ. The resultant transconjugants, PAKDΩ(pJIR1042) and PAKDΩ(pMMB67EH), were examined for the presence of fimbriae by electron microscopy. Wild-type P. aeruginosa PAK cells produced fimbriae, but PAKDΩ(pMMB67EH) cells did not (Fig. 2). Fimbriae were also produced by PAKDΩ(pJIR1042) cells, which contained the D. nodosus fimP gene (Fig. 2C). These results showed that the fimP gene restored the production of fimbriae in the P. aeruginosa pilD mutant, indicating that FimP had a function similar to that of the PilD protein in fimbrial biogenesis and could recognize and process the P. aeruginosa prepilin subunit, PilA.

FIG. 2.

Complementation analysis of a P. aeruginosa pilD mutant. Electron micrographs (Magnification, ×27,900) of P. aeruginosa PAK (A), the P. aeruginosa pilD mutant PAKDΩ (29) (B), P. aeruginosa PAKDΩ(pJIR1042) (carries fimP) (C), and P. aeruginosa PAKDΩ(pJIR1263) (carries fimPΩ) (D).

To ensure that the fimP gene was responsible for this complementation, a fimP mutant was constructed by the deletion of an internal NruI fragment of pJIR1042 (Fig. 1). The resultant plasmid, pJIR1205, was introduced into PAKDΩ as before. Electron microscopic analysis of PAKDΩ(pJIR1205) revealed cells of an unusual phenotype which were very round and did not possess flagella (data not shown). In pJIR1205, an open reading frame, ORF197, is located downstream of the fimP deletion. Since in the absence of fimP, ORF197 appeared to have a deleterious effect on the cells, a fimP mutant which did not carry ORF197 was constructed. The fimP gene was insertionally inactivated by cloning a 2.0-kb SmaI fragment containing the Ω cassette from pUC19Ω into the single HindII site of pJIR1204, which contained a 1.7-kb HpaI/ClaI pJIR922-derived fragment that had only fimP (Fig. 1). The insert from this recombinant plasmid was subsequently cloned into pMMB67HE to create pJIR1263 (Fig. 1) and introduced into PAKDΩ by conjugation. The resultant strain, PAKDΩ(pJIR1263), did not produce fimbriae (Fig. 2D) and had a normal cellular morphology, providing confirmation that pilD complementation was fimP dependent.

Both the wild-type and mutant fimP derivatives were tested for their ability to restore twitching motility to the pilD mutant. Strains PAK, PAKDΩ(pJIR1042), PAKDΩ(pJIR1263), and PAKDΩ(pMMB67EH) were assayed for their twitching motility on 1% agar. Both the wild-type strain PAK and strain PAKDΩ(pJIR1042) exhibited twitching motility. However, neither PAKDΩ(pJIR1263) nor PAKDΩ(pMMB67EH) had the typical growth zone that is indicative of twitching motility in this assay (data not shown). On the basis of these data, it was concluded that the D. nodosus fimP gene also restored twitching motility to the P. aeruginosa pilD mutant.

To determine whether fimP could complement the pilD mutant for protein secretion, the same series of strains was subcultured onto 2YT plates containing egg yolk and skim milk to test for the secretion of phospholipase C and proteases, respectively. Phospholipase C activity was apparent as an opaque zone beneath the PAK and PAKDΩ(pJIR1042) cells (data not shown). These strains also displayed a clear zone on skim milk agar, indicative of protease activity. No phospholipase C or protease activity was detected from strains PAKDΩ(pMMB67EH) or PAKDΩ(pJIR1263), which contained either the vector plasmid or the mutated copy of fimP, respectively. These results showed that the D. nodosus fimP gene also complemented the pilD protein secretion phenotype.

Complementation analysis of fimO.

To determine whether the D. nodosus fimO gene could complement a pilC mutant of P. aeruginosa, the 3.7-kb PstI fragment from pJIR922 was cloned into pBSKS(−) to construct pJIR1053. Since this plasmid also carried a complete copy of fimP and ORF197, a NsiI deletion derivative was made in which these genes were effectively removed. The insert from the resultant plasmid then was cloned into pMMB67EH to create pJIR1068 (Fig. 1). In this plasmid, fimO expression should be dependent upon the IPTG-inducible tac promoter. The plasmid pJIR1068 was transferred by conjugation into the P. aeruginosa pilC mutant, PAKCΩ. Analysis of the resultant strain, PAKCΩ(pJIR1068), and a control strain, PAKCΩ(pMMB67EH), grown in the presence of IPTG, showed that neither plasmid could restore the production of fimbriae or the twitching motility phenotype to the P. aeruginosa pilC mutant. These strains were also resistant to the fimbria-specific phage, PO4. RNA extracted from strain PAKCΩ(pJIR1068) produced the expected product from RT-PCR with oligonucleotide primers specific for the fimO gene, which indicated that fimO was expressed in P. aeruginosa (Fig. 3). To ensure that the pilC mutation in PAKCΩ could be complemented, pJIR1118, a pMMB67HE derivative that had the 2.2-kb EcoRI/BamHI fragment from p19A which carried the P. aeruginosa pilC gene, was introduced into PAKCΩ. Strain PAKCΩ(pJIR1118) produced normal fimbriae, confirming that the pilC mutant had an otherwise wild-type background.

FIG. 3.

RT-PCR analysis of fimN and fimO transcripts from P. aeruginosa. RT-PCR was performed on RNA extracted from PAKBΩ(pJIR1332) (lanes 1 and 2) and PAKCΩ(pJIR1068) (lanes 4 and 5) cells grown overnight on 2YT agar containing 1 mM IPTG. The resultant samples were analyzed by agarose gel electrophoresis. Lanes 1 and 4 contain the products of the RT-PCRs. Lanes 2 and 5 contain control reactions performed in an identical manner except that no RT was added. Lanes 3 and 6 contain positive controls, the products of PCRs performed with the respective plasmid templates. The standards (S) consist of HindIII-digested λcI857 DNA (measured in kilobases).

Complementation analysis of fimN.

The 0.9-kb BamHI/SalI fragment from pJIR922 and the 2.3-kb BamHI/EcoRI fragment from pJIR1003 were cloned into pUC18 to create pJIR1168, which contains an intact copy of the fimN gene (Fig. 1). To eliminate the region upstream of fimN, the 1.8-kb HinfI fragment from this construct was cloned into pMMB67HE to give pJIR1332 (Fig. 1), a plasmid in which fimN was transcribed from the tac promoter. The resultant plasmid and the vector control were then mobilized into the P. aeruginosa pilB mutant, PAKBΩ. Neither PAKBΩ(pJIR1332) nor PAKBΩ(pMMB67EH) displayed twitching motility on 1% agar or was observed to produce fimbriae under the electron microscope. These strains were also resistant to infection by phage PO4. To ensure that the PAKBΩ strain did not contain any additional mutations that affected fimbrial biogenesis, a 2.0-kb EcoRI/NarI p19A-derived fragment which contained pilB was cloned into pMMB67EH to construct pJIR1262. As expected, pJIR1262 restored the ability of the P. aeruginosa pilB mutant to produce fimbriae. The results of RT-PCR experiments, which showed that the fimN gene was transcribed in P. aeruginosa (Fig. 3), suggested that fimN was unable to complement the pilB mutation.

Alignment of the FimN and PilB proteins (25) indicated that the N-terminal 183 residues were less well conserved than the remainder of the protein. Therefore, it was postulated that this region may include species-specific domains necessary for binding and interaction with other pilus biogenesis proteins. If so, a fusion between the first 183 amino acids (aa) of PilB and aa 183 to 564 of FimN would result in a fusion protein (designated PilB183FimN) that contains the Pseudomonas-derived domains required for functional interaction with the other P. aeruginosa fimbrial assembly proteins and therefore may complement the pilB mutant. A pilB183-fimN gene fusion was constructed by SOE-PCR, and the resultant 2.0-kb product was cloned into pUC18 to produce pJIR1401, which was sequenced to ensure that there were no errors introduced by PCR. When the pMMB67EH derivative of this plasmid, pJIR1405, was introduced into PAKBΩ, the resultant strain was devoid of fimbriae and resistant to phage PO4 and did not show twitching motility. Transcription of the pilB183-fimN gene was confirmed by RT-PCR (data not shown). It was concluded that aa 1 to 183 of PilB did not provide the domains required to enable FimN to complement the pilB mutation.

It has been suggested that the PilB homologs, PulE and XcpR, may interact with the PilC homologs, PulF and XcpS, respectively, to form an active complex which is anchored to the cytoplasmic membrane through the PilC-like protein (41, 55). FimN and FimO may interact in a similar manner. The lack of complementation of PAKBΩ and PAKCΩ by fimN and fimO, respectively, may have resulted from the inability of PilB and FimO or PilC and FimN to form an active complex. To test this possibility, the fimN⁺ insert from pJIR1251 was cloned into the SmaI site of pJIR1068, upstream of the fimO gene. The recombinant pJIR1406 was introduced into PAKBΩ and PAKCΩ, and the derivatives were examined by electron microscopy for the presence of fimbriae. No fimbriae were detected on either of the resultant strains, PAKBΩ(pJIR1406) and PAKCΩ(pJIR1406); again, both fimN and fimO were shown to be expressed in these strains by RT-PCR. The strains also were resistant to the bacteriophage PO4. These results suggest that even if a FimN-FimO complex is formed, it cannot interact with the remainder of the P. aeruginosa secretion apparatus.

Expression of the fim genes in D. nodosus.

The D. nodosus fimN, fimO, and fimP genes appear to be arranged in an operon along with ORFM and ORF197 (Fig. 1). To investigate this possibility, RNA was extracted from D. nodosus strain A198 and used in Northern hybridization experiments. Discrete mRNA bands could not be detected with separate probes specific for each of these open reading frames, presumably due to the inherent instability of the transcript(s). However, an mRNA molecule specific for the D. nodosus fimA gene, which encodes the fimbrial subunit, was detected in each experiment. RT-PCR subsequently was used to detect transcriptional coupling between the fim genes. Separate primer pairs were used to amplify RT products from the intergenic regions of ORFM and fimN, fimN and fimO, fimO and fimP, and fimP and ORF197, respectively (Fig. 1). Two primer sets were used for each intergenic region. No products were produced from control reactions performed in the absence of RT, demonstrating the specificity of the assay for mRNA molecules. The results demonstrated transcriptional coupling between each of the gene pairs, since the predicted products were obtained from the intergenic regions in each experiment (data not shown). All of the open reading frames in this gene region are overlapping, except for the fimN and fimO genes, which are separated by 19 bp. On the basis of this arrangement, and on the basis of the RT-PCR results, it was concluded that ORFM, fimN, fimO, fimP, and ORF197 were arranged in an operon.

Based on the conclusion that the fim genes were transcriptionally coupled to ORFM, the 5′ coding region and upstream region of ORFM were sequenced. ORFM was found to encode (Fig. 4) a 199-aa protein with 59 to 62% amino acid sequence identity to the PabA proteins of E. coli, Salmonella typhimurium, Klebsiella aerogenes, and Serratia marcescens (26, 27), and the TrpG proteins of P. aeruginosa and Pseudomonas putida (13, 14). These proteins are glutamine amidotransferases which form part of the two component enzymes, para-aminobenzoate synthase and anthranilate synthase. Since these enzymes are involved in the folate and tryptophan pathways (5), respectively, it was concluded that ORFM was a housekeeping gene that was unlikely to be involved in fimbrial biogenesis in D. nodosus. The putative ORFM GTG initiation codon was identified on the basis of amino acid sequence similarity with other glutamine amidotransferase subunits. A potential ribosome binding site (RBS) was present 8 bp upstream of this codon (Fig. 4).

FIG. 4.

Nucleotide sequence of the upstream region of ORFM. Putative RBSs are marked by a line above the sequence. Nucleotides corresponding to the transcription start sites mapped by primer extension are indicated by asterisks. The two promoters, P1 and P2, are boxed. An incomplete inverted repeat sequence is indicated by arrows below the sequence. Numbers to the right of the sequence refer to the number of nucleotides or amino acid residues, respectively.

To identify the D. nodosus promoter(s) responsible for the expression of the fim operon, primer extension experiments were performed. An oligonucleotide primer, complementary to the region overlapping the predicted ORFM GTG start codon, was used to synthesize cDNA products from the RNA preparations. Two transcriptional start sites were identified (Fig. 4). A −10 region, with 5 of 6 bases identical to the ς⁷⁰ consensus sequence, was present 10 bp upstream of the beginning of the first transcript. A −35 region, with three of six conserved bases, was identified 17 bp upstream of the −10 sequence. This putative promoter was designated P1 (Fig. 4). The second start site mapped around 12 bp from a potential ς⁷⁰ promoter (P2) with a −10 region containing five of six conserved bases (Fig. 4). The putative −10 sequence of this promoter (TAGAAT) overlapped the −35 region of P1. An imperfect inverted repeat sequence which overlapped the putative ORFM RBS was also identified in the upstream region. The relative stability of the potential hairpin structure predicted to form from the inverted repeat sequence upstream of ORFM was estimated to be −52 kJ/mol (54).

Primer extension experiments also were performed on D. nodosus RNA with primers complementary to the N-terminal-encoding regions of fimN, fimO, and fimP, respectively. However, no cDNA transcripts were detected. These results provide evidence that transcription of the fim operon occurs from two ς⁷⁰-type promoters located upstream of ORFM. Although no transcripts could be mapped to the upstream regions of the other genes, it is possible that minor promoters are present in these regions.

Differential expression of fim genes in D. nodosus.

D. nodosus cells produce fewer fimbriae when they are grown in liquid media than when they are grown on solid agar surfaces (32). To determine whether this effect was due to differential transcription of the fimbrial subunit gene, fimA, or the fim operon, dot blots were performed on RNA extracted from D. nodosus cells grown for ∼84 h in Eugonbroth or on Eugon agar, each of which contained 10% horse serum. The RNA samples were probed with digoxigenin-labelled DNA fragments specific for either fimN or fimA or with the D. nodosus 16S rRNA genes as a control. The respective amounts of fimN mRNA and 16S rRNA produced were approximately the same in D. nodosus cells grown in broth and those grown on agar (Fig. 5). By contrast, the fimA-specific transcripts were much more abundant from cells grown on solid media (Fig. 5). These results suggest that the rate-limiting step in fimbrial biogenesis in D. nodosus is the expression of the fimbrial subunit gene, fimA.

FIG. 5.

RNA dot blot hybridization analysis of fimN and fimA transcripts from D. nodosus. Cells were grown on Eugon agar (a) or in Eugonbroth with 10% horse serum (b). RNA concentrations (in micrograms per milliliter) are indicated. A 16S rRNA probe was included as a control.

DISCUSSION

The FimP protein from D. nodosus has sequence similarity to the PilD prepilin peptidase from P. aeruginosa and in E. coli has the ability to cleave the leader sequence from the D. nodosus FimA fimbrial subunit (25). We now have shown that the fimP gene can complement a pilD mutant of P. aeruginosa, restoring its ability to produce type IV fimbriae. These results clearly indicate that the FimP and PilD prepilin peptidases are functionally equivalent.

Processing of heterologous prepilins has been reported for type IV prepilin peptidases from P. aeruginosa, P. putida, Aeromonas hydrophila, and enteropathogenic E. coli (6, 8, 36, 40, 61) as well as for their homologs from the secretion systems of Xanthomonas campestris, Klebsiella pneumoniae, and Bacillus subtilis (10, 11, 24). PilD from P. aeruginosa and its A. hydrophila homolog, TapD, have been shown to possess N-methyltransferase activity as well as prepilin peptidase activity (38, 40, 52). Pilin mutants of P. aeruginosa with reduced N-methyltransferase activity but normal peptidase activity cannot assemble intact pili, suggesting that the methylation of pilin subunits is required for fimbrial biogenesis (31). These data imply that FimP also has N-methyltransferase activity, since the introduction of fimP completely restored fimbrial morphogenesis to the pilD mutant.

PilD and TapD are required for the secretion of several extracellular proteins in P. aeruginosa (2, 37, 38) and A. hydrophila (40), respectively, and the product of the X. campestris xpsO gene also complements pilD for protein secretion (24). We have shown that the D. nodosus fimP gene restores the ability to secrete extracellular proteins to the P. aeruginosa pilD mutant, indicating that FimP also processes components of the P. aeruginosa protein export apparatus. D. nodosus secretes several extracellular proteases which have been implicated in the virulence of the organism (for a review, see reference 3). It is possible that FimP is involved in the secretion of some or all of these proteases. However, it should be noted that the type IV prepilin peptidases of Vibrio cholerae and P. putida do not appear to function in protein export (9, 28).

Both the D. nodosus fimN and fimO genes were unable to complement pilB and pilC mutants of P. aeruginosa, respectively. Even though they were shown to be transcribed in P. aeruginosa, the transcripts may not yield sufficient protein to enable complementation. However, homologs of PilB and PilC do not always function in heterologous hosts (9, 48), although there are some exceptions (30). To our knowledge, the only report of functional complementation by pilB- or pilC-like genes in a fimbrial biogenesis system involves complementation of P. aeruginosa pilB and pilC mutants by the respective tapB and tapC genes from A. hydrophila, although tapB only partially complements pilB (40). TapB and TapC are more closely related to PilB and PilC than the FimN and FimO proteins. It is likely that FimN and FimO perform an analogous function in the pilus morphogenesis system of D. nodosus but do not complement the relevant mutants because they are not able to interact with the fimbrial assembly machinery of P. aeruginosa.

The functional conservation observed with the fimbrial subunits and prepilin peptidases from different bacterial species does not seem to extend to other fimbrial biogenesis proteins. Presumably, this is because of the need for fimbrial biogenesis proteins to interact with each other and the secretion complex as a whole, as well as with the fimbrial subunit. The D. nodosus FimN and FimO domains involved in such protein-protein interactions may be incompatible with those of P. aeruginosa. However, the D. nodosus fimbrial subunit, FimA, has a highly conserved N-terminal domain which is probably involved in such interactions (12, 18) and can subsequently be assembled by the P. aeruginosa biogenesis machinery (33). It is likely that the P. aeruginosa PilD protein acts autonomously on the fimbrial subunit from within the membrane, since PilD-catalyzed processing of pilin to its mature form can be observed in E. coli (36). The D. nodosus fimP gene was able to complement a pilD mutant of P. aeruginosa for protein secretion and fimbrial assembly, presumably because FimP was required to interact only with the P. aeruginosa PilA fimbrial subunit protein and other subunit-like secretion proteins, not with the other components of the fimbrial assembly or protein secretion apparatus.

It has been suggested that PilB homologs may interact with the cytoplasmic PilC homologs, enabling them to associate with the inner membrane and linking them with the remainder of the protein secretion or fimbrial biogenesis apparatus (41, 55). It is possible that FimN and FimO also form such a complex, although the introduction of a plasmid carrying both fimN and fimO into the P. aeruginosa mutant strains, PAKBΩ and PAKCΩ, failed to complement either mutation. These results suggest that the putative FimN-FimO complex cannot interact with the remainder of the P. aeruginosa biogenesis apparatus.

In an attempt to identify the region of PilB involved in interactions with the fimbrial assembly apparatus, a hybrid PilB183FimN protein was constructed, but the resultant fusion protein could not complement the P. aeruginosa pilB mutant. Since FimN appears to contain the known catalytic domains present in PilB homologs, such as Walker box A and the Asp boxes (25, 42, 57), it is concluded that either aa 1 to 183 of PilB are not sufficient for interaction with the fimbrial secretion apparatus or the conformation of the PilB183FimN fusion is such that the fusion protein is not functional. Functional fusion proteins have been constructed from the V. cholerae EpsE protein and its homolog from A. hydrophila (48) and from the P. aeruginosa and P. putida XcpR proteins (9).

The arrangement of the fimN, fimO, and fimP genes in D. nodosus closely resembles the arrangement of the pilB, pilC, and pilD genes in P. aeruginosa (25). The P. aeruginosa genes appear to be transcribed from their own promoters, although pilD may also be cotranscribed with pilC (29). However, in D. nodosus, we have now shown that the fimN, fimO, and fimP genes comprise an operon which includes ORFM and ORF197. It is possible that these genes are expressed on more than one transcript, although no evidence for minor promoters was obtained. Two overlapping ς⁷⁰ promoters, identified upstream of the predicted coding region for ORFM, were shown to be active in D. nodosus. In addition, an imperfect inverted repeat was identified overlapping the putative ORFM RBS. Although a similar inverted repeat is involved in the regulation of the E. coli pabA gene (56), the functional significance of the D. nodosus repeat is not known.

The analysis of RNA dot blots showed that in D. nodosus, fimA transcription was several orders of magnitude higher from cells grown on solid medium. It is concluded that the production of fimbrial subunits is regulated at the transcriptional level, fimA expression being either activated by growth on solid medium or repressed in broth. The fimA gene is expressed from two ς⁵⁴ promoters located upstream of the coding region (22). The P. aeruginosa pilA gene is expressed from an rpoN-dependent promoter that is regulated by a two-component signal transduction system involving the sensor-kinase PilS and the response regulator, PilR (4, 21). It is postulated that a similar system exists in D. nodosus, whereby a PilR-like protein activates fimA transcription following the detection of a solid growth surface by a sensory protein similar to PilS. Increased temperature and high calcium concentrations activate the production of the bundle-forming pilus of enteropathogenic E. coli by controlling the expression of the fimbrial subunit gene, bfpA; these conditions are thought to exist in the small intestine, where the fimbriae are required for microcolony formation (43). By analogy, D. nodosus cells in contact with the surface of the sheep’s hoof may be induced to increase the transcription of fimA. An increase in the level of expression of fimA would be expected to result in the assembly of larger numbers of fimbriae, provided that the biogenesis machinery is not overloaded. D. nodosus cells producing larger numbers of fimbriae in vivo may move more readily across the surface of the hoof, owing to their twitching motility, potentially facilitating the spread of the infection.