Abstract
A family of genes, called ariel, are named for and encode asparagine-rich Entamoeba histolytica antigens containing 2 to 16 octapeptide repeats. Ariel proteins, which are constitutively expressed by trophozoites, belong to a large antigen family that includes the serine-rich E. histolytica protein (SREHP), an amebic vaccine candidate.
Entamoeba histolytica is a protozoan parasite that causes tens of millions of cases of amebic colitis and liver abscess each year in the developing world (21). With the goal of preventing amebic infection, human antiamebic sera have been used to identify vaccine candidates on the parasite surface. One such candidate is the serine-rich E. histolytica protein (SREHP), also known as the K2 protein, which is located on the parasite surface and is composed of an amino-terminal leader sequence and a hydrophobic carboxy-terminal anchor surrounding a series of tetrapeptide and octapeptide repeats (12, 25). SREHP repeats, which are recognized by most human antiamebic sera, are composed of hydrophilic and acidic amino acids (20). SREHP repeats immunize gerbils and SCID mice against liver challenge with E. histolytica trophozoites, while SREHP gene polymorphisms may be used to distinguish axenic strains and clinical isolates of E. histolytica (4, 22, 30).
The E. histolytica chitinase, encoded by a single-copy chit gene, contains a series of degenerate heptapeptide repeats (D/E-I/S/T/V-K-H/P-D/E-S-S) which are located between an amino-terminal signal sequence and a carboxy-half catalytic domain (6). Although the amino acid composition of the chitinase repeats is almost identical to that of the SREHP repeats, the amino acid sequence and codon usage of the chitinase repeats are different from those of SREHP, indicating their independent genetic origin. The amebic chitinase genes are polymorphic from one clinical isolate to the next, making chit genes (in conjunction with srehp genes) useful for molecular epidemiological studies (22).
To discover another single-copy, polymorphic repeat gene from E. histolytica, the coding region of the SREHP gene was used to identify a gray (weakly hybridizing) plaque in an E. histolytica HM-1 genomic DNA (gDNA) library (13, 25). The plaque encoded a novel repeat protein which was called Ariel, for asparagine-rich E. histolytica protein (Fig. 1). Four more unique ariel genes were amplified from E. histolytica gDNA by using PCR with sense (GAGTCTATTCATGAAAAT) and antisense (CCACAATAATAGCAAAGAGAA) primers flanking the repeats in the ariel gDNA library clone (14). Three unique ariel genes and one ariel gene matching a PCR product were found by screening an E. histolytica cDNA library and by using 5′ and 3′ rapid amplification of cDNA ends (RACE) with the same antisense and sense ariel primers, respectively (8). The longest ariel gene, which encodes a 23-kDa protein with 16 octapeptide repeats, was labeled ariel-1, while the shortest, which encodes an 11-kDa protein with 2 octapeptide repeats, was labeled ariel-8.
FIG. 1.
Alignment of amino acids, in single letter code, of eight predicted E. histolytica Ariel proteins (Ariel-1 to Ariel-8) with those of SREHP and SREDP. Because the Ariel proteins differ only in the number and sequence of the octapeptide repeats (shaded boxes), single amino- and carboxy-terminal Ariel sequences are shown. Sequences identical to Ariel-1 are marked with dashes, gaps are marked with dots, and COOH-terminal stop codons are marked with asterisks. Arrows indicate the locations of primers used for PCR and RACE. Tetrapeptide and octapeptide repeats of SREHP and SREDP are marked with unshaded boxes. Ariel-1, Ariel-2, Ariel-4, and Ariel-5 are derived from a cDNA library or RACE, while Ariel-2, Ariel-3, Ariel-6, Ariel-7, and Ariel-8 are derived from a gDNA library or PCR products.
Multicopy ariel genes are genetically related to the srehp gene.
Eight ariel genes encode predicted proteins identical over the first 58 amino acids (aa) at the amino termini and the last 29 aa at the carboxy termini, which show 55% and 76% positional identities, respectively, with those of SREHP (Fig. 1) (25). The ariel genes, then, belong to the same family of genes as srehp and sredp, which encodes the serine-rich protein of Entamoeba dispar (formerly known as nonpathogenic E. histolytica) (7, 12). Conserved in the amino termini of the Ariel proteins and SREHP are a putative signal sequence and a series of charged amino acids prior to the repeats (Fig. 1) (29). Conserved at the carboxy termini of the Ariel proteins and SREHP are putative hydrophobic anchors (11, 25). However, it is possible that Ariel proteins are anchored by glycophosphoinositol, as is the P. falciparum circumsporozoite protein (CSP), a vaccine candidate with a hydrophobic carboxy terminus similar to those of Ariel and SREHP (17, 24, 25). Whether Ariel proteins, like SREHP, are phosphorylated and acetylated and have O-linked terminal N-acetylglucosamine residues also remains to be determined (26).
The hydrophilic and acidic octapeptide repeats of the Ariel proteins resemble those of SREHP in amino acid composition, sequence, and codon usage (Fig. 1 and data not shown) (12, 25). However, the asparagine residues frequent in Ariel repeats are absent in SREHP repeats, and the tetrapeptide repeats present in SREHP are absent in the Ariel proteins. The Ariel octapeptide repeats (D/N/S-E-S-S-D/N-N-K-P) are identical in four or five positions to those of SREHP (E-A-S-S-S/T-D/N-K-P), while the last 4 amino acids of the Ariel octapeptide repeats are identical in three or four positions to the SREHP tetrapeptide (D-N-K-P). The same D-N-K-P tetrapeptide is tandemly repeated in protein A of Staphylococcus aureus (28). These results suggest that the Ariel repeats may contain some antigens in common with and some distinct from those of SREHP.
Constitutive expression of ariel genes.
Four ariel genes are expressed by cultured trophozoites, because their cDNAs were obtained from the cDNA library or by RACE (8). Multiple ariel genes were expressed simultaneously by trophozoites cloned on soft agar, including ariel-1 (major 440-bp product) and numerous smaller (faint) ariel genes (Fig. 2) (19). Because ariel reverse transcription (RT)-PCR products from each amebic clone look similar, it appears that the ariel genes are constitutively rather than variantly expressed.
FIG. 2.
RT-PCR products from mRNAs extracted from E. histolytica parasites cloned on soft agar with sense and antisense ariel primers (20). Lanes M, 100-bp ladders; lanes 1 to 5, different clones; lane 6, uncloned parent strain; lane 7, gDNA PCR product from the uncloned strain. Controls with a single sense or antisense ariel primer did not produce RT-PCR products (data not shown). The prominent 440-bp band corresponds to the ariel-1 gene, while lighter bands at lower molecular weights include those predicted by other ariel gene clones. Control RT-PCR with srehp, chit, and amebapore primers each produced a single product (data not shown) (6, 15, 25).
Antigenicity of Ariel repeats.
A prediction of the Hopp and Woods plot is that the hydrophilic repeats of the Ariel proteins are immunogenic, as has been shown for SREHP (11, 20, 25, 30). Pooled sera from patients with amebic liver abscesses reacted on Western blots with the Ariel repeats expressed as a glutathione S-transferase (GST) fusion protein (Fig. 3) (10, 23). Although it is possible that the human antibodies were raised against another amebic immunogen such as SREHP, it appears that the Ariel repeats are antigenic. Antiamebic human sera also recognized GST fusion proteins containing E. histolytica chitinase repeats (weakly) or alcohol dehydrogenase 1 at the carboxy termini but did not react with GST alone (6, 13). Whether an E. histolytica Ariel protein, like SREHP, may be useful as a serodiagnostic reagent for amebic infection or as a component of an antiamebic vaccine remains to be determined (11, 20, 25, 30). Whether antiamebic sera recognize antigens with few repeats (e.g., Ariel-8) also remains to be determined.
FIG. 3.
Western blot of recombinant GST-Ariel with human antiamebic sera. Pooled human antiamebic sera reacted strongly with GST-Ariel repeats (Ar) and GST-E. histolytica ADH1 (Al), weakly with GST-E. histolytica chitinase repeats (Ch), and not at all with control GST (Co). Lane M, protein standards.
New conclusions about antigenic diversity in E. histolytica.
(i) The same ancestral gene may lead to two different repeat antigens (Ariel and SREHP) with common amino and carboxy termini surrounding distinctive repeats. This is similar to what has been described for merozoite surface protein 1 (MSP-1) and S-antigen of Plasmodium falciparum (1, 2, 16).
(ii) Amebic repeat antigens may be encoded by multiple ariel genes, making these genes useless for molecular epidemiological studies. In contrast, polymorphic chit and srehp genes are present in one or two copies and so are useful for epidemiology (4, 6, 12, 22, 25). Single-copy polymorphic repeat genes of P. falciparum, useful for epidemiological studies, encode MSP-1, MSP-2, S-antigens, and CSP (1, 2, 5, 9, 16).
(iii) At least four ariel genes are constitutively expressed, so antigenic diversity may exist within a single parasite isolate rather than between separate parasite isolates (as is the case for SREHP and amebic chitinase) (4, 22). It is unclear whether amebae have any variably expressed antigens, such as the var proteins of P. falciparum, the variable surface proteins of Giardia lamblia, and the variable surface glycoproteins of Trypanosoma brucei (3, 18, 27).
Acknowledgments
This work was supported in part by a grant from the NIH.
Thanks to Sam Stanley and colleagues at Washington University for extensive characterization of SREHP and to Egbert Tannich of the Nocht Institute in Hamburg for the E. histolytica cDNA library.
REFERENCES
- 1.Anders R F, McColl D J, Coppel R L. Molecular variation in Plasmodium falciparum: polymorphic antigens of asexual erythrocyte stages. Acta Tropica. 1993;53:239–253. doi: 10.1016/0001-706x(93)90032-7. [DOI] [PubMed] [Google Scholar]
- 2.Bickel Q, Anders R F, Day K, Coppel R L. The S-antigen of Plasmodium falciparum: repertoire and origin of diversity. Mol Biochem Parasitol. 1993;61:189–196. doi: 10.1016/0166-6851(93)90065-6. [DOI] [PubMed] [Google Scholar]
- 3.Borst P. Discontinuous transcription and antigenic variation in trypanosomes. Annu Rev Biochem. 1986;55:701–732. doi: 10.1146/annurev.bi.55.070186.003413. [DOI] [PubMed] [Google Scholar]
- 4.Clark C G, Diamond L S. Entamoeba histolytica: a method for isolate identification. Exp Parasitol. 1993;77:450–455. doi: 10.1006/expr.1993.1105. [DOI] [PubMed] [Google Scholar]
- 5.De la Cruz V F, Lal A A, McCutchan T F. Sequence variation in putative functional domains of the circumsporozoite protein of Plasmodium falciparum: implications for vaccine development. J Biol Chem. 1987;262:11935–11939. [PubMed] [Google Scholar]
- 6.de la Vega H, Specht C A, Semino C E, Robbins P W, Eichinger D, Caplivski D, Ghosh S, Samuelson J. Cloning and expression of chitinases of Entamoebae. Mol Biochem Parasitol. 1997;85:139–147. doi: 10.1016/s0166-6851(96)02817-4. [DOI] [PubMed] [Google Scholar]
- 7.Diamond L S, Clark C G. A redescription of Entamoeba histolytica Schaudinn, 1903 (emended Walker, 1911) separating it from Entamoeba dispar Brumpt, 1925. J Eukaryot Microbiol. 1993;40:340–344. doi: 10.1111/j.1550-7408.1993.tb04926.x. [DOI] [PubMed] [Google Scholar]
- 8.Frohman M A, Dush M K, Martin G R. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci USA. 1988;85:8998–9002. doi: 10.1073/pnas.85.23.8998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gupta S, Treenholme K, Anderson R M, Day K P. Antigenic diversity and the transmission dynamics of Plasmodium falciparum. Science. 1994;263:961–963. doi: 10.1126/science.8310293. [DOI] [PubMed] [Google Scholar]
- 10.Harlow E, Lane D. Antibodies: a laboratory manual. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1988. [Google Scholar]
- 11.Hopp T P, Woods K R. Prediction of protein antigenic determinants from amino acid sequences. Proc Natl Acad Sci USA. 1981;78:3824–3828. doi: 10.1073/pnas.78.6.3824. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kohler S, Tannich E. A family of transcripts (K2) of Entamoeba histolytica contains polymorphic repetitive regions with highly conserved elements. Mol Biochem Parasitol. 1993;59:49–58. doi: 10.1016/0166-6851(93)90006-j. [DOI] [PubMed] [Google Scholar]
- 13.Kumar A, Shen P-S, Descoteaux S, Pohl J, Bailey G, Samuelson J. Cloning and expression of an NADP+-dependent alcohol dehydrogenase gene of Entamoeba histolytica. Proc Natl Acad Sci USA. 1992;89:10188–10192. doi: 10.1073/pnas.89.21.10188. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Lee C C, Wu X, Gibbs R A, Cook R G, Muzny D M, Caskey C T. Generation of cDNA probes directed by amino acid sequence: cloning of urate oxidase. Science. 1988;239:1288–1291. doi: 10.1126/science.3344434. [DOI] [PubMed] [Google Scholar]
- 15.Leippe M, Tannich E, Nickel R, Horstmann R D, Muller-Eberhard H J. Primary structure of the pore-forming peptide of pathogenic Entamoeba histolytica. EMBO J. 1992;11:3501–3506. doi: 10.1002/j.1460-2075.1992.tb05432.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Miller L H, Roberts T, Shahabuddin M, McCutchan T. Analysis of sequence diversity in the Plasmodium falciparum merozoite surface protein-1 (MSP-1) Mol Biochem Parasitol. 1993;59:1–14. doi: 10.1016/0166-6851(93)90002-f. [DOI] [PubMed] [Google Scholar]
- 17.Moran P, Caras I W. Requirements for glycosylphosphatidylinositol attachment are similar but not identical in mammalian cells and parasitic protozoa. J Cell Biol. 1994;125:333–343. doi: 10.1083/jcb.125.2.333. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Mowatt M R, Nguyen B-Y T, Conrad J T, Adam R D, Nash T E. Size heterogeneity among antigenically related Giardia lamblia variant-specific surface proteins is due to differences in tandem repeat copy number. Infect Immun. 1994;62:1213–1218. doi: 10.1128/iai.62.4.1213-1218.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Mueller D E, Petri W A., Jr Clonal growth in Petri dishes of Entamoeba histolytica. Trans R Soc Trop Med Hyg. 1995;89:123. doi: 10.1016/0035-9203(95)90684-3. [DOI] [PubMed] [Google Scholar]
- 20.Myung K, Burch D, Jackson T F H G, Stanley S L., Jr Serodiagnosis of invasive amebiasis using a recombinant Entamoeba histolytica antigen-based ELISA. Arch Med Res. 1992;23:285–288. [PubMed] [Google Scholar]
- 21.Ravdin J I. Amebiasis: state-of-the-art clinical article. Clin Infect Dis. 1995;20:1453–1464. doi: 10.1093/clinids/20.6.1453. [DOI] [PubMed] [Google Scholar]
- 22.Samuelson J, Caplivski D, Sturm-Ramirez K, Kretsinger K, Descoteaux S, Hernandez G, Vargas G, Mammo R, Newton O, Santos J, de la Vega H, Robbins P, Ganguly C, Lohia A. A proposal for a molecular biologic system for classifying isolates of Entamoeba histolytica and Entamoeba dispar. Arch Med. 1997;28:S274–S275. [PubMed] [Google Scholar]
- 23.Smith D B, Johnson K S. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene. 1988;67:31–40. doi: 10.1016/0378-1119(88)90005-4. [DOI] [PubMed] [Google Scholar]
- 24.Soute J A, Slaoui M, Heppner G, Momin P, Kester K E, Desmons P, Wellde B T, Garcon N, Krzych U, Marchand M, Ballou W R, Cohen J D. A preliminary evaluation of a recombinant circumsporozoite protein vaccine against Plasmodium falciparum malaria. N Engl J Med. 1997;336:86–91. doi: 10.1056/NEJM199701093360202. [DOI] [PubMed] [Google Scholar]
- 25.Stanley S L, Jr, Becker A, Kunz-Jenkins C, Foster L, Li E. Cloning and expression of a membrane antigen of Entamoeba histolytica possessing multiple tandem repeats. Proc Natl Acad Sci USA. 1990;87:4976–4980. doi: 10.1073/pnas.87.13.4976. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Stanley S L, Jr, Tian K, Koester J P, Li E. The serine-rich Entamoeba histolytica protein is a phosphorylated membrane protein containing O-linked terminal N-acetylglucosamine residues. J Biol Chem. 1995;270:4121–4126. doi: 10.1074/jbc.270.8.4121. [DOI] [PubMed] [Google Scholar]
- 27.Su X-Z, Heatwole V M, Wertheimer S P, Guinet F, Herrfeldt J A, Peterson D S, Ravetch J A, Wellems T E. The large diverse gene family var encodes proteins involved in cytoadherence and antigenic variation of Plasmodium falciparum-infected erythrocytes. Cell. 1995;82:89. doi: 10.1016/0092-8674(95)90055-1. [DOI] [PubMed] [Google Scholar]
- 28.Uhlen M, Guss B, Nilsson B, Gatenbeck S, Philipson L, Lindberg M. Complete sequence of the staphylococcal gene encoding protein A: a gene evolved through multiple duplications. J Biol Chem. 1984;259:1695–1702. [PubMed] [Google Scholar]
- 29.von Heijne G. Signal sequences. The limits of variation. J Mol Biol. 1985;184:99–105. doi: 10.1016/0022-2836(85)90046-4. [DOI] [PubMed] [Google Scholar]
- 30.Zhang T, Cieslak P R, Stanley S L., Jr Protection of gerbils from amebic liver abscess by immunization with a recombinant Entamoeba histolytica antigen. Infect Immun. 1994;62:1166–1170. doi: 10.1128/iai.62.4.1166-1170.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]



