Abstract
Epidemics of yaws-like cutaneous ulcers are regularly documented in children in the tropics. They occur mainly in poor and remote communities without access to health facilities. The integration of molecular tools into yaws control efforts has made it possible to describe Haemophilus ducreyi (HD) as a major cause of cutaneous ulcers. The objective of this study was to determine the prevalence of HD as cause of cutaneous ulcers, investigate its presence in asymptomatic individuals and identify associated risk factors. A cross-sectional study was conducted in yaws endemic districts of Cameroon. Participants included people presenting yaws-like ulcers and asymptomatic individuals. Swab samples were collected from each participant and tested for HD and Treponema pallidum (TP) using an established qPCR method. Additionally, demographic, habitat, proximity, and hygiene characteristics were collected using a structured questionnaire. A total of 443 individuals participated in the study, including 271 ulcer cases and 172 asymptomatic contacts. The prevalence of HD in ulcers was 30.3% (Confidence Interval (CI) 95% [24.8–35.7]) and the prevalence of asymptomatic HD carriage was 8.6% (CI95% [4.5–12.9]). TP was also detected in our sample among ulcer cases but in lower proportion (5.2% CI95% [2.5–7.8]) compared to HD. The adjusted logistic regression model showed that women were as much at risk of having HD cutaneous ulcer as men regardless of age. Physical proximity to a confirmed ulcer case was the major factor identified favouring HD transmission. HD ulcers were more likely to be present on Bantu individuals compared to Baka as well as HD colonization. These findings highlight HD as the most common cause of cutaneous ulcers in yaws-endemic communities in Cameroon. The exact implications of detecting HD on intact skin are not yet clear. Further studies are needed to understand the significance of this carriage in the spread dynamics of the disease.
Author summary
Cutaneous ulcers are commonly found affecting children in low-income countries of Africa and the South Pacific. In rural and remote communities of Cameroon the limited access to health care and shortage of sanitation is associated with a high morbidity of cutaneous ulcers. The latter represent an important cause of suffering and stigmatization in children. HD is commonly known as the causative agent of the sexually transmitted infection chancroid and has been recently described as a leading cause of cutaneous ulcers in yaws-endemic regions. In this study, we investigated the presence of HD and the associated risk factors. Our findings indicate a prevalence of HD associated with cutaneous ulcers of 30.3% and a prevalence of asymptomatic HD carriage of 5.2%. Physical proximity to a confirmed ulcer case, Bantu ethnicity, and the use of traditional latrines were the main risk factors associated with HD ulcers. TP DNA was detected in some cutaneous ulcer samples but in lower proportion compared to HD. This study confirms that HD is a leading cause of cutaneous ulcer in yaws endemic areas in Cameroon. National control programmes in endemic countries should therefore consider this pathogen in their strategies for controlling and eliminating skin neglected tropical diseases (NTDs).
Introduction
Cutaneous ulcers remain a public health problem in many parts of the world especially in the South Pacific, South East Asia, and West and Central Africa [1–3]. They predominantly affect children living in remote communities with limited access to potable water and health services and who live in poor hygiene conditions. The clinical manifestations of cutaneous ulcers vary depending on the causative organism and can range from small sores to multiple deep lesions which can evolve to bone damage [1].
In Africa, South East Asia and the South Pacific Islands most cutaneous ulcers in children have been attributed to yaws, caused by Treponema pallidum subsp. pertenue (TPE) [4,5] based on a clinical diagnosis which is known to be unreliable [6–8]. PCR which is the gold standard diagnosis has made it possible to detect other aetiological agents of cutaneous ulcers such as HD, which is often co-endemic and may also occur as a co-morbidity with TPE.
HD is a fastidious Gram negative coccobacillus traditionally considered as the causative agent of chancroid, a sexually transmitted infection characterized by the appearance of ulcers on the genitals accompanied by suppurative lymphadenopathy [9]. In recent years, multiple studies have reported cutaneous ulcers caused by H. ducreyi, including Papua New Guinea [1,10], the Solomon Islands [11], the Fiji Islands [12], Vanuatu [13], Indonesia [14], Sudan [15], Ghana [16] and Cameroon [17].
The true extent of the burden of HD cutaneous ulcers is still unclear, but several studies have established that HD may account for 20–60% of skin ulcers clinically diagnosed as yaws [1,10,18–20]. Moreover, HD was found colonizing fomites and the healthy skin of asymptomatic contacts [21].
The epidemiology of HD remains poorly understood. In most endemic areas of Africa and the South Pacific, the prevalence of HD as a cause of genital or cutaneous ulcers is not known due to the lack of confirmatory diagnosis in most settings. Traditionally diagnosis relied on culture but this was challenging due to special conditions required for culture which were not available in low and middle income country health services [22]. Today, nucleic acid amplification tests (NAATs) represent an alternative approach. Whilst they still require infrastructure and well-trained personnel, the stringent sample transport requirements which create a barrier to culture HD are not needed for NAATs [23,24].
Several factors have been associated with the transmission of certain skin NTDs such as yaws; these include demographic characteristics (age, sex), hygiene and sanitation indicators (poor hand-washing habits, sharing of clothes, frequency of bathing and contact with infected individuals) and housing characteristics (inadequate sanitation, overcrowded houses) [25], but we lack information on the risk factors for HD cutaneous ulcers.
To address the gaps in understanding H. ducreyi epidemiology, we designed a study to determine the prevalence of HD as a cause of cutaneous ulcers and to assess the frequency of asymptomatic carriage while identifying associated risk factors in yaws endemic districts of Cameroon. These districts were mainly made up of two major ethnic groups: the Baka and the Bantu. The Baka, also known as pygmies, are a semi-sedentary group of people who live in forest camps and sleep in mud or straw huts. They live essentially from hunting, gathering and, to a lesser extent, from farming, for which they are employed as labourers by their Bantu neighbours. In contrast, Bantu constitute a sedentary community with modern amenities, including cement, brick or wooden houses, sleep on mattresses and hygiene practices involving soap [26].
Methods
Ethic statement
This study was approved by the National Ethics Committee for Human Health Research (N°2020 / 12/ 1327/ CE/ CNERSH/ SP) and the Ministry of Public Health (approval N°631–021). All participants or their legal representatives (parents/ guardians) for minor participants provided written informed consent.
Study setting and selection of participants
We conducted a cross-sectional study from May 2021 to May 2022 in 14 health districts in four regions of Cameroon which have been identified as endemic for yaws by the National Yaws, Leishmaniasis, Leprosy and Buruli Ulcer Control Programme (CNLP2LUB). The selected health districts included: Messamena, Abong-Mbang, lomié, Yokadouma, Mbang, Doumé, Batouri, Bétaré-oya, Ndélélé in the East region; Sangmelima, Djoum, Lolodorf in the South region, Bankim in the Adamaoua region and Maroua in the Far North region (Fig 1). Twelve of the 14 health districts participated in both the prevalence and risk factor survey, and the remaining two districts, Maroua and Ndélélé, only participated in the prevalence survey as the study overlapped with the field surveillance activities of the national control programme, which conducted the investigations at these sites.
Fig 1. Geographic location of sampling sites and sites with HD confirmed ulcer cases.
The figure was generated using ArcGis Release 10.1 by Environmental Systems Research Institute (ESRI) (2012), Redland, CA. The basemap shapefiles were obtained from the open-access domain OpenStreetMap (https://www.openstreetmap.fr/).
We carried out active case searching for cutaneous ulcer cases using both school and community-based activities. For communities with high school enrolment rate and whose screening period coincided with the school year, the case searching was based in schools. For communities with low enrolment rates or where the survey was conducted during the holidays, the case search was house-to-house.
Participants underwent clinical examination and those with cutaneous ulcers were identified and enrolled in the study as cases. Asymptomatic individuals living in the vicinity of the cases, such as the same household or classroom, were enrolled as controls. In addition, we also enrolled asymptomatic participants from households without cases of cutaneous ulcers as a further set of controls.
Sample collection
We collected samples from cutaneous ulcer cases by swabbing of the ulcerated lesions and from asymptomatic participants by swabbing the front face of both legs with polyester tipped swabs with polystyrene handle (Puritan sterile swabs, Cat #25–806 1PD, Puritan Medical Products- Guilborg, UK). We placed the samples into 500 μL of a custom-made lysis buffer (10 mM Tris, pH 8.0, 0.1 M EDTA, pH 8.0 and 0.5% SDS) and kept them refrigerated (2–8°C) until transport to the Centre Pasteur du Cameroun (CPC) in a cooler, where they were stored at -20°C.
Laboratory assessment
We extracted genomic DNA from 200 μL of swab lysate using the QIAmp DNA mini kit (Qiagen, Germany) according to the manufacturer’s recommendations and eluted it in a total volume of 100 μL.
We performed on the samples three real time singleplex PCRs on the ABI prism 7500 thermocycler (Thermo Fisher Scientific, Waltham, USA). We first detected the RNAse P gene, which codes for an endoribonuclease present in all living cells, and used previously described primers and probe [27] to confirm the adequacy of the sample and the absence of amplification inhibitors. We targeted the V8 region of the 16S ribosomal RNA gene to detect the presence of HD DNA in the samples. The PCR reaction was performed in a total volume of 25 μL containing 0.9 μM of each primer and probe (Hd16SV8- F: 5’>TATACAGAGGGCGGCAAACC<3’; Hd16SV8-R: 5’>CCAATCCGGACTTAGACGTAC<3’; Hd16SV8- P: 5’>Fam-CAAAGG GGAGCGAATCTCAC-BHQ1<3’), ABI TaqMan Fast advanced Master Mix and 2 μL of the DNA template. The cycling conditions were: Uracil N-glycosylase (UNG) incubation at 50°C for 2 minutes, pre-denaturation at 95°C for 10 min, followed by 40 cycles of denaturation 95°C for 15 seconds, annealing and extension at 60°C for 30 seconds. We detected the presence of TP by amplifying the polA gene (tp0105), which is a fragment conserved in all TP subspecies, using a protocol described elsewhere [17].
Questionnaire
We administered a questionnaire to each participant (or their legal representative). We collected data either via an open-access Android application, Open Data Kit (ODK) collect [28] or via a paper form. The questionnaire consisted of demographic characteristics, information about the house in which the participant lived, data on possible exposure to cases of cutaneous ulcers and measures of access to hygiene and sanitation. Local community health workers acted as a translator where necessary for participants who did not speak English or French.
Data management and analyses
Each participant was attributed a unique ID code at the moment of inclusion, and that code was used to label his/her risk factor form and samples. The unique ID codes were used for management and analysis of all data related to the participants.
We calculated the prevalence of HD as a cause of cutaneous ulcers in the study population and how this varied by key explanatory variables. We then performed three analyses. Firstly, we compared individuals with and without a cutaneous ulcer; secondly, we compared characteristics of individuals whose cutaneous ulcers were or were not caused by HD; finally, we compared the characteristics of asymptomatic individuals who were or were not identified as carriers of HD. For each comparison we initially fitted a univariate logistics regression model. We then fitted multivariable models adjusting for age, sex and variables which were significant in the univariate analysis. All analyses were done with SPSS Statistics 20.
Results
Description of the population
A total of 24,610 people were clinically screened for cutaneous ulcers at the 14 study sites. Overall, we enrolled 443 participants including 271 individuals with a cutaneous ulcer and 172 asymptomatic contacts (controls). The sex ratio of males to females was 2.1 for ulcer cases and 1.4 for asymptomatic individuals. The age of participants ranged from 2 to 60 years, with a median age of 9 years (Inter Quartile Range (IQR) 7–11).
The overall prevalence of cutaneous ulcers in this population was therefore estimated to be 1.1%. Of these HD was identified in 82 (30.3% - 95% CI 24.8–36.1%) giving a population prevalence of HD ulcers of 0.3%. Eight out of 14 study sites had at least one cutaneous ulcer associated with HD (Fig 1). The proportion of ulcers caused by H. ducreyi was varied: with Doumé, Maroua and Bankim having the highest proportions of 73.3% (33/ 45), 72.7% (8/ 11) and 68.2% (30/ 44) respectively. Amongst asymptomatic controls HD was detected in 15 out of 172 participants (8.7% - 95% CI 5–14%) (Table 1). All cases of asymptomatic colonisation were detected in only two sites, Bankim (14/15) and Yokadouma (1/15) (S1 File).
Table 1. Proportion of individuals in whom HD and TP were detected.
| Germ detected | Individuals with a cutaneous ulcer N = 271 | Asymptomatic individualsN = 172 |
|---|---|---|
| HD | 82 (30. 3%) | 15 (8.7%) |
| TP | 14 (5. 2%) | 1 (0.6%) |
Of 271 individuals with a cutaneous ulcer TP DNA was detected in 14 (5.2% - 95% CI 2.9–8.5%). Cases of yaws were found in only two health districts Mbang (13/14) and Lomié (1/14) and 92.9% were from Baka communities (13/14). Treponemal DNA was detected only in one asymptomatic individual (0.6% - 95% CI 0–3.2%) from Mbang (Fig 2).
Fig 2. Appearance of cutaneous ulcers similar to yaws in children in Cameroon.
Pictures took by the reseach team during field investigation. Legend: A, B, C, D: HD cutaneous ulcers; E: yaws ulcer; F: idiopathic ulcer (negative for both TP and HD).
Of the 443 participants taking part in the study, a total of 245 (55.3%), including 127 ulcer cases and 118 asymptomatic individuals, successfully fill out the risk factor questionnaire and were included in the risk factor analysis (S2 File).
Both univariate and multivariable analysis revealed that children aged 0–4 years (adjusted Odd Ratio (aOR): 2.91–95% CI 1.02–8.34, p = 0.046) and those aged 15 years and over (aOR: 5.94–95% CI 1.15–30.70, p = 0.034) were more likely to have a cutaneous ulcer (Table 2). Females were about half less likely to have a cutaneous ulcer (aOR: 0.51–95% CI 0.28–0.93, p = 0.028). Members of the Baka ethnic group had lower odds of yaws like ulcer compared to Bantu (aOR = 0.28–95% CI 0.14–0.59, p = 0.001). Some hygiene factors were associated with a reduced risk of cutaneous ulcers including not sharing their clothes with others (aOR: 0.45–95% CI 0.25–0.81, p = 0.008), and living a large distance from a bin (waste disposal site, which may be individual but most of the time shared by several households) (aOR: 0.37–95% CI 0.20–550.69, p = 0.002) but many other household and hygiene related variables did not appear to be associated (Table 2).
Table 2. Risk factors associated to yaws like cutaneous ulcers.
| Characteristics | Total | Presence of ulcer | P-value | Bivariate analysis | Multivariate analysis | ||||
|---|---|---|---|---|---|---|---|---|---|
| No (%) | Yes (%) | Crude OR (95% CI) | P-value | Adjusted OR (95% CI) | P-value | ||||
| Range of age | 0.353 | ||||||||
| 0–4 years | 24 | 11 (45.8%) | 13 (54.2%) | 1.39 (0.57–3.36) | 0.469 | 2.91 (1.02–8.34) | 0.046 | ||
| 5–9 years | 113 | 61 (54.0%) | 52 (46.0%) | Ref. | Ref. | ||||
| 10–14 years | 99 | 43 (43.4%) | 56 (56.6%) | 1.53 (0.89–2.63) | 0.126 | 1.26 (0.68–2.33) | 0.458 | ||
| 15 years and over | 9 | 3 (33.3%) | 6 (66.7%) | 2.35 (0.59–1.23) | 0.244 | 5.94 (1.15–30.70) | 0.034 | ||
| Sex | 0.007 | ||||||||
| Female | 85 | 51 (60.0%) | 34 (40.0%) | 0.48 (0.28–0.82) | 0.007 | 0.51 (0.28–0.93) | 0.028 | ||
| Male | 160 | 67 (41.9%) | 93 (58.1%) | Ref. | Ref. | ||||
| Ethnicity | 0.040 | ||||||||
| Bantu | 173 | 76 (43.9%) | 97 (56.1%) | Ref. | Ref. | ||||
| Baka | 72 | 42 (58.3%) | 30 (41.7%) | 0.56 (0.32–0.98) | 0.041 | 0.28 (0.14–0.59) | 0.001 | ||
| Type of house | 0.502 | ||||||||
| Modern house | 24 | 10 (41.7%) | 14 (58.3%) | ||||||
| Traditional house | 221 | 108 (48.9%) | 113 (51.1%) | ||||||
| Type of latrines | 0.404 | ||||||||
| Open air | 44 | 25 (56.8%) | 19 (43.2%) | ||||||
| Traditional latrines | 198 | 92 (46.5%) | 106 (53.5%) | ||||||
| WC | 3 | 1 (33.3%) | 2 (66.7%) | ||||||
| Sharing bed with other people | 0.212 | ||||||||
| No | 34 | 13 (38.2%) | 21 (61.8%) | ||||||
| Yes | 211 | 105 (49.8%) | 106 (50.2%) | ||||||
| Sharing clothes with others | 0.040 | ||||||||
| No | 108 | 60 (55.6%) | 48 (44.4%) | 0.59 (0.35–0.98) | 0.040 | 0.45 (0.25–0.81) | 0.008 | ||
| Yes | 137 | 58 (42.3%) | 79 (57.7%) | Ref. | Ref. | ||||
| Proximity to an ulcer case | 0.411 | ||||||||
| No | 85 | 44 (51.8%) | 41 (48.2%) | ||||||
| Yes | 160 | 74 (46.2%) | 86 (53.8%) | ||||||
| Proximity with a bin | 0.001 | ||||||||
| Far | 78 | 50 (64.1%) | 28 (35.9%) | 0.38 (0.22–0.67) | 0.001 | 0.37 (0.20–0.69) | 0.002 | ||
| Close | 167 | 68 (40.7%) | 99 (59.3%) | Ref. | Ref. | ||||
| Daily bathing | 0.440 | ||||||||
| No | 186 | 87 (46.8%) | 99 (53.2%) | ||||||
| Yes | 59 | 31 (52.5%) | 28 (47.5%) | ||||||
| Use of soap for bath | 0.338 | ||||||||
| Occasionally | 159 | 73 (45.9%) | 86 (54.1%) | ||||||
| Always | 86 | 45 (52.3%) | 41 (47.7%) | ||||||
| Constant wearing of shoes | 0.054 | ||||||||
| No | 136 | 58 (42.6%) | 78 (57.4%) | ||||||
| Yes | 109 | 60 (55.0%) | 49 (45.0%) | ||||||
| Frequency of clothing change | 0.003 | ||||||||
| after a maximum of 2 days | 62 | 40 (64.5%) | 22 (35.5%) | 0.41 (0.22–0.74) | 0.003 | 0.43 (0.17–0.67) | 0.002 | ||
| after at least 3 days | 183 | 78 (42.6%) | 105 (57.4%) | Ref | Ref | ||||
Legend: Ref = Reference modality.
Among individuals with cutaneous ulcers, we found that members of the Bantu ethnic group were more likely to have HD as the causative agent than Baka (51.5% vs 0%, p = 0.001) as well as people who relieved themselves in traditional latrines (98% (50/51) of confirmed cases used traditional toilets) (Table 3). In addition, there was some evidence that close contact with a cutaneous ulcer case was associated with both HD cutaneous ulcer (aOR: 0.27–95% CI 0.11–0.68, p = 0.005) and asymptomatic carriage (close: 20.3% vs not close: 0%, p = 0.005). We also found that the 15 asymptomatic HD positive cases were all Bantu (Table 4).
Table 3. Risk factors associated to HD cutaneous ulcers.
| Characteristics | Total | HD ulcer | P-value | Bivariate analysis | Multivariate analysis | ||||
|---|---|---|---|---|---|---|---|---|---|
| Negative (%) | Positive (%) | Crude OR (95% CI) | P-value | Adjusted OR (95% CI) | P-value | ||||
| Range of age | 0.228 | ||||||||
| 0–4 years | 13 | 10 (76.9%) | 3 (23.1%) | 0.46 (0.11–1.87) | 0.281 | 3.97 (0.34–45.27) | 0.266 | ||
| 5–9 years | 52 | 27 (51.9%) | 25 (48.1%) | 1.43 (0.67–3.07) | 0.358 | 2.04 (0.83–5.01) | 0.118 | ||
| 10–14 years | 56 | 34 (60.7%) | 22 (39.3%) | Ref. | Ref. | ||||
| 15 years and over | 6 | 5 (83.3%) | 1 (16.7%) | 0.31 (0.03–2.83) | 0.298 | 0.47 (0.04–5.44) | 0.548 | ||
| Sex | 0.789 | ||||||||
| Female | 34 | 21 (61.8%) | 13 (38.2%) | 0.90 (0.40–2.01) | 0.789 | 1.25 (0.46–3.42) | 0.662 | ||
| Male | 93 | 55 (59.1%) | 38 (40.9%) | Ref. | Ref. | ||||
| Ethnicity | > 0.001 | ||||||||
| Bantu | 99 | 48 (48.5%) | 51 (51.5%) | Ref. | Ref. | ||||
| Baka | 28 | 28 (100.0%) | 0 (0.0%) | 1 | - | 1 | |||
| Type of house | 0.426 | ||||||||
| Modern house | 14 | 7 (50.0%) | 7 (50.0%) | ||||||
| Traditional house | 113 | 68 (61.1%) | 44 (38.9%) | ||||||
| Type of latrines | 0.001 | ||||||||
| Open air | 19 | 19 (100.0%) | 0 (0.0%) | 1 | - | 1 | - | ||
| Traditional latrines | 106 | 56 (52.8%) | 50 (47.2%) | Ref. | Ref. | ||||
| WC | 2 | 1 (50.0%) | 1 (50.0%) | 1.12 (0.61–1.31) | 0.560 | 1.31 (0.05–32.83) | 0.870 | ||
| Sharing bed with other people | 0.833 | ||||||||
| No | 21 | 13 (61.9%) | 8 (38.1%) | ||||||
| Yes | 106 | 63 (59.4%) | 43 (40.6%) | ||||||
| Sharing clothes with others | 0.787 | ||||||||
| No | 48 | 28 (58.3%) | 20 (41.7%) | ||||||
| Yes | 79 | 48 (60.8%) | 31 (39.2%) | ||||||
| Proximity to an ulcer case | 0.034 | ||||||||
| No | 41 | 30 (73.2%) | 11 (26.8%) | 0.42 (0.19–0.95) | 0.037 | 0.27 (0.11–0.68) | 0.005 | ||
| Yes | 86 | 46 (53.5%) | 40 (46.5%) | Ref | Ref | ||||
| Proximity with the bin | 0.327 | ||||||||
| Far | 28 | 19 (67.9%) | 9 (32.1%) | ||||||
| Near | 99 | 57 (57.6%) | 42 (42.4%) | ||||||
| Daily bathing | 0.741 | ||||||||
| No | 99 | 60 (60.6%) | 39 (39.4%) | ||||||
| Yes | 28 | 16 (57.1%) | 12 (42.9%) | ||||||
| Use of soap for bath | 0.857 | ||||||||
| Occasionally | 86 | 51 (59.3%) | 35 (40.7%) | ||||||
| Rarely | 41 | 25 (61.0%) | 16 (39.0%) | ||||||
| Constant wearing of shoes | 0.319 | ||||||||
| No | 78 | 44 (56.4%) | 34 (43.6%) | ||||||
| Yes | 49 | 32 (65.3%) | 17 (34.7%) | ||||||
| Frequency of clothing change | 0.380 | ||||||||
| After no more than 2 days | 22 | 15 (68.2%) | 7 (31.8%) | ||||||
| After at least 3 days | 105 | 61 (58.1%) | 44 (41.9%) | ||||||
Legend: Ref = Reference modality.
Table 4. Risk factors associated to the carriage of HD.
| Characteristics | Total | Detection of HD | P-value | Bivariate analysis | Multivariate analysis | ||||
|---|---|---|---|---|---|---|---|---|---|
| No (%) | Yes (%) | Crude OR (95% CI) | P-value | Adjusted OR (95% CI) | P-value | ||||
| Range of age | 0.325 | ||||||||
| 0–4 years | 11 | 11 (100.0%) | 0 (0.0%) | 1 | - | 1 | - | ||
| 5–9 years | 61 | 54 (88.5%) | 7 (11.5%) | Ref. | Ref. | ||||
| 10–14 years | 43 | 35 (81.4%) | 8 (18.6%) | 1.76 (0.59–5.30) | 0.312 | 0.93 (0.27–3.18) | 0.906 | ||
| 15 years and over | 3 | 3 (100.0%) | 0 (0.0%) | 1 | - | 1 | - | ||
| Sex | 0.166 | ||||||||
| Female | 51 | 47 (92.2%) | 4 (7.8%) | 0.43 (0.13–1.45) | 0.175 | 0.63 (0.16–2.44) | 0.507 | ||
| Male | 67 | 56 (83.6%) | 11 (16.4%) | Ref. | Ref. | ||||
| Ethnicity | 0.002 | ||||||||
| Bantu | 76 | 61 (80.3%) | 15 (19.7%) | Ref. | |||||
| Baka | 42 | 42 (100%) | 0 (0.0%) | 1 | - | 1 | - | ||
| Type of house | 0.086 | ||||||||
| Modern house | 10 | 7 (70.0%) | 3 (30.0%) | ||||||
| Traditional house | 108 | 96 (88.9%) | 12 (11.1%) | ||||||
| Type of latrines | 0.088 | ||||||||
| Open air | 25 | 25 (100.0%) | 0 (0.0%) | ||||||
| Traditional latrines | 92 | 77 (83.7%) | 15 (16.3%) | ||||||
| WC | 1 | 1 (100%) | 0 (0.0%) | ||||||
| Sharing bed with other people | 0.234 | ||||||||
| No | 13 | 10 (76.9%) | 3 (23.1%) | ||||||
| Yes | 105 | 93 (88.6%) | 12 (11.4%) | ||||||
| Sharing clothes with others | 0.837 | ||||||||
| No | 60 | 52 (86.7%) | 8 (13.3%) | ||||||
| Yes | 58 | 51 (87.9%) | 7 (12.1%) | ||||||
| Proximity to an ulcer case | 0.001 | ||||||||
| No | 44 | 44 (100.0%) | 0 (0.0%) | 1 | 1 | ||||
| Yes | 74 | 59 (79.7%) | 15 (20.3%) | Ref | Ref | ||||
| Proximity with the bin | 0.139 | ||||||||
| Far | 50 | 41 (82.0%) | 9 (18.0%) | ||||||
| near | 68 | 62 (91.2%) | 6 (8.8%) | ||||||
| Daily bathing | 0.970 | ||||||||
| No | 87 | 76 (87.4%) | 11 (12.6%) | ||||||
| Yes | 31 | 27 (87.1%) | 4 (12.9%) | ||||||
| Use of soap for bath | 0.874 | ||||||||
| Occasionally | 73 | 64 (87.7%) | 9 (12.3%) | ||||||
| Rarely | 45 | 39 (86.7%) | 6 (13.3%) | ||||||
| Constant wearing of shoes | 0.368 | ||||||||
| No | 58 | 49 (84.5%) | 9 (15.5%) | ||||||
| Yes | 60 | 54 (90.0%) | 6 (10.0%) | ||||||
| Frequency of clothing change | 0.593 | ||||||||
| After no more than 2 days | 40 | 34 (85.0%) | 6 (15.0%) | ||||||
| After at least 3 days | 78 | 69 (88.5%) | 9 (11.5%) | ||||||
Legend: Ref = Reference modality.
Discussion
In this comprehensive study we found that approximately 1% of the screened population in Cameroon had a cutaneous ulcer and that over 30% of these were associated with HD infection, making it the single commonest causative organism identified. Ulcers were more frequent in children and appeared to be related to several parameters regarding sanitation and hygiene. We also detected asymptomatic colonisation with HD and this occurred exclusively in people exposed to an individual with HD ulcer.
Consistent with some previous studies we found the proportion of cutaneous ulcers associated with HD (30.3%) was much higher than those associated with TPE (5.2%). Our previous surveillance-based study in Cameroon showed that HD was responsible for almost half (49.6%) of yaws-like ulcers identified between 2017 and 2019, slightly more than twice those caused by TPE [17]. In this study, some of the samples were collected from participants who had washed and disinfected their ulcers prior to collection, which could have led to degradation or low load of HD DNA. The previous study also predominantly involved investigating reported outbreaks of cutaneous ulcers whilst the current study was conducted in normal conditions in the community which may also have impacted on our findings.
We identified a number of sociodemographic characteristics alongside markers of poor personal hygiene and sanitation behaviours that were associated with an increased risk of cutaneous ulcers. Apart from a study in 2017 that did not find a significant association between age and cutaneous ulcers [29], our results are consistent with the findings of a case-control study in Ghana where raising age was associated with increased odds of infection [25]. The practice of activities likely to induce trauma or scratches such as farming, animal husbandry and rough play tends to increase with age [30]; these smaller wounds could later serve as a gateway to the bacteria responsible for infection [31]. We found the proportion of men affected by cutaneous ulcers was slightly higher than that of women which has been reported elsewhere. This may be partially attributed to host biological factors [32] and to a higher risk of microtrauma amongst boys and men. Ethnicity was the only socio-demographic variable studied associated both for general cutaneous ulcers and for HD ulcers, with Bantu people being more likely to get infected by HD cutaneous ulcers compared to Baka people. These unexpected results contrast with several previously published reports. Most of the cutaneous ulcers which correspond to bacterial ulcerative conditions affect preferentially poor people living in warm, moist climates and mainly in forested tropical regions [33,34]. This corresponds to the natural environment of the Baka population of Central Africa which until now constituted the most at risk community in this region [35–38].
We found people in close and constant contact with other cutaneous ulcer cases were three times more likely to be infected and most of the cases of HD ulcers were detected in schools, among classmates. This school environment is characterised by close proximity and frequent contact between children which could favour the transmission of HD. Nearly all individuals with an HD ulcer made use of traditional latrines characterized by cracked mud walls, damp earthen floors and lack of roof. These kinds of toilets might facilitate interactions with flies which had been identified as possible mechanical vector for the transmission of TPE and HD. DNA of HD has been detected in flies collected from areas immediately outside the houses of individuals with cutaneous ulcers [21]. We also found people who shared their clothes with others or only changed clothes infrequently had an increased risk of cutaneous ulcers which is consistent with previous studies showing a higher risk among people who share personal items such as towels, clothes and sponges [25,39,40].
HD was detected in 15 (8.7%) individuals without cutaneous ulcers which is about half the rate seen in a previous study [21]. In the current study all asymptomatic individuals in whom HD DNA was detected were linked to a confirmed case of HD cutaneous ulcer whereas in the previous study HD DNA was found in almost the same proportion in asymptomatic individuals exposed and not exposed to ulcers [21]. HD spreads naturally through skin contact [33,41], and so far no real evidence of an alternative transmission route has been clearly demonstrated. In this context, it seems plausible that the HD DNA detected in asymptomatic individuals results from direct or indirect contact with confirmed ulcer cases.
Our study had some limitations. Firstly, because of the COVID-19 pandemic, we could not visit the entire population of the community with many schools and households declining to undertake the preliminary screening step of inclusion and this could have affected the representativeness of our study population. We relied predominantly on detection of DNA and not culture, which is technically challenging, and our data are cross-sectional in nature. As a result, further studies are needed to draw more robust conclusions about the role of asymptomatic colonization.
While our research has primarily focused on HD and to a lesser extent to TPE, it is worth noting that other pathogens, including Streptococcus pyogenes [42], Streptococcus dysgalactiae, Arcanobacterium haemolyticum, Corynebacterium diphtheriae [43], Fuso-bacterium, Bacillus fusiformis, Treponema vincentii [8] have also been described to be associated with approximately one-third of cutaneous encountered in yaws-endemic communities.
Our data confirm that HD is a leading cause of cutaneous ulcers in yaws endemic health district in Cameroon and is associated with limited access to water and sanitation. Whilst we confirmed the evidence of HD colonization have further studies on its viability and implications for transmission should be undertaken to help inform control strategies.
Supporting information
Legend: CU = cutaneous ulcer case; AS = asymptomatic individual.
(XLSX)
(XLSX)
Acknowledgments
We would like to thank the field team of this study. We thank all the study participants and their legal representatives for their time.
Data Availability
All relevant data are within the manuscript and its supporting information file.
Funding Statement
This study was fully funded by the European and Developing Countries Clinical Trial Partnership (EDCTP) as part of the LAMP4yaws project. Grant number: RIA2018D-2495. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Mitjà O, Lukehart SA, Pokowas G, Moses P, Kapa A, Godornes C, et al. Haemophilus ducreyi as a cause of skin ulcers in children from a yaws-endemic area of Papua New Guinea: A prospective cohort study. Lancet Glob Heal. 2014;2: 235–241. doi: 10.1016/S2214-109X(14)70019-1 [DOI] [PubMed] [Google Scholar]
- 2.Roberts SA, Taylor SL. Haemophilus ducreyi: A newly recognised cause of chronic skin ulceration. Lancet Glob Heal. 2014;2: e187–e188. doi: 10.1016/S2214-109X(14)70197-4 [DOI] [PubMed] [Google Scholar]
- 3.Marks M, Mitjà O, Solomon AW, Asiedu KB, Mabey DC. Yaws. Br Med Bull. 2015;113: 91–100. doi: 10.1093/bmb/ldu037 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Gangaiah D, Webb KM, Humphreys TL, Fortney KR, Toh E, Tai A, et al. Haemophilus ducreyi cutaneous ulcer strains are nearly identical to class I genital ulcer strains. PLoS Negl Trop Dis. 2015;9: 1–20. doi: 10.1371/journal.pntd.0003918 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Gangaiah D, Spinola SM. Haemophilus ducreyi Cutaneous Ulcer Strains Diverged from Both Class I and Class II Genital Ulcer Strains: Implications for Epidemiological Studies. PLoS Negl Trop Dis. 2016;10: 1–8. doi: 10.1371/journal.pntd.0005259 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Kositz C, Butcher R, Marks M. Images in clinical tropical medicine: New diagnostics for yaws. Am J Trop Med Hyg. 2017;96: 3–4. doi: 10.4269/ajtmh.16-0639 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Marks M, Fookes M, Wagner J, Ghinai R, Sokana O, Solomon AW, et al. Direct Whole-Genome Sequencing of Cutaneous Strains of Haemophilus ducreyi. 2018;24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.G-Beiras C, Ubals M, Corbacho-Monné M, Vall-Mayans M, Mitjà O. Yaws, Haemophilus ducreyi, and Other Bacterial Causes of Cutaneous Ulcer Disease in the South Pacific Islands. Dermatol Clin. 2021;39: 15–22. doi: 10.1016/j.det.2020.08.002 [DOI] [PubMed] [Google Scholar]
- 9.Fleming DT, Wasserheit JN. From epidemiological synergy to public health policy and practice: The contribution of other sexually transmitted diseases to sexual transmission of HIV infection. Sex Transm Infect. 1999;75: 3–17. doi: 10.1136/sti.75.1.3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.González-Beiras C, Kapa A, Vall-Mayans M, Paru R, Gavilán S, Houinei W, et al. Single-Dose Azithromycin for the Treatment of Haemophilus ducreyi Skin Ulcers in Papua New Guinea. Clin Infect Dis. 2017;65: 2085–2090. doi: 10.1093/cid/cix723 [DOI] [PubMed] [Google Scholar]
- 11.Marks M, Chi K, Vahi V, Pillay A, Sokana O, Pavluck A, et al. Haemophilus ducreyi Associated with Skin Ulcers among Children, Solomon Islands. 2014;20. doi: 10.3201/eid2010.140573 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Marckmann P, Hojbjerg T, von Eyben FE, Christensen I. Imported pedal chancroid: Case report. Genitourin Med. 1989;65: 126–127. doi: 10.1136/sti.65.2.126 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.McBride WJH, Hannah RCS, Le Cornec GM, Bletchly C. Cutaneous chancroid in a visitor from Vanuatu. Australas J Dermatol. 2008;49: 98–99. doi: 10.1111/j.1440-0960.2008.00439.x [DOI] [PubMed] [Google Scholar]
- 14.van Hattem JM, Langeveld TJC, Bruisten SM, Kolader M, Grobusch MP, de Vries HJC, et al. Haemophilus ducreyi cutaneous ulcer contracted at Seram Island, Indonesia, presented in the Netherlands. PLoS Negl Trop Dis. 2018;12: 1–9. doi: 10.1371/journal.pntd.0006273 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Humphrey S, Romney M, Au S. Haemophilus ducreyi leg ulceration in a 5-year-old boy. Journal of the American Academy of Dermatology. MOSBY-ELSEVIER 360 PARK AVENUE SOUTH, NEW YORK, NY 10010–1710 USA; 2007. pp. AB121–AB121. [Google Scholar]
- 16.Ghinai R, El-duah P, Chi K, Pillay A, Solomon AW, Bailey RL, et al. A Cross-Sectional Study of ‘ Yaws ‘ in Districts of Ghana Which Have Previously Undertaken Azithromycin Mass Drug Administration for Trachoma Control. 2015; 1–10. doi: 10.1371/journal.pntd.0003496 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ngono JPN, Tchatchouang S, Tsanga MVN, Tabah EN, Tchualeu A, Asiedu K, et al. Ulcerative skin lesions among children in cameroon: It is not always yaws. PLoS Negl Trop Dis. 2021;15. doi: 10.1371/JOURNAL.PNTD.0009180 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.González-Beiras C, Marks M, Chen CY, Roberts S, Mitjà O. Epidemiology of Haemophilus ducreyi infections. Emerg Infect Dis. 2016;22: 1–8. doi: 10.3201/eid2201.150425 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Fegan D, Glennon MJ, Kool J, Taleo F. Tropical leg ulcers in children: more than yaws. Trop Doct. 2016;46: 90–93. doi: 10.1177/0049475515599326 [DOI] [PubMed] [Google Scholar]
- 20.Chi KH, Danavall D, Taleo F, Pillay A, Ye T, Nachamkin E, et al. Molecular differentiation of treponema pallidum subspecies in skin ulceration clinically suspected as yaws in vanuatu using real-time multiplex PCR and serological methods. Am J Trop Med Hyg. 2015;92: 134–138. doi: 10.4269/ajtmh.14-0459 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Houinei W, Godornes C, Kapa A, Knauf S, Mooring EQ, González-Beiras C, et al. Haemophilus ducreyi DNA is detectable on the skin of asymptomatic children, flies and fomites in villages of Papua New Guinea. PLoS Negl Trop Dis. 2017;11: e0004958. doi: 10.1371/journal.pntd.0004958 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Bruisten SM, Cajro I, Fennema H, Pijl A, Buimer M, Peerbooms PGH, et al. Diagnosing genital ulcer disease in a clinic for sexually transmitted diseases in Amsterdam, The Netherlands. J Clin Microbiol. 2001;39: 601–605. doi: 10.1128/JCM.39.2.601-605.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Tekle-Michael T, Van Dyck E, Abdellati S, Laga M. Development of a heminested polymerase chain reaction assay for the detection of Haemophilus ducreyi in clinical specimens. Int J STD AIDS. 2001;12: 797–803. doi: 10.1258/0956462011924425 [DOI] [PubMed] [Google Scholar]
- 24.Lewis DA. Epidemiology, clinical features, diagnosis and treatment of Haemophilus ducreyi-a disappearing pathogen? Expert Rev Anti Infect Ther. 2014;12: 687–696. doi: 10.1586/14787210.2014.892414 [DOI] [PubMed] [Google Scholar]
- 25.Okine RNA, Sarfo B, Adanu RM, Kwakye-Maclean C, Osei FA. Factors associated with cutaneous ulcers among children in two yaws-endemic districts in Ghana. Infect Dis Poverty. 2020;9: 1–9. doi: 10.1186/s40249-020-00641-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Attribution-noncommercial-sharealike CC, License I, By-nc-sa CC, Trust A. Of Apes and Men: Baka and Bantu Attitudes to Wildlife and the Making of Eco-Goodies and Baddies Author (s): Axel Köhler Published by: Ashoka Trust for Research in Ecology and the Environment and Wolters Stable URL: https://www.jstor.org/stable/263965. 2005;3: 407–435. [Google Scholar]
- 27.Who T, Centre C, Atlanta CDC, States U. CDC protocol of realtime RTPCR for swine influenza A(H1N1) 28. Control. 2009;1. [Google Scholar]
- 28.Hartung C, Anokwa Y, Brunette W, Lerer A, Tseng C, Borriello G. Open data kit: Tools to build information services for developing regions. ACM Int Conf Proceeding Ser. 2010. doi: 10.1145/2369220.2369236 [DOI] [Google Scholar]
- 29.Dzotsi E, Agana N, Ohene S-A, Adjabeng M, Aziz A, Odoom JK. Factors Associated with Yaws Infections in the West Akim Municipality, Ghana. Int J Trop Dis Heal. 2017;22: 1–9. doi: 10.9734/ijtdh/2017/32425 [DOI] [Google Scholar]
- 30.Costa e Silva L, Fragoso MI, Teles J. Physical Activity–Related Injury Profile in Children and Adolescents According to Their Age, Maturation, and Level of Sports Participation. Sports Health. 2017;9: 118–125. doi: 10.1177/1941738116686964 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Zachary JF. C H A P T E R 4 Mechanisms of Microbial Infections 1. 2020. [Google Scholar]
- 32.Janowicz DM, Ofner S, Katz BP, Spinola SM. Experimental infection of human volunteers with Haemophilus ducreyi: Fifteen years of clinical data and experience. J Infect Dis. 2009;199: 1671–1679. doi: 10.1086/598966 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Mitjà O, Asiedu K, Mabey D. Yaws. Lancet. 2013;381: 763–773. doi: 10.1016/S0140-6736(12)62130-8 [DOI] [PubMed] [Google Scholar]
- 34.Marks M, Lebari D, Solomon AW, Higgins SP. Yaws. Int J STD AIDS. 2015;26: 696–703. doi: 10.1177/0956462414549036 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Pampiglione S, Wilkinson AE. A study of yaws among pygmies in Cameroon and Zaire. Brit J vener Dis. 1975;51: 165. doi: 10.1136/sti.51.3.165 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Martin PM V, Gonzalez JP, Martin MH, Georges-Courbot MC, Palisson MJ, Georges AJ. Clinical Aspects and Usefulness of Indirect Absorbed Immunofluorescence for Diagnosis of Yaws in Central Africa. J Clin Microbiol. 1988. Available: https://journals.asm.org/journal/jcm doi: 10.1128/jcm.26.11.2432-2433.1988 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Manirakiza A, Vilas Boas S, Beyam N, Zadanga G, Konamna FX, Njuimo SP, et al. Clinical outcome of skin yaws lesions after treatment with benzathinebenzylpenicillin in a pygmy population in Lobaye, Central African Republic. 2011. doi: 10.1186/1756-0500-4-543 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Coldiron M, Obvala D, Mouniaman-Nara I, Pena J, Blondel C, Porten K. The prevalence of yaws among the Aka in the Congo. Med Sante Trop. 2013;23: 231–232. [DOI] [PubMed] [Google Scholar]
- 39.Tettey A. School of public health, college of health sciences, University of Ghana-Legon, factors associated with yaws in the Ga West district of Ghana (A Case-control study at Obom). University of Ghana. 2009. Available: http://197.255.68.203/handle/123456789/8816 [Google Scholar]
- 40.Sitanggang YA, Hutapea H, Suhardi S, Maladan Y, Wahyuni T, Rokmad MF. Serologic observation and risk factor of yaws in Hamadi Public Health Center, Jayapura. Heal Sci J Indones. 2017;8: 25–29. doi: [DOI] [Google Scholar]
- 41.Lewis DA, Mitjà O. Haemophilus ducreyi: From sexually transmitted infection to skin ulcer pathogen. Curr Opin Infect Dis. 2016;29: 52–57. doi: 10.1097/QCO.0000000000000226 [DOI] [PubMed] [Google Scholar]
- 42.Griesenauer BI, Xing Y, Fortney KR, Gao X, Gonzá lez-Beiras C, Nelson DE, et al. Two Streptococcus pyogenes emm types and several anaerobic bacterial species are associated with idiopathic cutaneous ulcers in children after community-based mass treatment with azithromycin. 2022. doi: 10.1371/journal.pntd.0011009 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Noguera-Julian M, González-Beiras C, Parera M, Ubals M, Kapa A, Paredes R, et al. Etiological Characterization of the Cutaneous Ulcer Syndrome in Papua New Guinea Using Shotgun Metagenomics. Clin Infect Dis. 2019;68: 482–489. doi: 10.1093/cid/ciy502 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Legend: CU = cutaneous ulcer case; AS = asymptomatic individual.
(XLSX)
(XLSX)
Data Availability Statement
All relevant data are within the manuscript and its supporting information file.