ABSTRACT
In this study, the presence of tulip virus X (TVX) in Korean tulips was confirmed through high-throughput RNA sequencing. Its complete genome sequence of 6,056 nucleotides was determined via Sanger sequencing, exhibiting a 99.24% nucleotide identity with TVX-J isolate. This signifies a previously unreported presence of TVX outside Japan.
KEYWORDS: tulip virus X, tulip, high-throughput sequencing, complete genome sequence
ANNOUNCEMENT
Tulips, members of the family Liliaceae, are popular ornamental plants known for their diverse colors and shapes. Several viruses were reported in recent virome analysis of tulip plants (1, 2). Tulip virus X (TVX) is a member of the genus Potexvirus, which belongs to the family Alphaflexiviridae. Since the initial report of the complete genome sequence (CGS) in Japanese tulips (3), no further reports emerged until the genome of viola mottle virus was confirmed identical to that of TVX (4).
In April 2021, 86 tulip plants exhibiting viral symptoms in leaves (mosaic, yellowing, and malformation) and flowers (color breaking) were collected in five regions of Korea: Chilgok (35°54′48.5″N 128°24′35.6″E), Chuncheon (37°43′38.7″N 127°42′10.4″E), Goseong (34°59′42.6″N 128°19′40.1″E), Yecheon (36°44′00.6″N 128°26′02.4″E), and Yesan (36°41′09.4″N 126°48′31.7″E). Total RNA was extracted from pooled samples using the Maxwell 16 LEV Plant RNA Kit (Promega, USA). Subsequently, a single library was constructed using the TruSeq Stranded Total RNA LT Sample Prep Kit for Plants (Illumina, USA) and subjected to 100-bp paired-end sequencing on an Illumina NovaSeq 6000 (Macrogen, Korea). A total of 628 million reads were generated out of 641 million using Trimmomatic version 0.38 and de novo assembled into 498,795 contigs using Trinity version trinityrnaseq_r20140717 with default parameters. These contigs were then subjected a BLASTn with an e-value cut-off of 10−5, against the NCBI nucleotide database version 20180116, leading to the identification of contigs related to lily symptomless virus (LSV), olive mild mosaic virus (OMMV), tulip breaking virus (TBV), and TVX. Confirmed through reverse transcription-PCR (RT-PCR) assays (1, 2), individual samples exhibited sole infections: five LSV, eight TBV, nine TVX, and seven OMMV. Co-infections included two LSV + TVX, four LSV + OMMV, two TBV + TVX, twelve TBV + OMMV, and four LSV + TBV + OMMV. Total RNA was extracted from a TVX-positive sample using the easy-spin Total RNA Extraction Kit (iNtRON, Korea) and used for cDNA synthesis with Oligo d(T) utilizing the SuperiorScript III cDNA synthesis kit (Enzynomics, Korea). PCRs were performed using 10 primer pairs designed to have a 100- to 200-bp overlap at both ends (Table 1). The amplicons were cloned using the All-in-One Cloning Kit (BioFact, Korea) and sequenced using the ABI 3730XL DNA Analyzer (Bioneer, Korea). Subsequently, the sequencing reads underwent quality trimming with a Phred cut-off score of ≥20. The sequences of both ends of genome were determined using 5′/3′ RACE System for Rapid Amplification of cDNA Ends (Thermo Fisher Scientific, USA) with gene-specific primers (Table 1). The assembly of the obtained fragments was performed using UGENE version 44.0 (Unipro, Russia).
TABLE 1.
Primer list used to determine the complete genome sequence for Korean isolate of tulip virus X
| Fragment a | Primer name | Primer sequence (5′ to 3′) | Location |
|---|---|---|---|
| 1 | TVX-F74 | CTAAGAAGCTAGGTAAACGAC | 74–94 |
| TVX-R816 | CGTTGGGCAGTGACAGTG | 799–816 | |
| 2 | TVX-F673 | CTACACGCTTACCTACTCC | 673–691 |
| TVX-R1421 | GACTTTGGTTGGCGCAAGC | 1403–1421 | |
| 3 | TVX-F1261 | GATCAAGGCTCTTCAGTGG | 1261–1279 |
| TVX-R2096 | GCAGCACAACTTCGACTGG | 2078–2096 | |
| 4 | TVX-F1834 | GCAACTCAACAGAAGCCCC | 1834–1852 |
| TVX-R2635 | CATGGTGGTGTCGCTGTC | 2618–2635 | |
| 5 | TVX-F2520 | CATTGGTGAAGAAAGCGGC | 2520–2538 |
| TVX-R3418 | GTACCTCCGCATGTATCTG | 3400–3418 | |
| 6 | TVX-F3211 | CAAGTCCCTCCAACAGATC | 3211–3229 |
| TVX-R4114 | GTGTGCTTGTTCAGGGGAG | 4096–4114 | |
| 7 | TVX-F3950 | GATCCCCTAAAGCTTCACAG | 3950–3969 |
| TVX-R4730 | GACACTCTCTGGGCAATGG | 4712–4730 | |
| 8 | TVX-F4514 | CTTCCTCAAGACCACCAGC | 4514–4532 |
| TVX-R5253 | CTTGTTAGAAGTTCGGGCG | 5235–5253 | |
| 9 | TVX-F5099 | GACTCATTCTACTTCTGTCTC | 5099–5119 |
| TVX-R5788 | CGTTGGCTGTTATTTCGTCG | 5769–5788 | |
| 10 | TVX-F5557 | GTCGTCAAAGTCTCAACCAC | 5557–5576 |
| TVX-F5946 | CTGGGTTCGCAGCTGTAG | 5929–5946 | |
| 5′-termini b | TVX-RR185 | CTTTCTTCATCACTCGGTAGG | 165–185 |
| TVX-RR285 | GTTATGGCAAGTGGGTGTG | 267–285 | |
| 3′-termini b | TVX-RF5769 | CGACGAAATAACAGCCAACG | 5769–5788 |
| TVX-RF5871 | CCAGCTCTCTAACACCTCC | 5871–5889 |
Each fragment was designed to have an overlap of approximately 100–200 bp on both ends of the amplification product.
Indicates gene-specific primers used for rapid amplification of cDNA ends to determine both ends of the complete genome sequence.
The determined genome was composed of 6,056 nucleotides, with a GC content of 57.15% (Fig. 1). Five open-reading frames (ORFs) were predicted using the NCBI ORF finder with default parameters. The CGS exhibits 99.24% nucleotide identity to TVX-J (GenBank AB066288) with 100% query coverage in NCBI BLASTn. To our knowledge, there have been no previous cases of TVX reported in any natural hosts in Korea. Given the exclusive dependence on imported bulbs in Korean tulip cultivation, these findings imply a potential introduction of TVX through imported bulbs.
Fig 1.
Genome schematic of the Korean isolate of TVX. (A) The schematic represents the genome organization of the Korean isolate of TVX. The genome contains five open-reading frames (ORF): ORF1 (RNA-dependent RNA polymerase, RdRp; nt 96–4181), ORF2 (triple gene block1, TGB1; nt 4183–4875), ORF3 (triple gene block2, TGB2; nt 4841–5170), ORF4 (triple gene block3, TGB3; nt 5007–5291), and ORF5 (coat protein, CP; nt 5303–5926). The blue bar indicates the tulip virus X-like contig, which was composed of 6,076 nt and assembled de novo from 24,068 reads. (B) The positions of amplified fragments for determining the complete genome sequence of the TVX Korean isolate.
ACKNOWLEDGMENTS
This work was supported by the Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through Agriculture, Food and Rural Affairs Convergence Technologies Program for Educating Creative Global Leader Program, funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA) (no. 321001-03).
Contributor Information
Su-Heon Lee, Email: suheon@knu.ac.kr.
Jelle Matthijnssens, Katholieke Universiteit Leuven, Leuven, Belgium .
DATA AVAILABILITY
The complete genome sequence of tulip virus X, a Korean isolate, was deposited in GenBank under the accession number OP856636 .1. The original data from both high-throughput sequencing and Sanger sequencing, used for establishing the complete genome sequence of Korean TVX, have been archived in the Sequence Read Archive under the accession numbers SRR24725337 and SRR26283619, respectively.
REFERENCES
- 1. Bak S, Kim M, Kim HJ, Lee HK, Kwon M, Hong JS, Min DJ, Byun HS, Lee JS, Song JK, Nam KH, Lee SH. 2023. First report of tulip virus X infecting tulip (Tulipa gesneriana) in Korea. Plant Disease 107:238. doi: 10.1094/PDIS-12-21-2762-PDN [DOI] [Google Scholar]
- 2. Bak S, Kim M, Kim HJ, Kang EH, Kang DH, Min JG, Han S, Lee HK, Lee SH. 2023. First report of olive mild mosaic virus in imported tulips (Tulipa gesneriana) in Korea. Plant Dis 107:2895. doi: 10.1094/PDIS-03-23-0527-PDN [DOI] [Google Scholar]
- 3. Yamaji Y, Kagiwada S, Nakabayashi H, Ugaki M, Namba S. 2001. Complete nucleotide sequence of tulip virus X (TVX-J): the border between species and strains within the genus Potexvirus. Arch Virol 146:2309–2320. doi: 10.1007/s007050170004 [DOI] [PubMed] [Google Scholar]
- 4. Matsumoto O, Miyazaki A, Tokoshima J, Suzuki T, Yoshida T, Okano Y, Nijo T, Maejima K, Namba S, Yamaji Y. 2021. Complete genome sequence of viola mottle virus, revealing its synonymous relationship to tulip virus X. Arch Virol 166:2343–2346. doi: 10.1007/s00705-021-05129-4 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The complete genome sequence of tulip virus X, a Korean isolate, was deposited in GenBank under the accession number OP856636 .1. The original data from both high-throughput sequencing and Sanger sequencing, used for establishing the complete genome sequence of Korean TVX, have been archived in the Sequence Read Archive under the accession numbers SRR24725337 and SRR26283619, respectively.

