Figure 9. Full-length lp54 with fully resolved telomeres are recovered from ϕBB-1-packaged DNA.

(A) De novo assembly of packaged reads produced a 67,405-bp contig with tail-to-tail and head-to-head junctions. (B and C) Sequences at the packaged 5′ junction (green) or the 3′ junction (cyan) are compared to the lp54 reference sequence NC_012194.1. The conserved inverted repeat sequence 5′–TTTATTAGTATACTAATAAA is outlined. (D) Alignments of the tail-to-tail and head-to-head junctions reveals a variable 18-bp sequence in between the conserved inverted repeats. (E and F) Predicted hairpin structures are shown for each end of lp54. The loop sequence for each hairpin is underlined in panel D.