TABLE 1.

Structures of the different oligonucleotides used in this study

Oligonucleotide	Structure or sequencea
LacZF	79-nt homology extension (from positions 366734 to 366655) at the 5′ end of the lacI gene and the 20-nt priming sequence (pS1) for pKD3 (6)
GapZF	59-nt homology extension (positions 1860478 to 1860536) from the yeaA-gapA intergenic region and the same 20-nt pS1 priming sequence as that in LacZF
LacZR	39-nt homology extension from +1 of the transcription start site to the ATG of lacZ (positions 365529 to 365567) and 42 nt of the short GI promoter sequence (9) from 4 bp upstream of the −35 site to 8 bp downstream of the −10 site, degenerated at the last base of the −35 site (TTGACH) (where H is A, C, or T) and the priming sequence (pS2) for pKD3 (6)
LacZRT	Identical to LacZR without the degeneration of the last base of the −35 site (TTGACA)
LacZRBSR	60-nt homology extension to lacZ after the start codon (positions 362455 to 362512) and 40-nt homology extension to the lacZR oligonucleotide. This oligonucleotide is degenerated in the RBS sequence (AGYAY, where Y is G or A) and in the start codon sequence (ATG degenerated at the A position to a G or a T)
LacZRBS2R	58-nt homology extension to lacZ after the start codon and 42-nt homology extension to the lacR oligonucleotide, including a degenerated RBS sequence (AAYYAGGAAA) from the 15th to the 5th nt upstream of the start codon (where Y is G or A) (18)
LacZmRNA	43-nt homology extension of lacZ downstream of the RBS site, 34 nt of an mRNA-stabilizing structure, and a 23-nt homology extension to the lacZR oligonucleotide upstream of +1 of the transcription start site. This oligonucleotide is degenerated in the mRNA-stabilizing sequence (1) as follows: in GGTCGAGTTATCTCGAGTGAGATATTGTTGACG, there is degeneration of the 1st G and the 2nd G to a C, of the 4th C to a G, and of the 7th G to a C.
GapR	38-nt homology extension from +3 relative to the transcription start site of P1 (natural gapA promoter [3]) to the ATG start codon of gapA, 42 nt of the short GI promoter sequence (9), from 4 bp upstream of the −35 site to 8 bp downstream of the −10 site, degenerated at the last base of the −35 site (TTGACH) (wherein H is A, C, or T) and the priming sequence (pS2) for pKD3 (6)
LacseqF	GGCTGCGCAACTGTTGGGAA(positions 365367 to 365386)
LacseqR	CATTGAACAGGCAGCGGAAAAG (positions 366915 to 366934)
GapseqR	AGTCATATATTCCACCAGCTATTTGTTAGTG (positions 1860770 to 1860800)
GapseqF	GTCGACAAACGCTGGTATACCTCA (positions 1859940 to 1859963)

^ant, nucleotide.