Taxonomy and systematics of the fungus-growing ant associate Escovopsis (Hypocreaceae)

QV Montoya; MJS Martiarena; A Rodrigues

doi:10.3114/sim.2023.106.06

. 2023 Nov 15;106:349–397. doi: 10.3114/sim.2023.106.06

Taxonomy and systematics of the fungus-growing ant associate Escovopsis (Hypocreaceae)

QV Montoya ^1,^*, MJS Martiarena ¹, A Rodrigues ^1,^*

PMCID: PMC10825746 PMID: 38298572

Abstract

Abstract: Escovopsis is a symbiont of fungus-growing ant colonies. Unstandardised taxonomy prevented the evaluation of the morphological diversity of Escovopsis for more than a century. The aim of this study is to create a standardised taxonomic framework to assess the morphological and phylogenetic diversity of Escovopsis. Therefore, to set the foundation for Escovopsis taxonomy and allow interspecific comparisons within the genus, we redescribe the ex-type cultures of Escovopsis aspergilloides, E. clavata, E. lentecrescens, E. microspora, E. moelleri, E. multiformis, and E. weberi. Thus, based on the parameters adopted in this study combined with phylogenetic analyses using five molecular markers, we synonymize E. microspora with E. weberi, and introduce 13 new species isolated from attine nests collected in Argentina, Brazil, Costa Rica, Mexico, and Panama: E. breviramosa, E. chlamydosporosa, E. diminuta, E. elongatistipitata, E. gracilis, E. maculosa, E. papillata, E. peniculiformis, E. phialicopiosa, E. pseudocylindrica, E. rectangula, E. rosisimilis, and E. spicaticlavata. Our results revealed a great interspecific morphological diversity throughout Escovopsis. Notwithstanding, colony growth rates at different temperatures, as well as vesicle shape, appear to be the most outstanding features distinguishing species in the genus. This study fills an important gap in the systematics of Escovopsis that will allow future researchers to unravel the genetic and morphological diversity and species diversification of these attine ant symbionts.

Taxonomic novelties: New species: Escovopsis breviramosa Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, E. chlamydosporosa Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, E. diminuta Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, E. elongatistipitata Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, E. gracilis Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, E. maculosa Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, E. papillata Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, E. peniculiformis Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, E. phialicopiosa Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, E. pseudocylindrica Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, E. rectangula Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, E. rosisimilis Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, E. spicaticlavata Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues.

Citation: Montoya QV, Martiarena MJS, Rodrigues A (2023). Taxonomy and systematics of the fungus-growing ant associate Escovopsis (Hypocreaceae). Studies in Mycology 106: 349–397. doi: 10.3114/sim.2023.106.06

Keywords: fungus-growing ants, Hypocreaceae, new taxa, symbiosis, systematics, taxonomic diversity

INTRODUCTION

The genus Escovopsis (Ascomycota: Sordariomycetes, Hypocreales, Hypocreaceae) is a common inhabitant of fungus-growing ant colonies (Formicidae: Myrmicinae: Attini: Attina, often known as the “attines”) that have co-evolved with these insects (Currie et al. 2003, Yek et al. 2012, Gotting et al. 2022). Attine colonies are a model system for studies on symbiosis and evolution (Mueller et al. 1998, Mueller & Gerardo 2002, Caldera et al. 2009) because the evolutionary success of these ants is directly influenced by microorganisms. Therefore, establishing Escovopsis taxonomy is necessary to interpret the impact of species diversity in the genus and roles played by these fungi in the symbiotic network that enabled the evolutionary success of attines. However, since the discovery of Escovopsis by Möller (1893), the assessment of the morphological diversity of the genus has been almost completely neglected, and the absence of a taxonomic framework continues to limit the description of new species (Montoya et al. 2019, 2021).

Thus far, 12 Escovopsis species have been described (Muchovej & Della Lucia 1990, Seifert et al. 1995, Augustin et al. 2013, Marfetán et al. 2019, Montoya et al. 2019). However, an evaluation of morphological characters in the genus is extremely difficult because the cultivation media used to assess cultural and microscopic morphology differ in each study, and most descriptions are based on only one or a few isolates of each species. For example, in the case of E. weberi, the type species of the genus (Muchovej & Della Lucia 1990), features of colonies grown on culture media are still unknown, and its microscopic morphology is still not fully described (Augustin et al. 2013).

The first step towards standardization of parameters to describe Escovopsis species was provided by Seifert et al. (1995), who described colonies of E. aspergilloides on malt extract agar (MEA) and Czapek yeast agar (CYA), typically used in descriptions of Penicillium and Aspergillus species (Samson et al. 2014, Visagie et al. 2014), together with potato dextrose agar (PDA), widely used for other fungi in Hypocreaceae. Micromorphology was described from colonies grown on MEA, the standard then used for Penicillium and Aspergillus. However, the conditions used to assess the morphology of subsequent species descriptions of Escovopsis lentecrescens, E. microspora, and E. moelleri (Augustin et al. 2013); as well as E. atlas, E. catenulata, E. longivesica, E. primorosea, and E. pseudoweberi (Marfetán et al. 2019) varied from those used by Seifert et al. (1995). Although E. clavata and E. multiformis were described according to Seifert et al. (1995) and Augustin et al. (2013), morphological comparisons of these species with the other described are confounded by the use of different media (Montoya et al. 2019).

The value of standardizing cultivation media, a uniform set of diagnostic and descriptive characters, accompanied by a comprehensive reference set of diagnostic DNA sequences, has been demonstrated, for example, by the adoption of such protocols by the communities of taxonomists working on the taxonomy of Penicillium and Aspergillus (Samson et al. 2014, Visagie et al. 2014). In these genera, the standardised approach has facilitated the description of many new species by taxonomists from laboratories all around the world.

This study proposes a standardised taxonomic framework for Escovopsis species delimitation, based on the combination of macroscopic characters using three different media and a consistent set of micromorphological characters, with phylogenetic analyses using a set of five molecular markers, following Genealogical Concordance Phylogenetic Species Recognition (GCPSR) (Taylor et al. 2000). This approach will provide a solid ground for identifying species in the genus. In addition, following these standards, thirteen new Escovopsis species are proposed here.

MATERIALS AND METHODS

Sampling and strains

We used 138 Escovopsis strains, including ex-type cultures of E. aspergilloides, E. clavata, E. lentecrescens, E. microspora, E. moelleri, E. multiformis, and E. weberi (Table 1). The ex-type material of the five species from Argentina described by Marfetán et al. (2019) were unavailable and we did not obtain any isolates that we could identify as these species, so it was not possible to include them in our study. Of the 138 isolates, 86 were obtained from previous studies (Currie et al. 2003, Augustin et al. 2013, Meirelles et al. 2015a, b, Montoya et al. 2019, 2021) whereas the remaining 52 isolates were obtained from attine nests collected in Argentina, Brazil, Costa Rica, Mexico, and Panama (Table 1). For isolating cultures in this study, we followed the methods published in Montoya et al. (2019). Briefly, ant garden fragments (0.5–1 mm³) were inoculated onto PDA (Neogen^® Culture Media, Lansing, USA) supplemented with 150 μg/mL of chloramphenicol (Sigma-Aldrich, St. Louis, USA). We inoculated three plates for each ant fungus garden and seven garden fragments per plate. The plates were incubated at 25 °C in darkness and monitored daily for seven days. When Escovopsis mycelia were grown, they were transferred to new PDA plates without chloramphenicol and finally axenic cultures were obtained by single conidial isolation.

Table 1 .

Isolates and their associated metadata used in the phylogenetic analysis of Escovopsis based on five gene markers (Figs 3, S1). In addition to 138 isolates of Escovopsis spp., Sympodiorosea kreiselii CBS 139320 was used as the outgroup.

Fungal species name	Isolate ID	Specimen voucher	City, State, Country	Geographical coordinates	Habitat	GenBank accessions					References
ITS	LSU	tef1	rpb1	rpb2
E. aspergilloides	CBS 423.93^ET	DAOM:216382	Trinidad and Tobago: Trinidad	–	Fungus garden of Trachymyrmex ruthae	NR_137160	KF293283	AY172632	MT305421	MT305546	Augustin et al. (2013); Currie et al. (2003); Montoya et al. (2021)
E. breviramosa	CBS 149741^T	LESF 055; AR022	Camacan, Bahia, Brazil	15°23’43.0’’S 39°33’49.1’’W	Fungus garden of Acromyrmex sp.	KM817044	OQ589727	KM817114	OQ596350	OQ603820	Meirelles et al. (2015b); This study
	LESF 039^$	RS019	Nova Petrópolis, Rio Grande do Sul, Brazil	29°22’38.2’’S 50°57’18.1’’W	Fungus garden of Acromyrmex ambiguus	KM817076	OQ589725	EU082802	OQ596348	OQ603818	Meirelles et al. (2015b); This study
	LESF 040	RS020	Nova Petrópolis, Rio Grande do Sul, Brazil	29°19’05.9’’S 51°10’13.6’’W	Fungus garden of Acromyrmex laticeps	KM817077	OQ589721	EU082803	OQ596344	OQ603814	Meirelles et al. (2015b); This study
	LESF 041	RS030	São Marcos, Rio Grande do Sul, Brazil	28°58’02.8’’S 51°08’08.8’’W	Fungus garden of Acromyrmex lundii	KM817078	OQ589728	EU082795	OQ596351	OQ603821	Meirelles et al. (2015b); This study
	LESF 045	RS076	Vacaria, Rio Grande do Sul, Brazil	28°27’51.7”S 50°53’07.0”W	Fungus garden of Acromyrmex coronatus	KM817082	OQ589726	EU082801	OQ596349	OQ603819	Meirelles et al. (2015b); This study
	LESF 316	ES001	Rio Claro, São Paulo, Brazil	22°23’46.0”S 47°32’43.2”W	Fungus garden of Mycetomoellerius sp.	KM817052	OQ589720	KM817122	OQ596343	OQ603813	Meirelles et al. (2015b); This study
E. chlamydosporosa	CBS 149748^T	LESF 984; QVM71	Novo Airão, Amazonas, Brazil	2°31’25.6”S 60°49’32.4”W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589809	OQ589759	OQ603902	OQ596382	OQ603852	This study
	LESF 1000	QVM87	Novo Airão, Amazonas, Brazil	–	Fungus garden of Acromyrmex sp.	OQ589814	OQ589764	OQ603907	OQ596387	OQ603857	This study
	LESF 1001	QVM88	Novo Airão, Amazonas, Brazil	2°32’01.4’’S 60°50’00.4’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589799	OQ589749	OQ603892	OQ596372	OQ603842	This study
	LESF 1002	QVM89	Novo Airão, Amazonas, Brazil	2°32’01.4’’S 60°50’00.4’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589800	OQ589750	OQ603893	OQ596373	OQ603843	This study
	LESF 1026^$	QVM154	Manaus, Amazonas, Brazil	2°26’52.56”S 59°45’53.4”W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589807	OQ589757	OQ603900	OQ596380	OQ603850	This study
	LESF 961^$	QVM48	Novo Airão, Amazonas, Brazil	2°16’15.7’’S 61°01’8.46’’W	Fungus garden of Acromyrmex sp.	OQ589801	OQ589751	OQ603894	OQ596374	OQ603844	This study
	LESF 963^$	QVM50	Novo Airão, Amazonas, Brazil	2°16’15.7’’S 61°01’8.46’’W	Fungus garden of Acromyrmex sp.	OQ589802	OQ589752	OQ603895	OQ596375	OQ603845	This study
	LESF 966	QVM53	Novo Airão, Amazonas, Brazil	2°16’14.5’’S 61°01’6.8’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589803	OQ589753	OQ603896	OQ596376	OQ603846	This study
	LESF 967	QVM54	Novo Airão, Amazonas, Brazil	2°16’14.5’’S 61°01’6.8’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589804	OQ589754	OQ603897	OQ596377	OQ603847	This study
	LESF 970	QVM57	Novo Airão, Amazonas, Brazil	2°31’23.4’’S 60°49’31.9’’W	Fungus garden of Apterostigma sp.	OQ589794	OQ589744	OQ603887	OQ596367	OQ603837	This study
	LESF 971	QVM58	Novo Airão, Amazonas, Brazil	–	Fungus garden of Acromyrmex sp.	OQ589795	OQ589745	OQ603888	OQ596368	OQ603838	This study
	LESF 972	QVM59	Novo Airão, Amazonas, Brazil	–	Fungus garden of Apterostigma sp.	OQ589796	OQ589746	OQ603889	OQ596369	OQ603839	This study
	LESF 974	QVM61	Novo Airão, Amazonas, Brazil	–	–	OQ589797	OQ589747	OQ603890	OQ596370	OQ603840	This study
	LESF 976	QVM63	Novo Airão, Amazonas, Brazil	–	–	OQ589808	OQ589758	OQ603901	OQ596381	OQ603851	This study
	LESF 977	QVM64	Novo Airão, Amazonas, Brazil	–	–	OQ589811	OQ589761	OQ603904	OQ596384	OQ603854	This study
	LESF 978	QVM65	Novo Airão, Amazonas, Brazil	–	–	OQ589812	OQ589762	OQ603905	OQ596385	OQ603855	This study
	LESF 981	QVM68	Novo Airão, Amazonas, Brazil	–	Fungus garden of attini	OQ589805	OQ589755	OQ603898	OQ596378	OQ603848	This study
	LESF 982	QVM69	Novo Airão, Amazonas, Brazil	–	Fungus garden of attini	OQ589806	OQ589756	OQ603899	OQ596379	OQ603849	This study
	LESF 986	QVM73	Novo Airão, Amazonas, Brazil	2°31’.25.3’’S 60°49’33.1’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589798	OQ589748	OQ603891	OQ596371	OQ603841	This study
	LESF 991^$	QVM78	Novo Airão, Amazonas, Brazil	2°31’26.04”S 60°49’31.62”W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589813	OQ589763	OQ603906	OQ596386	OQ603856	This study
	LESF 995	QVM82	Novo Airão, Amazonas, Brazil	–	Fungus garden of Acromyrmex sp.	OQ589810	OQ589760	OQ603903	OQ596383	OQ603853	This study
E. clavata	CBS 145326 ^ET	LESF 853; 1707	Florianópolis, Santa Catarina, Brazil	27°44’39.6’’S 48°31’10.14’’W	Fungus garden of Apterostigma sp.	MH715096	MH715110	MH724270	MT305419	MT305544	Montoya et al. (2019, 2021)
	LESF 854^$	1704A	Florianópolis, Santa Catarina, Brazil	27°44’38.94’’S 48°31’9.3’’W	Fungus garden of Apterostigma sp.	MH715097	MH715111	MH724271	MT305495	MT305620	Montoya et al. (2019, 2021)
	LESF 855^$	1705B	Florianópolis, Santa Catarina, Brazil	27°44’39.49’’S 48°31’9.72’’W	Fungus garden of Apterostigma sp.	MH715098	MH715112	MH724272	MT305496	MT305621	Montoya et al. (2019, 2021)
E. diminuta	CBS 149747^T	LESF 969; QVM56	Novo Airão, Amazonas, Brazil	2°31’23.4’’S 60°49’31.9’’W	Fungus garden of Trachymyrmex sp. sensu lato	MT273476	MT273565	MT305385	MT305509	MT305634	Montoya et al. (2021)
	LESF 1003^$	QVM90	Novo Airão, Amazonas, Brazil	2°32’1.4’’S 60°50’0.4’’W	Fungus garden of Trachymyrmex sp. sensu lato	MT273482	MT273571	MT305391	MT305515	MT305640	Montoya et al. (2021)
	LESF 996^$	QVM83	Novo Airão, Amazonas, Brazil	2°32’02.7’’S 60°50’11.7’’W	Fungus garden of Apterostigma sp.	MT273480	MT273569	MT305389	MT305513	MT305638	Montoya et al. (2021)
	LESF 997	QVM84	Novo Airão, Amazonas, Brazil	2°31’23.4’’S 60°49’31.9’’W	Fungus garden of Trachymyrmex sp. sensu lato	MT273481	MT273570	MT305390	MT305514	MT305639	Montoya et al. (2021)
E. elongatistipitata	CBS 149750 ^T	LESF 999; QVM86	Novo Airão, Amazonas, Brazil	2°31’23.4’’S 60°49’31.9’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589831	OQ589781	OQ603924	OQ596404	OQ603874	This study
	LESF 1021^$	QVM149	Manaus, Amazonas, Brazil	2°26’’54.3’’S 59°45’53.9’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589829	OQ589779	OQ603922	OQ596402	OQ603872	This study
	LESF 985^$	QVM72	Novo Airão, Amazonas, Brazil	2°31’26.8’’S 60°49’28.4’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589830	OQ589780	OQ603923	OQ596403	OQ603873	This study
	–	QVM285⁺	Novo Airão, Amazonas, Brazil	2°31’23,4’’S 60°49’31.9’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ708429	OQ708420	OQ709465	OQ709447	OQ709456	This study
	–	QVM286⁺	Novo Airão, Amazonas, Brazil	2°31’25.3’’S 60°49’33.1’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ708430	OQ708421	OQ709466	OQ709448	OQ709457	This study
E. gracilis	CBS 149743^T	LESF 325; BA004	Camacan, Bahia, Brazil	14°47’56.8’’S 39°10’16.4’’W	Fungus garden of Atta cephalotes	KM817049	MH715127	KM817119	MT305467	MT305592	Meirelles et al. (2015b); Montoya et al. (2019, 2021)
	LESF 843^$	B120301; BA003	Camacan, Bahia, Brazil	14°47’51.18’’S 39°10’17.4’’W	Fungus garden of Atta cephalotes	KM817048	OQ589722	KM817118	OQ596345	OQ603815	Meirelles et al. (2015b); This study
	LESF 844^$	B410301; BA005	Camacan, Bahia, Brazil	15°23’14.82’’S39°33’28.38’’W	Fungus garden of Atta cephalotes	KM817050	OQ589723	KM817120	OQ596346	OQ603816	Meirelles et al. (2015b); This study
E. lentecrescens	CBS 135750 ^T	AUJ9	Viçosa, Minas Gerais, Brazil	–	Fungus garden of Acromyrmex subterraneus molestans	JQ815079	JQ855717	JQ855714	MT305415	MT305540	Augustin et al. (2013); Montoya et al. (2021)
E. maculosa	CBS 149746^T	LESF 962; QVM49	Novo Airão, Amazonas, Brazil	2°16’15.7’’S 61°01’8.5’’W	Fungus garden of Acromyrmex sp.	MT273475	MT273564	MT305384	MT305508	MT305633	Montoya et al. (2021)
	–	QVM281⁺	Novo Airão, Amazonas, Brazil	2°31’32.2’’S 60°49’35.5’’W	Fungus garden of Acromyrmex sp.	OQ708425	OQ708416	OQ709461	OQ709443	OQ709452	This study
	–	QVM282⁺	Novo Airão, Amazonas, Brazil	–	Fungus garden of Acromyrmex sp.	OQ708426	OQ708417	OQ709462	OQ709444	OQ709453	This study
	–	QVM283⁺	Novo Airão, Amazonas, Brazil	2°36’37.9’’S 60°52’34.4’’W	Fungus garden of Acromyrmex sp.	OQ708427	OQ708418	OQ709463	OQ709445	OQ709454	This study
	–	QVM284⁺	Novo Airão, Amazonas, Brazil	2°32’2.1’’S 60°50’6.1’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ708428	OQ708419	OQ709464	OQ709446	OQ709455	This study
E. microspora (now E. weberi)	CBS 135751^ET	VIC:31756	Viçosa, Minas Gerais, Brazil	20°44’31.71’’S42°52’43.83’’W	Fungus garden of Acromyrmex subterraneus molestans	JQ815076	KF293284	KJ935030	MT305416	MT305541	Augustin et al. (2013); Meirelles et al. (2015a); Montoya et al. (2021)
E. moelleri	CBS 135748 ^ET	VIC:31753	Viçosa, Minas Gerais, Brazil	20°44’31.71’’S42°52’43.83’’W	Fungus garden of Acromyrmex subterraneus molestans	JQ815077	JQ855715	JQ855712	MT305413^#	MT305538^#	Augustin et al. (2013); Meirelles et al. (2015a); Montoya et al. (2021)
E. multiformis	CBS 145327 ^ET	LESF 847	Florianópolis, Santa Catarina, Brazil	27°28’11.28’’S48°22’39.48’’W	Fungus garden of Apterostigma sp.	MH715091	MH715105	MH724265	MT305420	MT305545	Montoya et al. (2019, 2021)
	LESF 1007	QVM135	Florianópolis, Santa Catarina, Brazil	27°35’27.8”S 48°28’27.4”W	Fungus garden of attine ant	OQ589837	OQ589787	OQ603930	OQ596410	OQ603880	This study
	LESF 1134	QVM275	Cotrigaçu, Mato Grosso, Brazil	9°49’25.1’’S 58°15’22.1’’W	Fungus garden of Apterostigma sp	OQ589833	OQ589783	OQ603926	OQ596406	OQ603876	This study
	LESF 1135	QVM276	Cotrigaçu, Mato Grosso, Brazil	9°50’32.0’’S 58°15’12.7’’W	Fungus garden of Apterostigma sp.	OQ589834	OQ589784	OQ603927	OQ596407	OQ603877	This study
	LESF 1136^$	QVM277	Alta Floresta, Mato Grosso, Brazil	09°49’22.7’’S 58°15’32.0’’W	Fungus garden of Apterostigma sp.	MH715092	MH715106	MH724266	MT305536	MT305661	Montoya et al. (2019, 2021)
	LESF 849	1612	Florianópolis, Santa Catarina, Brazil	27°35’18.6’’S 48°22’20.8’’W	Fungus garden of Apterostigma sp.	OQ589832	OQ589782	OQ603925	OQ596405	OQ603875	This study
	LESF 850	1703	Florianópolis, Santa Catarina, Brazil	277°44’38.9’’S 48°31’9.3’’W	Fungus garden of Apterostigma sp.	OQ589835	OQ589785	OQ603928	OQ596408	OQ603878	This study
	LESF 852	1706B	Florianópolis, Santa Catarina, Brazil	27°44’39.4’’S 48°31’10.0’’W	Fungus garden of Apterostigma sp.	MT273460	MT273549	MT305372	MT305494	MT305619	Montoya et al. (2021)
	LESF 884	U42	Argentina	–	Fungus garden of Apterostigma sp.	OQ589838	OQ589788	OQ603931	OQ596411	OQ603881	This study
E. papillata	CBS 149745^T	LESF 960; QVM47	Novo Airão, Amazonas, Brazil	2°31’25.8’’S 60°49’28.62’’W	Fungus garden of Apterostigma sp.	OQ589840	OQ589790	OQ603933	OQ596413	OQ603883	This study
	LESF 959	QVM46	Novo Airão, Amazonas, Brazil	2°31’25.8’’S 60°49’28.62’’W	Fungus garden of Apterostigma sp.	OQ589839	OQ589789	OQ603932	OQ596412	OQ603882	This study
E. peniculiformis	CBS 149744^T	LESF 876; UT008	Gamboa - Panama	–	Fungus garden of Atta colombica	KM817101	OQ589724	KM817162	OQ596347	OQ603817	Meirelles et al. 2015b); This study
	LESF 297^$	RC005	Austin, Texas, USA	30°22’9.9”S 97°47’49.8”W	Fungus garden of Trachymyrmex turrifex	OQ589792	OQ589742	OQ603885	OQ596365	OQ603835	This study
	LESF 878^$	U59	Panama	–	Fungus garden of Apterostigma sp. G4	OQ589793	OQ589743	OQ603886	OQ596366	OQ603836	This study
	LESF 881	U51	Panama	–	Fungus garden of attine ant	OQ589836	OQ589786	OQ603929	OQ596409	OQ603879	This study
E. phialicopiosa	CBS 149738^T	LESF 048; SES005	Uberlândia, Minas Gerais, Brazil	19°17’17.5”S 48°39’40.2”W	Fungus garden of Trachymyrmex sp. sensu lato	KM817088	OQ589739	KF240731	OQ596362	OQ603832	Meirelles et al. (2015b); This study
	LESF 021^$	ES002	Rio Claro, São Paulo, Brazil	–	Fungus garden of Atta sexdens rubropilos	OQ589828	OQ589778	OQ603921	OQ596401	OQ603871	This study
	LESF 047^$	SES002	Fazenda Pau, Goias, Brazil	–	Fungus garden of Trachymyrmex sp. sensu lato	KM817085	OQ589737	KM817147	OQ596360	OQ603830	Meirelles et al. (2015b); This study
	LESF 106^$	SES006	Uberlândia, Minas Gerais, Brazil	19°17’17.5”S 48°39’40.2”W	Fungus garden of Mycetomoellerius dichrous	KM817089	OQ589738	KM817150	OQ596361	OQ603831	Meirelles et al. (2015b); This study
E. pseudocylindrica	CBS 149749^T	LESF 993; QVM80	Novo Airão, Amazonas, Brazil	2°31’29.64’’S 60°49’28.92’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589819	OQ589769	OQ603912	OQ596392	OQ603862	This study
	LESF 1018	QVM146	Manaus, Amazonas, Brazil	2°26’55.1’’S 59°46’16.38W	Fungus garden of Apterostigma sp.	OQ589820	OQ589770	OQ603913	OQ596393	OQ603863	This study
	LESF 1024	QVM152	Manaus, Amazonas, Brazil	2°26’52.6’’S 59°45’53.4’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589821	OQ589771	OQ603914	OQ596394	OQ603864	This study
	LESF 1029^$	QVM157	Manaus, Amazonas, Brazil	2°26’55.5’’S 59°45’54.2’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ589818	OQ589768	OQ603911	OQ596391	OQ603861	This study
E. rectangula	CBS 149739^T	LESF 050; SES008	RO	–	Fungus garden of Acromyrmex sp.	KM817091	OQ589729	KM817152	OQ596352	OQ603822	Meirelles et al. (2015b); This study
	LESF 022^$	ES003	Frei Caneca, Pernambuco, Brazil	–	Fungus garden of Atta cephalotes	KM817054	OQ589736	KM817124	OQ596359	OQ603829	Meirelles et al. (2015b); This study
	LESF 032	ES008	Santarém, Pará, Brazil	–	Fungus garden of Acromyrmex sp.	KM817059	OQ589734	KM817129	OQ596357	OQ603827	Meirelles et al. (2015b); This study
	LESF 038	RS004	Registro, Santa Catarina, Brazil	28°45’52.5’’S 49°17’32.2’’W	Fungus garden of Acromyrmex coronatus	OQ589816	OQ589766	OQ603909	OQ596389	OQ603859	This study
	LESF 318	ES029	Palmas, Tocantins, Brazil	10°10’37.6”S 48°18’23.7”W	Fungus garden of Acromyrmex sp.	KM817069	OQ589732	KM817139	OQ596355	OQ603825	Meirelles et al. (2015b); This study
	LESF 326^$	BA006	Ilhéus, Bahia, Brazil	14°47’56.8’’S 39°10’16.4’’W	Fungus garden of Atta cephalotes	KM817051	OQ589733	KM817121	OQ596356	OQ603826	Meirelles et al. (2015b); This study
	LESF 860	U35	Panama	–	–	OQ589815	OQ589765	OQ603908	OQ596388	OQ603858	This study
	LESF 863^$	U31	Panama	–	Fungus garden of Apterostigma dentigerum	OQ589791	OQ589741	OQ603884	OQ596364	OQ603834	This study
	LESF 865^$	UT001	Guadalupe Island, Mexico	–	Fungus garden of Acromyrmex octospinosus	KM817094	OQ589735	KM817155	OQ596358	OQ603828	Meirelles et al. (2015b); This study
	LESF 883	UT005	Argentina	–	Fungus garden of Acromyrmex sp.	KM817098	OQ589730	KM817159	OQ596353	OQ603823	Meirelles et al. (2015b); This study
	LESF 892	UT020	México	–	Fungus garden of Trachymyrmex sp. sensu lato	KM817112	OQ589731	KM817173	OQ596354	OQ603824	Meirelles et al. (2015b); This study
E. rosisimilis	CBS 149742^T	LESF 135; SES003	Uberlândia, Minas Gerais, Brazil	19°17’17.5”S 48°39’40.2”W	Fungus garden of Trachymyrmex sp. sensu lato	KM817086	OQ589740	KM817148	OQ596363	OQ603833	Meirelles et al. (2015b); This study
	–	QVM287⁺	Novo Airão, Amazonas, Brazil	2°34’49.1’’S 61°02’2.7’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ708431	OQ708422	OQ709467	OQ709449	OQ709458	This study
	–	QVM288⁺	Novo Airão, Amazonas, Brazil	2°55’46.3’’S 59°58’28.3’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ708432	OQ708423	OQ709468	OQ709450	OQ709459	This study
	–	QVM289⁺	Novo Airão, Amazonas, Brazil	2°31’32.2S 60°49’35.5’’W	Fungus garden of Trachymyrmex sp. sensu lato	OQ708433	OQ708424	OQ709469	OQ709451	OQ709460	This study
Escovopsis sp.	LESF 049	SES007	Uberlandia, Minas Gerais, Brazil	–	Fungus garden of Trachymyrmex sp. sensu lato	KM817090	OQ589719	KM817151	OQ596342	OQ603812	Meirelles et al. (2015b); This study
E. spicaticlavata	CBS 149740^T	LESF 052; SES010	Manaus, Amazonas, Brazil	2°26’54.84’’S 59°46’10.02’’W	Fungus garden of Paratrachymyrmex diversus	KM817093	MH715124	KM817154	MT305437	MT305562	Meirelles et al. (2015b); Montoya et al. (2019)
	LESF 975^$	QVM62	Novo Airão, Amazonas, Brazil	2°31’25.3’’S 60°49’33.1’’W	Fungus garden of Trachymyrmex sp. sensu lato	MT273477	MT273566	MT305386	MT305510	MT305635	Montoya et al. (2021)
	LESF 979^$	QVM66	Novo Airão, Amazonas, Brazil	–	Fungus garden of Trachymyrmex sp. sensu lato	MT273478	MT273567	MT305387	MT305511	MT305636	Montoya et al. (2021)
E. weberi	ATCC 64542 ^ET	–	Viçosa, Minas Gerais, Brazil	–	Carpenter ant fungal mass	KF293285	KF293281	MZ170961	MT305412	MT305537	Augustin et al. 2013); Montoya et al. (2021)
	LESF 017	NL001	Botucatu, São Paulo, Brazil	22°50’46.44’’S 48°26’9.6’’W	Midden of Atta capiguara	KM817072	MH715113	KM817142	MT305422	MT305547	Meirelles et al. (2015b); Montoya et al. (2021)
	LESF 019^$	NL005	Botucatu, São Paulo, Brazil	22°50’45.8’’S 48°26’09.4’’W	Fungus garden of Atta sexdens rubropilosa	KM817074	MH715115	KM817144	MT305423	MT305548	Meirelles et al. 2015b); Montoya et al. (2021)
	LESF 020	NL006	Botucatu, São Paulo, Brazil	22°50’45.8’’S 48°26’09.4’’W	Fungus garden of Atta sexdens rubropilosa	MT273425	MT273503	MT305340	MT305424	MT305549	Montoya et al. (2021)
	LESF 023^$	ES005	Alta Floresta, Mato Grosso, Brazil	–	Fungus garden of Atta cephalotes	KM817056	MH715117	KM817126	MT305425	MT305550	Meirelles et al. (2015b); Montoya et al. (2019)
	LESF 024	ES006	Alta Floresta, Mato Grosso, Brazil	–	Fungus garden of Acromyrmex coronatus	KM817057	MT273504	KM817127	MT305426	MT305551	Montoya et al. (2019, 2021)
	LESF 025	ES007	Alta Floresta, Mato Grosso, Brazil	–	Fungus garden of Acromyrmex coronatus	KM817058	MT273505	KM817128	MT305427	MT305552	Montoya et al. (2019, 2021)
	LESF 027	ES010	Rio Claro, São Paulo, Brazil	–	Fungus garden of Acromyrmex landolti	KM817061	MH715119	KM817131	MT305428	MT305553	Meirelles et al. (2015b); Montoya et al. (2019)
	LESF 029	ES012	Corumbataí, São Paulo, Brazil	22°17’22’’S 47°39’23’’W	Fungus garden of Atta sexdens	KM817063	MH715120	KM817133	MT305429	MT305554	Meirelles et al. (2015b); Montoya et al. (2019, 2021)
	LESF 030	ES013	Corumbataí, São Paulo, Brazil	22°17’22’’S 47°39’23’’W	Fungus garden of Atta sexdens	KM817064	MH715121	KM817134	MT305430	MT305555	Meirelles et al. (2015b); Montoya et al. (2019, 2021)
	LESF 031^$	ES014	Corumbataí, São Paulo, Brazil	22°17’22’’S 47°39’23’’W	Fungus garden of Atta sexdens	MT273426	MT273506	MT305341	MT305431	MT305556	Montoya et al. (2021)
	LESF 033	ES004	Bahia, Brazil	–	Fungus garden of Acromyrmex sp.	KM817055	MT273507	KM817125	MT305432	MT305557	Meirelles et al. (2015b); Montoya et al. (2021)
	LESF 034	ES024	Botucatu, São Paulo, Brazil	–	Fungus garden of Acromyrmex balzanii	MT273427	MT273508	MT305342	MT305433	MT305558	Montoya et al. (2021)
	LESF 042^$	RS053	Chuvisca, Rio Grande do Sul, Brazil	30°50’10.2”S 51°55’10.4”W	Fungus garden of Acromyrmex lundii	KM817079	MT273509	EU082797	MT305434	MT305559	Meirelles et al. (2015b); Montoya et al. (2021)
	LESF 043^$	RS055	Chuvisca, Rio Grande do Sul, Brazil	30°50’10.2”S 51°55’10.4”W	Fungus garden of Acromyrmex heyeri	KM817080	MT273510	EU082796	MT305435	MT305560	Meirelles et al. (2015b); Montoya et al. (2021)
	LESF 046	SES001	Rio Claro, São Paulo, Brazil	22°23’45.9’’S 47°32’43.2’’W	Fungus garden of Trachymyrmex sp. sensu lato	KM817084	MT273511	KM817146	MT305436	MT305561	Meirelles et al. (2015b); Montoya et al. (2021)
	LESF 054^$	AR003	Ilhéus, Bahia, Brazil	14°47’56.8’’S 39°10’16.4’’W	Fungus garden of Acromyrmex balzanii	KM817043	MT273512	KM817113	MT305438	MT305563	Meirelles et al. (2015b); Montoya et al. (2021)
	LESF 056	AR033	Camacan, Bahia, Brazil	15°22’50.3’’S 39°34’03.5’’W	Fungus garden of Acromyrmex sp.	KM817045	MT273513	KM817115	MT305439	MT305564	Meirelles et al. (2015b); Montoya et al. (2021)
	LESF 136	4a	Corumbataí, São Paulo, Brazil	22°17’21.7’’S 47°39’22.8’’W	Fungus garden of Atta sexdens rubropilosa	MT273428	MT273514	MT305343	MT305440	MT305565	Montoya et al. (2021)
	LESF 146	1cT4	Corumbataí, São Paulo, Brazil	22°17’21.7’’S 47°39’22.8’’W	Fungus garden of Atta sexdens rubropilosa	MT273429	MT273515	MT305344	MT305441	MT305566	Montoya et al. (2021)
	LESF 156^$	A088	Corumbataí, São Paulo, Brazil	22°17’21.7’’S 47°39’22.8’’W	Fungus garden of Atta sexdens rubropilosa	MT273430	MT273516	MT305345	MT305443	MT305568	Montoya et al. (2021)
	LESF 178	A086a	Corumbataí, São Paulo, Brazil	22°17’21.7’’S 47°39’22.8’’W	Fungus garden of Atta sexdens rubropilosa	MT273431	MT273517	MT305346	MT305445	MT305570	Montoya et al. (2021)
	LESF 239	13B	Corumbataí, São Paulo, Brazil	22°17’21.7’’S 47°39’22.8’’W	Fungus garden of Atta sexdens rubropilosa	MT273432	MT273518	MT305347	MT305446	MT305571	Montoya et al. (2021)
	LESF 241	H1b	Corumbataí, São Paulo, Brazil	22°17’21.7’’S 47°39’22.8’’W	Fungus garden of Atta sexdens rubropilosa	MT273433	MT273519	MT305348	MT305447	MT305572	Montoya et al. (2021)
	LESF 292^$	NL003	Botucatu, São Paulo, Brazil	22°50’46.4”S 48°26’09.6”W	Fungus garden of Atta capiguara	MT273434	MT273520	MT305349	MT305448	MT305573	Montoya et al. (2021)
	LESF 294	H33	Corumbataí, São Paulo, Brazil	22°17’21.7’’S 47°39’22.8’’W	Fungus garden of Atta sexdens rubropilosa	MT273435	MT273521	MT305350	MT305449	MT305574	Montoya et al. (2021)
	LESF 295	NL009	Botucatu, São Paulo, Brazil	22°50’45.8’’S 48°26’09.4’’W	Fungus garden of Atta sexdens rubropilosa	MT273436	MT273522	MT305351	MT305450	MT305575	Montoya et al. (2021)
	LESF 298	NL004	Botucatu, São Paulo, Brazil	22°50’46.4”S 48°26’09.6”W	Fungus garden of Atta capiguara	MT273437	MT273523	MT305352	MT305451	MT305576	Montoya et al. (2021)
	LESF 315	NL007	Botucatu, São Paulo, Brazil	22°50’45.8’’S 48°26’09.4’’W	Fungus garden of Atta sexdens rubropilosa	KM817075	MH715125	KF240730	MT305463	MT305588	Meirelles et al. (2015b); Montoya et al. (2019, 2021)
	LESF 317	ES026	Rio Claro, São Paulo, Brazil	–	Fungus garden of Trachymyrmex sp. sensu lato	KM817067	MT273531	KM817137	MT305464	MT305589	Meirelles et al. (2015b); Montoya et al. (2021)
	LESF 319	ES030	Palmas, Tocantins, Brazil	10°10’52.9”S 48°21’42.0”W	Fungus garden of Acromyrmex sp.	KM817070	MT273532	KM817140	MT305465	MT305590	Meirelles et al. (2015b); Montoya et al. (2021)
	LESF 324^$	RS105	Thermas de Santa Bárbara, São Paulo, Brazil	22°49’10.6”S 49°16’06.2”W	Fungus garden of Atta laevigata	KM817083	MT273533	KM817145	MT305466	MT305591	Meirelles et al. (2015b); Montoya et al. (2021)
	LESF 355	ES021	Corumbataí, São Paulo, Brazil	–	Fungus garden of Atta sexdens rubropilosa	MT273445	MT273534	MT305358	MT305468	MT305593	Montoya et al. (2021)
	LESF 356	ES032	Botucatu, São Paulo, Brazil	–	Fungus garden of Atta laevigata	MT273446	MT273535	MT305359	MT305469	MT305594	Montoya et al. (2021)
	LESF 359	ES019	Corumbataí, São Paulo, Brazil	–	Fungus garden of Atta sexdens	MT273447	MT273536	MT305360	MT305470	MT305595	Montoya et al. (2021)
	LESF 362	ES028	Corumbataí, São Paulo, Brazil	–	Fungus garden of Atta sexdens	MT273448	MT273537	MT305361	MT305471	MT305596	Montoya et al. (2021)
	LESF 363	ES023	Corumbataí, São Paulo, Brazil	–	Fungus garden of Atta sexdens	MT273449	MT273538	MT305362	MT305472	MT305597	Montoya et al. (2021)
	LESF 364	ES015	Corumbataí, São Paulo, Brazil	–	Fungus garden of Atta sexdens	MT273450	MT273539	MT305363	MT305473	MT305598	Montoya et al. (2021)
	LESF 519	ES016	–	–	Fungus garden of Atta sexdens rubropilosa	MT273451	MT273540	MT305364	MT305475	MT305600	Montoya et al. (2021)
	LESF 575	RS087	Indaial, Santa Catarina, Brazil	26°54’04.9”S 49°10’51.2”W	Fungus garden of Acromyrmex diciger	MT273452	MT273541	MT305365	MT305476	MT305601	Montoya et al. (2021)
	LESF 858	A210201	Camacan, Bahia, Brazil	–	Fungus garden of Atta cephalotes	MT273461	MT273550	MT305373	MT305497	MT305622	Montoya et al. (2021)
	LESF 859	B110302	Camacan, Bahia, Brazil	–	Fungus garden of Atta cephalotes	MT273462	MT273551	MT305374	MT305498	MT305623	Montoya et al. (2021)
	LESF 877	NL010	–	–	–	MT273466	MT273555	MT305376	MT305500	MT305625	Montoya et al. 2021)
	LESF 880	2aT=3	–	–	–	MT273467	MT273556	MT305377	MT305501	MT305626	Montoya et al. (2021)
	LESF 994	QVM81	Novo Airão, Amazonas, Brazil	2°36’37.9’’S 60°52’34.4’’W	Fungus garden of Acromyrmex sp.	MT273479	MT273568	MT305388	MT305512	MT305637	Montoya et al. (2021)
Sympodiorosea kreiselii	CBS 139320^ET	LESF 053	Florianópolis, Santa Catarina, Brazil	27°37’50.01’’S48°27’03.64’’W	Fungus garden of Mycetophylax morschi	KJ808767	KJ808765	KJ 808766	MT305418	MT305543	Meirelles et al. (2015a); Montoya et al. (2021)

Open in a new tab

^T Holotype; ^ET Ex-type cultures; $: strains used to assess the morphological characters of Escovopsis species; +: Inactive strains; LESF: Laboratory of Fungal Ecology and Systematics (UNESP, Rio Claro, Brazil); QVM: Quimi Vidaurre Montoya.

All Escovopsis isolates used in this study (except those that have the specimen vouchers QVM281–QVM289) are stored at the Laboratory of Fungal Ecology and Systematics [LESF– Department of General and Applied Biology, São Paulo State University (UNESP), Rio Claro, SP, Brazil] in sterile distilled water at 8–10 °C (Castellani 1963), in 10 % aqueous solution of glycerol at -80 °C (cryopreservation), and as freeze-dried in 10 % Skim Milk. Isolates that have the specimen vouchers QVM281–QVM289 were sequenced while still viable, but later they lost viability, so we were unable to preserve them (Table 1). Holotypes (metabolically inactive, freeze-dried cultures) and the ex-type cultures of the new species were also deposited at the culture collection of the Westerdijk Fungal Biodiversity Institute, Utrecht, the Netherlands (CBS) (Table 1).

Adjusting the parameters to evaluate the morphology of Escovopsis

To enable reliable comparison of cultural and micromorphological characters, we selected a set of media and optimal cultivation conditions for Escovopsis species. To do so, we recorded characters of colonies in culture, i.e., mycelium colour, morphology and presence of soluble pigments, in 21 isolates of seven Escovopsis species (including the ex-type cultures), i.e., E. aspergilloides (n = 1), E. clavata (n = 3), E. lentecrescens (n = 1), E. microspora (n = 1), E. moelleri (n = 1), E. multiformis (n = 4), and E. weberi (n = 10), using the combination of all conditions, i.e., eight media [cornmeal agar dextrose (CMD), CYA, PDA, malt agar 2 % (MA2 %), MEA, oatmeal agar (OA), potato carrot agar (PCA), and synthetic nutrient-poor agar (SNA) — Supplementary Table S1] and five temperatures (10, 20, 25, 30, 35 °C), used in previous studies (Seifert et al. 1995, Augustin et al. 2013, Masiulionis et al. 2015, Meirelles et al. 2015a, b, Montoya et al. 2019).

To standardize the inoculum (make the number of conidia in all inoculum approximately the same), we homogeneously spread 200 μL of 10⁶ conidia/mL (from 7-d-old colonies), on Petri dishes (90 × 15 mm) with water agar (WA) (Montoya et al. 2019). These Petri dishes were incubated for 7 d at 25 °C in darkness (Montoya et al. 2019). An agar plug (ca. 5 mm diam × 5 mm height) of WA with mycelium was cut and inoculated in the centre of Petri dishes (90 × 15 mm) containing each test medium, and incubated at 10, 20, 25, 30, and 35 °C. All Petri dishes were incubated unsealed to allow air exchange and better development of fungal colonies (Montoya et al. 2019). We performed three replicates for each ex-type culture at each media and temperature. Morphological characters were examined every 24 h for 14 d. From this experiment, we selected CMD (Neogen^® Culture Media, Lansing, USA), MEA [30 g/L of malt extract (Neogen^® Culture Media, Lansing, USA), 5 g/L of bacteriological peptone (Neogen^® Culture Media, Lansing, USA), 20 g/L of glucose (Labsynth, Diadema, Brazil), and 15 g/L of Agar (Neogen^® Culture Media, Lansing, USA], and PDA as the most suitable media to evaluate the macroscopic features of Escovopsis species. These media were selected based on the (i) ease to evaluate the growth rate; (ii) expression of unique phenotypic characters of each species, (iii) feasibility of comparison of morphological features of Escovopsis with other genera in the Hypocreaceae, and (iv) ease of access to media in most laboratories. To describe the colony colours, we used the standard names and codes provided by Ridgway (1912). Likewise, the optimal time for measuring the growth and evaluating the macroscopic characters of colonies were standardised based on the point at which we were able to observe the most significant differences in growth rate and morphological characters between species.

To evaluate the growth rate of the Escovopsis ex-type cultures, and the new described species, on the selected media, we grew the colonies, in quadruplicate, on each medium at 20, 25 and 30 °C, on four separate time periods for 1 wk. Measurements of the colony radius (Supplementary Table S2) were carried out on the fourth day (see the results section for details on the selected temperatures and time for growth measurements). The growth measurements shown in the descriptions of the species (taxonomy section) represent the minimum and maximum values observed among the 16 values obtained. Statistical analyses were performed in R Studio using one-way ANOVA, followed by Duncan’s multiple range test. Differences were considered significant when P ≤ 0.05.

The microscopic structures of all Escovopsis ex-type cultures, and our newly described species, i.e., conidiophores, branches of conidiophores, swollen cells of conidiophores (formed at the apex of the conidiophore and from which branches are formed), vesicles, conidiogenous cells, conidia and chlamydospores (sensu Augustin et al. 2013), their shape, size, colour, and pattern of formation and aggregation (Montoya et al. 2021), were evaluated on PDA following the method used by Montoya et al. (2019). Briefly, we carried out slide culture preparations using plugs from PDA 5 mm diam × 5 mm height, placed on microscopic slides. Then, the plugs were inoculated with conidia, covered with coverslips, and incubated at 25 °C for 4–7 d in the dark. Finally, the coverslips were removed and placed on new slides with a drop of lactophenol. The slides were examined using compound light microscope (DM750, Leica, Wetzlar), and microscopic structures were photographed and 30 measurements recorded for each structure using LAS EZ v. 4.0 (Leica Application Suite) and ImageJ2 v. 2.3.0 in Fiji (Schindelin et al. 2012). The measurements of the microscopic structures shown in the descriptions of the species (taxonomy section) represent the minimum and maximum values observed among the 30 measurements obtained.

DNA extraction, PCR and sequencing

We used five molecular markers in this study, i.e., the internal transcribed spacers (ITS), the large subunit nuclear ribosomal RNA gene (28S), the translation elongation factor 1-alpha (tef1), and the RNA polymerase II protein-coding largest and second largest subunit genes rpb1 and rpb2 (Supplementary Table S3). Of the 138 isolates used in this study, 64 were previously sequenced for these five markers in other studies (Augustin et al. 2013, Meirelles et al. 2015a, b, Montoya et al. 2019, 2021; see Table 1). The ITS and tef1 regions of 22 isolates were previously sequenced by Meirelles et al. (2015b). These were supplemented with our sequences of the 28S, rpb1, and rpb2 genes. All five markers were sequenced for the remaining 52 isolates (Table 1).

For the isolates sequenced in this study, we first extracted the genomic DNA using a modified CTAB method (Möller et al. 1992). Briefly, aerial mycelium, grown for 7 d at 25 °C on PDA, was crushed with the aid of glass beads (Sigma) in a lysis solution. Five μL of Proteinase K were added to this solution and incubated at 65 °C for 30 min. Then, the organic phase of the solution was separated by centrifugation at 10 000 g for 10 min, using chloroformisoamyl alcohol (24: 1). Four hundred μL of the supernatant were collected, and the genomic DNA was precipitated with 3 M sodium acetate and isopropanol. The genomic DNA was purified with two successive washes of 70 % ethanol and left at room temperature to dry overnight. Finally, the DNA was suspended in 30 μL of Tris-EDTA solution and stored at -20 °C.

Amplification reactions for ITS, 28S, tef1, rpb1 and rpb2 regions were carried out using the primers and conditions published by Meirelles et al. (2015a, b), Augustin et al. (2013), and Montoya et al. (2021) (summarized in Supplementary Table S3). Amplicons were purified with the Wizard SV Gel and PCR Clean-up System (Promega, Madison) following the manufacturer’s protocol and sequenced (forward and reverse sequencies) on an ABI 3500 Genetic Analyzer (Life Technologies). Consensus sequences were assembled using Geneious v. 6.0 (Kearse et al. 2012) and deposited in GenBank (see Table 1 for accession numbers).

Phylogenetic analyses

We performed a multilocus analysis combining the five molecular markers. First, the data sets were aligned separately for each marker in MAFFT v. 7 (Katoh & Standley 2013). The nucleotide substitution model for each alignment was calculated in jModelTest v. 2 (Darriba et al. 2012) using the Akaike Information Criterion (AIC) with 95 % confidence intervals. To determine if all Escovopsis species clades remained constant (monophyletic) considering the GCPSR concept (Taylor et al. 2000), a phylogenetic tree was inferred using each molecular marker separately (Supplementary Fig. S1). Finally, the datasets were concatenated using Winclada v. 1.00.08 (Nixon 2002). The final data set contained a total of 139 sequences 3 700 bp long [ITS (570 bp), 28S (591 bp), rpb1 (751 bp), rpb2 (1 030 bp), and tef1 (758 bp)]. Escovopsis species described by Marfetán et al. (2019) were not included in the multilocus analyses of this study because most of the sequences of these species are unavailable (Montoya et al. 2021). However, 21 available 28S sequences of those species were combined with our 28S data to reveal their phylogenetic relationships (Supplementary Table S4 and Supplementary Fig. S2).

We reconstructed the final phylogenetic trees using Bayesian Inference (BI) in MrBayes v. 3.2.2 (Ronquist et al. 2012) and Maximum Likelihood (ML) in RAxML v. 8 (Stamatakis 2014). For the BI analysis, we carried out two separate runs (each consisting of three hot chains and one cold chain) using the GTR model for each partition independently. Two million generations of the Markov Chain Monte Carlo (MCMC) were enough to reach convergence (standard deviation of split frequencies < 0.01). The first 25 % of trees were discarded as burn-in to generate the best BI tree. For the ML analysis, we estimated 1 000 independent trees and performed 1 000 bootstrap replicates using the GTR model. The final tree was visualized in FigTree v. 1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/) and edited in Adobe Illustrator CC v. 17.1. The alignments and resulting trees were deposited in TreeBASE (Study Accession URL: http://purl.org/phylo/treebase/phylows/study/TB2:S30754).

Taxonomic key to Escovopsis species

Sixty-eight morphological features from species of Escovopsis (Supplementary Table S5) were analysed using the “rpart” library (Therneau & Atkinson 2019) in R v. 3.6.3. Nineteen out of the 68 characters were selected using a recursive partitioning algorithm (with the information gain as a measure for deciding between alternative splits) as the most informative features to build the dichotomous key (Williams 2011). Finally, a dichotomous key (in cladogram format) was reconstructed using a decision tree that started with a single node root that split into 18 (Supplementary Fig. S3; numbered in red) branches to end in the leaves corresponding to each species (Supplementary Fig. S3). The final cladogram was manually edited using Adobe Illustrator CC v. 17.1, and the information on branches was used to construct the taxonomic key. The Escovopsis species described by Marfetán et al. (2019) could not be included in this key because the morphological features of those species had been described using conditions different to those used in this study.

RESULTS

Adjusting the parameters to evaluate the morphology of Escovopsis

Colony growth of Escovopsis species was observed on different media at temperatures between 10 and 30 °C. Escovopsis weberi, E. clavata, E. microspora, and E. moelleri were able to grow at 10 °C, but their growth was limited and inconspicuous. Thus, 10 °C was selected as the minimum test temperature and growth of all strains at this temperature is reported as present or absent. The seven Escovopsis ex-type cultures grew well at 20, 25 and 30 °C, although at 30 °C, colony growth of E. aspergilloides, E. clavata, E. lentecrescens, E. multiformis was much slower than that of E. microspora, E. moelleri, and E. weberi. Therefore, we consider these temperatures most appropriate for evaluating macroscopic characters. At temperatures 20, 25 and 30 °C, colonies started to grow after the first (Escovopsis microspora, E. moelleri, and E. weberi) or the second day (E. aspergilloides, E. clavata, E. lentecrescens, E. multiformis). Some fast-growing species (E. microspora, E. moelleri, and E. weberi) covered the diameter of the Petri dishes between the third and the fourth day. Therefore, we selected the fourth day as the best time to measure growth radius at 20, 25, and 30 °C.

Evaluation of colony growth on the eight agar media tested (Fig. 1) demonstrated that some media did not yield informative colony characters while some species exhibited similar morphological traits on different media. For instance, growth on all media resulted in a similar morphology for E. microspora and E. weberi. Likewise, on MA2 % colonies showed similar growth patterns to those on CYA, MEA, OA, as well as on PDA (E. moelleri), on CYA (E. aspergilloides), and on PCA and PDA (E. clavata, E. lentecrescens, and E. multiformis). By contrast, none of the isolates grew well on SNA (all strains exhibited inconspicuous aerial mycelia, and the morphological patterns were difficult to observe). Oatmeal Agar was also not ideal because the growth was difficult to measure due to the medium’s opacity. On the other hand, except for E. aspergilloides, all isolates exhibited vigorous growth and notable expression of colony colour on MEA. Differences in colony growth rate were most apparent on CMD, and, on this medium, some species (e.g., E. microspora and E. weberi) produced pustule-like hyphal structures on which conidiophores were often produced, similar to the sporulating tufts produced by Trichoderma. Based on these results, we selected CMD, MEA, and PDA as the most suitable media to evaluate macroscopic features of Escovopsis species. These media are also used for the culture assessments of many other genera in the Hypocreaceae, which facilitates comparisons across the family.

Colonies of most Escovopsis species grew better (colonies develop faster and form more mycelium and conidia) at 25 °C on CMD, MEA, and PDA (Fig. 2), and the differences in macroscopic characters, especially colony colours, were most apparent on the seventh day. For instance, White (LIII73(10)) to Colonial Buff (XXX21′′d) and Light Brownish Olive (XXX19′′k) (E. clavata, E. lentecrescens, E. microspora, E. moelleri, E. multiformis, and E. weberi), and Light Yellow-Green (VI31d) to *Olive-Yellow (XXX23′′) colours (E. aspergilloides) were clearly distinguishable on the seventh day. Although less clear, other colours [Ecru-Olive (XXX21′′i), *Vinaceous-Cinnamon (XXIX13′′b), and Deep Colonial Buff (XXX21′′b)] were observed on colonies of E. weberi and E. microspora on PDA and MEA. Between the seventh and tenth day, most species became Light Brownish Olive (XXX19′′k) on the three media, thus, the distinction between them became less apparent (except for E. lentecrescens). After the 10^th day, the aerial mycelium of all species started to deteriorate (collapse). Therefore, 7 d of growth at 25 °C appears optimal to evaluate the macroscopic characters of Escovopsis species. Supplementary Table S6 shows the conditions, adopted in this study, for macroscopic characters evaluation of the colonies.

The most informative microscopic structures for distinguishing Escovopsis species are: conidiophores, conidiophore branching, presence and shape of conidiophore swollen cells, vesicles, phialides, conidia, and chlamydospores. A complete micromorphological description should consider the following: (i) Conidiophores: The number of vesicles (mono-vesiculate, poly-vesiculate conidiophore), length, stipe (length, septum, distance of septum from the foot cell), shape (pyramidal, irregular, etc.), cell wall (smooth or rough), arrangement (alternate, opposite, in verticils, etc.); (ii) Conidiophore branches: length, arrangement, shape, levels of branching, stipe; (iii) Vesicle: length and width, shapes, presence or absence of septum, stipe; (vi) Phialide: where is it formed (vesicles, aerial mycelium), shape, total length and dimensions (length and width) of the base, swollen section and neck; (v) Conidia: formed in chains or solitary, shape, length, width, colour (individually and in mass), presence or absence of ornamentation; (vi) Chlamydospores: where is it formed (on aerial or submerged mycelium), arrangement (intercalary or terminal), shape, colour, length and width. Supplementary Table S7 shows the characters and parameters, selected in this study, for the evaluation of the microscopic morphology.

Escovopsis phylogeny

The analysis resulting from the combination of the five molecular markers showed that the 138 Escovopsis isolates distributed among 19 well supported monophyletic groups across the genus phylogeny (Fig. 3). Six out of the 19 clades correspond to the previously described species: Escovopsis aspergilloides, E. clavata, E. lentecrescens, E. moelleri, E. multiformis, and E. weberi. The ex-type strain of E. microspora was placed in the same clade with strains of E. weberi [Posterior Probability (PP) = 1; Maximum likelihood bootstrap (MLB) = 100 %, Fig. 3]. The remaining 13 clades correspond to the new species described in this study, i.e., E. breviramosa, E. chlamydosporosa, E. diminuta, E. elongatistipitata, E. gracilis, E. maculosa, E. papillata, E. peniculiformis, E. phialicopiosa, E. pseudocylindrica, E. rectangula, E. rosisimilis, and E. spicaticlavata, (Fig. 3).

In total, five major clades can be differentiated in the multilocus phylogeny of Escovopsis (Fig. 3). Clade I comprises E. breviramosa, E. gracilis, E. peniculiformis, and E. weberi. Clade II comprises E. chlamydosporosa and E. rectangula. Clade III comprises by E. elongatistipitata, E. moelleri, E. phialicopiosa, E. pseudocylindrica, and E. spicaticlavata. Clade IV comprises E. aspergilloides, E. diminuta, E. maculosa, E. lentecrescens, and E. rosisimilis. Lastly, clade V comprises E. clavata, E. multiformis, and E. papillata. Species in Clades I, II and III, grow faster and over wider temperature ranges, and form mostly cylindrical vesicles, while species in clades IV and V grow slowly, at narrow temperature ranges, and form globose vesicles (Figs 2, 3).

In the analyses performed with the molecular markers separately, we observed that the phylogenetic placement of the 19 Escovopsis species may vary depending on the marker used (Supplementary Fig. S1). The rpb2 and tef1 genes, for example, showed each of the 19 Escovopsis species forming well-supported monophyletic clades (Supplementary Fig. S1A, B). The topology of these trees differs slightly from that of the tree with all the markers combined (Figs 3, S1F). In the rpb2 gene tree, E. chlamydosporosa and E. rectangula do not share the same common ancestor (Fig. S1A). In the case of the tef1 gene, E. breviramosa is more closely related to E. weberi than to E. peniculiformis; E. papillata is more closely related to clade IV, and E. multiformis and E. clavata do not share the same common ancestor, as seen in the tree based on the five markers (Fig. S1B). On the other hand, most of the species form well-supported monophyletic groups in the trees reconstructed with the ITS or rpb1 markers (Fig. S1C, D). However, the clades E. breviramosa, E. chlamydosporosa (ITS tree, Fig. S1C), and E. phialicopiosa (rpb1 tree, Fig. S1D) were unresolved. Likewise, in the rpb1 tree, E. peniculiformis is placed within E. weberi (Fig. S1D). Finally, the 28S marker was the one with the lowest resolution to separate Escovopsis species (Fig. S1E). While E. breviramosa, E. clavata, E. lentecrescens, E. maculosa, E. lower whiskers the lowest and the highest values, respectively (without considering outliers). Boxes marked with the same letter indicate species for which the mean growth rates did not differ significantly according to the Duncan’s Multiple Range Test. multiformis, E. papillata, E. rectangula, and E. rosisimilis formed well-supported monophyletic groups, their phylogenetic placement, as well as the monophyly of the other species, are not well-resolved (Fig. S1E).

Morphological diversity Escovopsis

While species in the five main clades observed in the Escovopsis phylogeny share some morphological characters, each also has unique character states that differentiate them from one another (Fig. 3). Clades I and II form pyramidal conidiophores mostly producing cylindrical vesicles and smooth-walled conidia. However, species in Clade I (i.e., E. breviramosa, E. gracilis, and E. peniculiformis) usually have septate vesicles and phialides produced both on vesicles and aerial mycelium (although the latter is less frequent). In contrast, species in Clade II have shorter and less frequently septate vesicles without phialides formed in the aerial mycelium. In addition, some species in Clade II (e.g., E. chlamydosporosa), usually form chlamydospores which are rare in species in Clade I.

In contrast, species in Clades III, IV and V form irregular-shaped conidiophores, differing among each other in the type of vesicle and conidia. Species in Clade III form clavate, cymbiform, subulate, and lanceolate vesicles, and conidia with thickened walls and ornamentation, except for E. phialicopiosa, in which conidia have inconspicuous ornamentation. Species in Clade IV form globose, subglobose, and capitate vesicles, and smooth-walled conidia. Species in this clade are usually slow growing, with the striking example provided by E. lentecrescens, the slowest growing species in the genus.

Finally, distinct from all other clades, species in Clade V have the most variable vesicle shapes, ranging from globose, subglobose, capitate, obovoid, prolate, spatulate, clavate, cymbiform, lanceolate to subulate. Also, in contrast to species in other clades, most species in Clade V can only grow between 20 and 25 °C, except for some isolates of E. multiformis that can also grow at 10 and 30 °C.

Taxonomy

Our taxonomic protocol is applied below to provide standardised morphological descriptions of the know species of Escovopsis, excluding the five species described by Marfetán et al. (2019) for which no cultures were available. We re-described the extype cultures of E. aspergilloides, E. clavata, E. lentecrescens, E. moelleri, E. multiformis, and E. weberi (Figs 4, 7, 11, 13, 14, 22). The re-description of these species provided the basis for the morphological analysis of the genus. Furthermore, based on the similarity of their sequence and morphological characters, we synonymize E. microspora with E. weberi. Finally, we describe 13 new species obtained from our field work in Argentina, Brazil, Costa Rica, Mexico, and Panama.

Fig. 4 — Morphological characters of *Escovopsis aspergilloides* (ex-type culture CBS 423.93). A. Mono-vesiculate conidiophore. **B, C.** Polyvesiculate conidiophores. D. Conidiophore arrangement on aerial mycelium. E. Globose vesicle with phialides. F. Phialides. G. Conidia. H. Chlamydospores. **I–K.** Cultures on CMD, MEA and PDA, respectively, after 7 d of growth at 25 °C. Scale bars: A–C = 10 μm; D = 40 μm; E = 4 μm; F–H = 2 μm.

Fig. 7 — Morphological characters of *Escovopsis clavata* (ex-type culture CBS 145326). A. Mono-vesiculate conidiophores. B. Polyvesiculate conidiophore. C. Conidiophore with infertile hypha at the apex. D. Conidiophore with swollen cell. E. Conidiophore arrangement on aerial mycelium. F. Clavate vesicle with phialides. G. Phialides. H. Conidia. **I–K.** Cultures on CMD, MEA and PDA, respectively, after 7 d of growth at 25 °C. Scale bars: A–D = 10 μm; E = 20 μm; F = 4 μm; G; H = 2 μm.

Fig. 11 — Morphological characters of *Escovopsis lentecrescens* (ex-type culture CBS 135750). A. Mono-vesiculate conidiophores. **B, C.** Polyvesiculate conidiophore. D. Conidiophore arrangement on aerial mycelium. E. Globose vesicle with phialides. F. Subglobose vesicle with phialides. G. Phialides. H. Conidia. I. Chlamydospore. **J–L.** Cultures on CMD, MEA and PDA, respectively, after 7 d of growth at 25 °C. Scale bars: A–C = 10 μm; D = 20 μm; E, F, I = 4 μm; G, H = 2 μm.

Fig. 13 — Morphological characters of *Escovopsis moelleri* (ex-type culture CBS 135748). A. Mono-vesiculate conidiophore. **B, C.** Polyvesiculate conidiophore. D. Conidiophore arrangement on aerial mycelium. E. Subulate vesicle. F. Lanceolate vesicle. G. Phialides with conidia. H. Ornamented conidia. **I–K.** Cultures on CMD, MEA and PDA, respectively, after 7 d of growth at 25 °C. Scale bars: D, G = 20 μm; E, F = 10 μm; H–K = 4 μm.

Fig. 14 — Morphological characters of *Escovopsis multiformis* (ex-type culture CBS 145327). A. Mono-vesiculate conidiophore. B. Polyvesiculate conidiophores. C. Conidiophore with swollen cell. D. Conidiophore arrangement on aerial mycelium. E. Capitate vesicle with phialides. F. Cylindrical vesicles with phialides. G. Phialides. H. Conidia. **I–K.** Cultures on CMD, MEA and PDA, respectively, after 7 d of growth at 25 °C. Scale bars: A–C = 10 μm; D = 20 μm; E, F = 4 μm; G, H = 2 μm.

Fig. 22 — Morphological characters of *Escovopsis weberi* (ex-type culture ATCC 64542). **A–B.** Polyvesiculate conidiophore. C. Arrangement of mono- and polyvesiculate conidiophores on aerial mycelium. D. Septate cylindrical vesicle. E. Cylindrical vesicle. F. Clavate vesicle. G. Phialides. H. Conidia. **I–K.** Cultures on CMD, MEA and PDA, respectively, after 7 d of growth at 25 °C. Scale bars: A–C = 20 μm; D–H = 4 μm.

Escovopsis aspergilloides K.A. Seifert et al., Mycologia 87: 408. 1995. MycoBank MB 413060. Fig. 4.

Diagnosis: Escovopsis aspergilloides forms colonies with diffuse pale-yellow to yellowish-brown colours and conidiophores with globose vesicles.

Typus: Trinidad and Tobago, near ASA Wright Nature Centre, isolated from a nest of Trachymyrmex ruthae (collected 15–20 cm below the soil surface in a wet, dense, secondary tropical rainforest by T. R. Schultz, 9 Nov. 1992), in Ithaca, New York by I.H. Chapela, no. 92110905C [holotype DAOM 216382 (dried agar culture), ex-type culture CBS 423.93].

Description: Conidiophores forming 2–15 vesicles, hyaline, irregular shape, smooth-walled, alternate or opposite, formed on aerial hyphae. Mono-vesiculate conidiophores 40–72 μm, polyvesiculate 80–300 μm long. Conidiophore stipes 24–100 × 5–6 μm, with a septum 4–6 μm from the foot cell. Conidiophore branches 32–160 μm long, formed in one to three levels, in almost right angles, alternate. Second branching level usually longer than other branching levels. Stipes on branches 10–49 μm long, with a septum 2–4 μm from conidiophore axis. Vesicles of various shapes, i.e., globose, sub-globose, capitate, obovoid, prolate and spatulate, 13–29 × 10–24 μm, aseptate, formed on the tips of conidiophore and branches. Vesicle stipe 10–40 μm long, with one or two septa. Phialides formed on vesicles, 6–10 μm long, ampulliform, 1–2 × 0.5–1.5 μm at the base, 3.5–4 × 2–3 μm at the swollen section and 4 × 2 μm at the neck. Conidia formed in chains, globose to oblong, 2.5–3 × 2–2.5 μm, Olive-Ochre (XXX21′′), with smooth and slightly thickened walls. Chlamydospores intercalary, hyaline, 11–22 × 8–14 μm.

Culture characteristics: Colonies growing at 20 and 25 °C on CMD, PDA, and MEA. At 20 °C, growth starts on second day on PDA, on third day on MEA, and on fourth day on CMD. At 25 °C, growth starts on second day on MEA and PDA, and on third day on CMD. Colony radius after 4 d at 20 °C: 0–1 mm on CMD, 2–5 mm on MEA and 5–8 mm on PDA; at 25 °C: 1–3 mm on CMD, 5–7 mm on MEA and 5–10 mm on PDA. Colony morphology — CMD 25 °C, 7 d: colonies with diffuse aerial mycelium, spread by stolons, Light Yellow-Green (VI31d) to Olive-Ochre (XXX21′′). MEA 25 °C, 7 d: colonies with submerged mycelium forming dense circular zones, diffuse aerial mycelium forming concentric rings, White (LIII73(10)) to Picnic Yellow (IV23d) and *Olive-Yellow (XXX23′′) (*Olive-Yellow (XXX23′′) at centre and White (LIII73(10)) at margin). PDA 25 °C, 7 d: colonies with abundant aerial mycelium, spread by stolons, Picnic Yellow (IV23d) to *Olive-Yellow (XXX23′′) and Light Yellow-Green (VI31d) to Colonial buff (XXX21′′d). Pustule-like structures and soluble pigments absent.

Ecology: Unknown, but this species has only been found in a nest of Trachymyrmex ruthae in a rain forest. Distribution: Trinidad.

Notes: Escovopsis aspergilloides is closely related to E. maculosa. However, E. aspergilloides grows slower and forms longer and more branched conidiophores. Unlike E. maculosa, which has mainly globose vesicles, E. aspergilloides forms vesicles of various shapes, i.e., globose, sub-globose, capitate, obovoid, prolate and spathulate.

Escovopsis breviramosa Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. Mycobank MB 847805. Fig. 5.

Etymology: “breviramosa” (brevi = short, ramose = branches) in reference to the short branches formed on the conidiophores of this species.

Diagnosis: Escovopsis breviramosa frequently has mono-vesiculate conidiophores and their polyvesiculate conidiophores have branches comprised mainly of a sessile vesicle.

Typus: Brazil, Bahia, Camacan, Serra Bonita, 15°23’43.0’’S, 39°33’49.1’’W, fungus garden of Acromyrmex sp., May 2015, A. Rodrigues, LESF 055 (holotype CBS 149741 preserved as metabolically inactive culture, extype culture CBS 149741).

Description: Conidiophores forming 2–33 vesicles, hyaline, usually pyramidal, smooth-walled, alternate or less frequent opposite, formed on aerial hyphae. Mono-vesiculate conidiophores 17–55 μm, polyvesiculate 36–430 μm long. Conidiophore stipes 3.5–130 μm × 3.5–5 μm, with a septum 1.5–28.5 μm from the foot cell. Conidiophore branches 20.5–190 μm long, formed in one or three levels, at almost right angles, alternate. Stipes on branches 1–24.5 μm long, with a septum 0.5–13 μm from conidiophore axis. Vesicles cylindrical, 29.5–60 × 3.5–9.5 μm, predominantly aseptate, less frequently septate (1–2 septa), formed on conidiophore axis or on the axis of branches. Vesicle stipe 1–6 μm long, with one septum, rarely with two septa. Phialides predominantly formed on vesicles, less frequently on aerial mycelia, 4.5–12 μm long, lageniform, 0–1.5 × 0.5–2 μm at the base, 2.5–4 × 2–3 μm at the swollen section and 1–9.5 × 0.5 μm at the neck. Conidia formed in chains, subglobose, 1–3 × 1–2 μm, Olive-Ochre (XXX21′′), with smooth and thick wall. Chlamydospores absent.

Culture characteristics: Colonies growing at 10, 20, 25, and 30 °C on CMD, PDA, and MEA. At 10 °C, growth starts between the first and second day, and at 20, 25, and 30 °C growth starts at the first day, on all media. Colony radius, after 4 d at 10 °C: Inconspicuous growth (the colony barely grows on the inoculum); at 20 °C: 7–12 mm on CMD, 10–40 mm on MEA and 40 mm on PDA; at 25 °C: 15–18 mm on CMD and 40 mm on MEA and PDA; at 30 °C: 15–18 mm on CMD, 15–33 mm on MEA and 40 mm on PDA. Colony morphology — CMD 25 °C, 7 d: Colonies with diffuse aerial mycelium, spread by stolons, abundant pustule-like formations, White (LIII73(10)) to Olive-Ochre (XXX21′′). MEA 25 °C, 7 d: Colonies with aerial mycelium at centre, dense submerged mycelium at margin, pustule-like formations, White (LIII73(10)) to Olive-Ochre (XXX21′′). PDA 25 °C, 7 d: Colonies with abundant aerial mycelium, spread by stolons, without pustule-like formations, White (LIII73(10)) to Olive-Ochre (XXX21′′) (White (LIII73(10)) at centre and Olive-Ochre (XXX21′′) at margin. Soluble pigments absent.

Ecology: Unknown.

Distribution: This species is found in different regions in Brazil and Panama in fungus gardens of the attine ant genera Atta, Acromyrmex, Apterostigma, and Mycetomoellerius.

Additional materials examined: Brazil, Rio Grande do Sul, Nova Petrópolis, grape orchard, 29°22’38.2’’S, 50°57’18.1’’W, fungus garden of Acromyrmex ambiguus, Jun. 2004, A. Rodrigues, LESF 039; São Paulo, Rio Claro, São Paulo State University (UNESP), 22°23’46.0”S, 47°32’43.2”W, fungus garden of Mycetomoellerius sp., unknown date, A. Rodrigues, LESF 316.

Notes: Escovopsis breviramosa is closely related to E. gracilis and E. peniculiformis. Unlike strains of E. peniculiformis, E. breviramosa grows at 10 °C. Conidiophores of E. breviramosa are usually shorter, more branched, and have shorter and broader terminal vesicles than those of E. peniculiformis. Unlike E. gracilis, strains of E. breviramosa grow at 10 and 30 °C. In addition, E. breviramosa forms wider and branched conidiophores, and wider and longer vesicles than E. gracilis.

Escovopsis chlamydosporosa Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. MycoBank MB 847806. Fig. 6.

Etymology: “chlamydosporosa” (osa = Lat feminine indicating abundance) in reference to the abundant chlamydospores formed by isolates of this species.

Diagnosis: Escovopsis chlamydosporosa forms chlamydospores (sensu Augustin et al. 2013) more frequently and abundantly than any other known Escovopsis species; these structures are rare or absent in most species of this genus.

Typus: Brazil, Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°31’25.6”S, 60°49’32.4”W, fungus garden of Trachymyrmex sp. sensu lato, Jan. 2017, Q.V. Montoya, LESF 984 (holotype CBS 149748 preserved as metabolically inactive culture, ex-type culture CBS 149748).

Description: Conidiophores forming 2–26 vesicles, scarce, thin, hyaline, irregular shaped, smooth-walled, alternate, formed on aerial hyphae. Mono-vesiculate conidiophores 1.5–65.5 μm, polyvesiculate 45.5–380 μm long. Conidiophore stipes 4–170 μm × 3.5–5.5 μm, with a septum 0–6.5 μm from the foot cell. Conidiophore branches 16.5–97.5 μm long, formed in in one or two levels, usually at right angles, alternate. Stipes on branches 1–17.5 μm long, with a septum 1–9.5 μm from conidiophore axis. Vesicles cylindrical, 20.5–84.5 × 4–8 μm, predominantly aseptate, less frequently septate (one septum), formed on conidiophore axis or on the axis of branches. Vesicle stipe1–17 μm long, aseptate. Phialides formed on vesicles, 5.5–10 μm long, lageniform, 0.5–

1.5 × 0.5–1.5 μm at the base, 2–3.5 × 1.5–2.5 μm at the swollen section, 1.5–5.5 × 0.5 μm at the neck. Conidia formed in chains, subglobose, 1–4 × 1–3 μm, Olive-Ochre (XXX21′′), with smooth and thick wall. Chlamydospores very common, 10–17 × 8–16 μm, formed in chains on aerial mycelium, intercalary.

Culture characteristics: Colonies growing at 20, 25, and 30 °C on CMD, PDA, and MEA. Growth starts on the first day at all temperatures, on all media. Colony radius, after 4 d at 20 °C: 9–14 mm on CMD, 16–20 mm on MEA and 30–40 mm on PDA; at 25 °C: 13–15 mm on CMD, 32–40 mm on MEA and 40 mm on PDA; at 30 °C: 10–15 mm on CMD, 36–20 mm on MEA and 30–40 mm on PDA. Colony morphology — CMD 25 °C, 7 d: Colonies with scattered aerial mycelium, spread by stolons, White (LIII73(10)) to Margerite Yellow (XXX23′′f). MEA 25 °C, 7 d: Colonies with cottony aerial mycelium, White (LIII73(10)) to Margerite Yellow (XXX23′′f). PDA 25 °C, 7 d: Colonies with abundant cottony aerial mycelium, spread by stolons, White (LIII73(10)) to Colonial Buff (XXX21′′d). White (LIII73(10)) to Colonial Buff (XXX21′′d) pustule-like formations only on PDA. Soluble pigments absent.

Ecology: Unknown.

Distribution: This species is found in Novo Airão, Amazonas, Brazil in fungus gardens of the attine ant genera Acromyrmex, Apterostigma, and Trachymyrmex.

Additional materials examined: Brazil, Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°16’15.7’’S, 61°01’8.46’’W, fungus garden of Acromyrmex sp., 24 Jan. 2017, Q.V. Montoya, LESF 961, ibid., LESF 963; Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°31’26.04’’S, 60°49’31.62’’W, fungus garden of Trachymyrmex sp., 20 Jan. 2017, Q.V. Montoya, LESF 991; Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°26’52.56”S, 59°45’53.4”W, fungus garden of Trachymyrmex sp., 9 Mar. 2017, Q.V. Montoya, LESF 1026.

Notes: Escovopsis chlamydosporosa is closely related to E. rectangula. Unlike strains of E. rectangula, E. chlamydosporosa does not grow at 10 °C. Furthermore, its conidiophores are usually longer, more branched, and irregularly shaped, compared to of E. rectangula, which are shorter and slightly rectangular.

Escovopsis clavata Q.V. Montoya et al., Mycokeys 46: 102. 2019. MycoBank MB 828328. Fig. 7.

Diagnosis: Escovopsis clavata usually forms conidiophores with swollen cells and with terminal sterile hypha (conidiophore apex does not end in a vesicle).

Typus: Brazil, Santa Catarina, Florianópolis, 27°44’39.6’’S, 48°31’10.14’’W, elev. 46 m, fungus garden of Apterostigma sp., Aug. 2015, A. Rodrigues, LESF 853 (holotype CBS H-23845 dried culture, ex-type culture CBS 145326).

Description: Conidiophores forming 2–8 vesicles, sometimes with swollen cells, hyaline, irregular shape, smooth-walled, alternate or opposite, formed on aerial hyphae. Mono-vesiculate conidiophores 10–50 μm, polyvesiculate up to 780 μm long. Conidiophore stipes 10–40 μm × 5–8 μm, with a septum 2–9 μm from the foot cell. Conidiophore axis usually ends in a vesicle, sometimes in an infertile hypha and less frequently in a terminal swollen cell 10–18 × 7–9 μm. Conidiophore branches 16–138 μm long (usually shorter, sometimes as long as conidiophore axis), formed in one or two levels, usually at right angles and sometimes slightly curved up or down, alternate or opposite. Swollen cells form 2–4 branches, 28–35 μm long, mostly curved upward or less frequently at right angles. Stipes on branches 9–38 μm long, with a septum 2–6 μm from conidiophore axis. Vesicles of various shapes, i.e., globose, sub-globose, capitate, obovoid, prolate, spatulate, predominantly clavate, cymbiform, and cylindric, 9–27 × 7–20 μm, aseptate, formed on the tips of conidiophore and branches. Vesicle stipe 10–30 μm long, with two or six septa. Phialides formed on vesicles, 5–8 μm long, lageniform 0.5–1.5 × 0.5–1 μm at the base, 1.5–2.5 × 1–3 μm at the swollen section, 1.5–4 × 0.5 μm at the neck. Conidia formed in chains, ellipsoidal to oblong, 1.5–2.5 × 0.5–1.5 μm, Olive-Ochre (XXX21′′), with smooth and slightly thick walls. Chlamydospores absent.

Culture characteristics: Colonies growing at 20 and 25 °C on CMD, PDA, and MEA. At both temperatures, growth starts on the third day on all media. Colony radius, after 4 d at 20 °C: 0–3 mm on CMD, 1–4 mm on MEA and 3–5 mm on PDA; at 25 °C: 2–8 mm on CMD, 4–6 mm on MEA and 6–11 mm on PDA. Colony morphology — CMD 25 °C, 7 d: Colonies with diffuse aerial mycelium, Margerite Yellow (XXX23′′f) to Colonial Buff (XXX21′′d). MEA and PDA 25 °C, 7 d: Colonies with dense floccose aerial mycelium forming concentric rings, Margerite Yellow (XXX23′′f) to Colonial Buff (XXX21′′d) at centre and Margerite Yellow (XXX23′′f) at margin. Rarely forming stolons. Pustule-like formations and soluble pigments absent.

Ecology: Unknown.

Distribution: This species is found in different regions of Brazil in fungus gardens of the attine ant genus Apterostigma.

Additional materials examined: Brazil, Santa Catarina, Florianópolis, 27°44’38.94’’S, 48°31’9.3’’W, elev. 32 m, fungus garden of Apterostigma sp., Aug. 2015, A. Rodrigues, LESF 854; Santa Catarina, Florianópolis, 27°44’39.49’’S, 48°31’9.72’’W, elev. 38 m, fungus garden of Apterostigma sp., Aug. 2015, A. Rodrigues, LESF 855.

Notes: Escovopsis clavata is closely related to E. multiformis. Unlike strains of E. multiformis, which grow at 10, 20, 25 and 30 °C, E. clavata only grows at 20 and 25 °C. Conidiophores of E. clavata are usually larger and more branched than those of E. multiformis and end in a sterile elongation not observed in E. multiformis. Compared to the latter species, swollen cells are less frequent and shorter in E. clavata.

Escovopsis diminuta Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. MycoBank MB 847814. Fig. 8.

Etymology: “diminuta” (diminuta = reduced in size) in reference to the reduced size of the conidiophores.

Diagnosis: Escovopsis diminuta forms short and rarely branched conidiophores with globose vesicles.

Typus: Brazil, Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°31’23.4’’S, 60°49’31.9’’W, fungus garden of Trachymyrmex sp., 20 Jan. 2017, Q.V. Montoya, LESF 969 (holotype CBS 149747 preserved as metabolically inactive culture, ex-type culture CBS 149747).

Description: Conidiophores forming 2–8 vesicles, hyaline, irregularly shaped, smooth-walled, alternate, formed on aerial hyphae. Mono-vesiculate conidiophores 22–80 μm, polyvesiculate 52–130 μm long. Conidiophore stipe 8–73 × 3.5–8.5 μm, with a septum 0–5 μm from the foot cell. Conidiophore branches 21–61 μm long, formed in one level, in almost right angles, alternate or opposite. Stipes on branches 3–30 μm long, with a septum 0.5–10 μm from conidiophore axis. Vesicles globose 17–30 × 15–30 μm, aseptate, formed on the tips of conidiophore and branches. Vesicle stipe 0.5–10 μm long, with two septa. Phialides formed on vesicles, 6–9 μm long, lageniform, 0–1 × 1–2 μm at the base, 3–5 × 2–4 μm at the swollen section and 2–4 × 0.5–1 μm at the neck. Conidia formed in chains, oblong, 2–3 × 1.5–2.5 μm, Olive-Ochre (XXX21′′, smooth and thick wall. Chlamydospores absent.

Culture characteristics: Colonies growing at 20, and 25 °C on CMD, PDA, and MEA. At 20 °C growth starts on second day, and at 25 °C on the first day. Colony radius, after 4 d at 20 °C: 4–10 mm on CMD, 3–15 mm on MEA and 12–15 mm on PDA; at 25 °C: 10–16 mm on CMD, 15–18 mm on MEA and 14–21 mm on PDA. Colony morphology — CMD 25 °C, 7 d: colonies with diffuse aerial mycelia, with pustule-like formations, White (LIII73(10)) to Colonial Buff (XXX21′′d) (Colonial buff (XXX21′′d) at centre, White (LIII73(10)) at margin). MEA 25 °C, 7 d: colonies with dense cottony aerial mycelium, few stolons, White (LIII73(10)) to Margerite Yellow (XXX23′′f), *Olive-Yellow (XXX23′′) to Olive-Ochre (XXX21′′) (*Olive-Yellow (XXX23′′) to Olive-Ochre (XXX21′′) at centre, White (LIII73(10)) to Margerite Yellow (XXX23′′f) at margin). PDA 25 °C, 7 d: colonies with dense aerial mycelium, few stolons, few pustule-like formations, White (LIII73(10)), Colonial buff (XXX21′′d), Olive-Ochre (XXX21′′) (Olive-Ochre (XXX21′′) to Colonial Buff (XXX21′′d) at centre, White (LIII73(10)) at margin). Light Yellow-Green (VI31d) soluble pigments only on MEA.

Ecology: Unknown.

Distribution: This species was found in the Amazon regions of Brazil in fungus gardens of the attine ant genera Apterostigma and Trachymyrmex.

Additional materials examined: Brazil, Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°32’02.7’’S, 60°50’11.7’’W, fungus garden of Apterostigma sp., 19 Jan. 2017, Q.V. Montoya, LESF 996; Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°32’1.4’’S, 60°50’0.4’’W, fungus garden of Trachymyrmex sp., 21 Jan. 2017, Q.V. Montoya, LESF 1003.

Notes: Escovopsis diminuta is closely related to E. rosisimilis and E. lentecrescens. Escovopsis diminuta grows faster than E. rosisimilis but slower than E. lentecrescens. Furthermore, E. diminuta has shorter conidiophores than E. rosisimilis and E. lentecrescens.

Escovopsis elongatistipitata Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. MycoBank MB 847810. Fig. 9.

Etymology: “elongatistipitata” (elongati = Latin feminine for elongate, stipitata = stipe) in reference to the elongate stipes of both the conidiophores and the conidiophore branches.

Diagnosis: Escovopsis elongatistipitata forms conidiophores and conidiophore branches with long stipes.

Typus: Brazil, Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°31’23.4’’S, 60°49’31.9’’W, fungus garden of Trachymyrmex sp., 20 Jan. 2017, Q.V. Montoya, LESF 999, (holotype CBS 149750 preserved as metabolically inactive culture, ex-type culture LESF 999 = CBS 149750).

Description: Conidiophores forming 2–13 vesicles, hyaline, irregular shaped, smooth-walled, alternate or opposite, formed on aerial hyphae. Mono-vesiculate conidiophores rare, 54–120 μm, polyvesiculate 56.5–380 μm long. Conidiophore stipes 10.5–190 × 2–6.5 μm, with a septum 0.5–9 μm from the foot cell. Conidiophore branches 20–230 μm long, formed in one or two levels, usually at right angles, less frequently at angles less than 90°, alternate or opposite. Stipes on branches 3–220 μm long, with a septum commonly 0–2 μm and rarely 6–20 μm from conidiophore axis. Vesicles mainly cylindric, less frequently clavate, 14–74.5 × 2–7.5 μm, aseptate, formed on conidiophore axis or on the axis of branches. Vesicle stipe 0–76 μm long, with one or two septa. Phialides formed on vesicles, 4–13 μm long, lageniform, 0–1 × 1–2 μm at the base, 2–7 × 1.5–3 μm at the swollen section and 1–3.5 × 0.5–1.5 μm at the neck. Conidia formed in chains, oblong, 3–5 × 2–3.5 μm, Olive-Ochre (XXX21′′), with ornamented and thick wall. Chlamydospores absent.

Culture characteristics: Colonies growing at 20, and 25 °C on CMD, MEA, PDA. Growth starts on second day at both temperatures, on all media. Colony radius, after 4 d at 20 °C: 5–9 mm on CMD, 10–15 mm on MEA and 12–15 mm on PDA; at 25 °C: 8–12 mm on CMD, 25–30 mm on MEA and 20–23 mm on PDA. Colony morphology — CMD 25 °C, 7 d: colonies with diffuse cottony aerial mycelium, White (LIII73(10)) to Margerite Yellow (XXX23′′f). MEA 25 °C, 7 d: colonies with cottony aerial mycelium, sometimes spread by stolons, forming concentric rings, White (LIII73(10)) to Margerite Yellow (XXX23′′f) and Colonial Buff (XXX21′′d) (Colonial buff (XXX21′′d) at centre White (LIII73(10)) to Margerite Yellow (XXX23′′f) at margin). PDA 25 °C, 7 d: colonies with cottony aerial mycelium, spread by stolons, White (LIII73(10)) to Margerite Yellow (XXX23′′f). Pustule-like formations and soluble pigments absent.

Ecology: Unknown.

Distribution: This species was found in the amazon regions of Brazil in fungus gardens of the attine ant Trachymyrmex.

Additional materials examined: Brazil, Amazonas, Novo Airão, Parque Naciona de Anavilhanas, 2°16’8.7’’S, 59°27’32.32’’W, fungus garden of Trachymyrmex sp., 20 Jan. 2017, Q.V. Montoya, LESF 1021; Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°18’52.09’’S, 60°27’29.41.02’’W, fungus garden of Trachymyrmex sp., 20 Jan. 2017, Q.V. Montoya, LESF 985.

Notes: Escovopsis elongatistipitata is closely related to E. phialicopiosa. Unlike strains of the latter species, which can grow at 30 °C on MEA and PDA and do not form concentric rings on any media, E. elongatistipitata does not grow at 30 °C and eventually forms concentric rings on MEA and PDA.

Escovopsis gracilis Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. MycoBank MB 847807. Fig. 10.

Etymology: “gracilis” (gracilis = thin) in reference to the narrow conidiophores and vesicles.

Diagnosis: Escovopsis gracilis forms cottony colonies with disperse narrow conidiophores and vesicles.

Typus: Brazil, Bahia, Camacan, Serra Bonita, 14°47’56.8’’S, 39°10’16.4’’W, fungus garden of Atta cephalotes, 3 Jul. 2012, A. Rodrigues, LESF 325 (holotype CBS 149743 preserved as metabolically inactive culture, extype culture CBS 149743).

Description: Conidiophores forming 2–10 vesicles, scarce, thin, hyaline, irregular shaped, smooth-walled, alternate, formed on aerial hyphae. Mono-vesiculate conidiophores 27–150 μm, polyvesiculate 78–680 μm long. Conidiophore stipes 7.5–550 μm × 3–5.5 μm, with a septum 2–58.5 μm from the foot cell. Conidiophore branches 32.5–120 μm long, formed in one level, rarely in two levels, usually at angles less than 90°, less frequently at right angles, alternate. Stipes on branches 2–90 μm long, with a septum 0–22.5 μm from conidiophore axis. Vesicles thin, cylindrical, 19.5–81 × 2.5–5.5 μm, predominantly aseptate, less frequently septate (1–2 septa), formed on conidiophore axis or on the axis of branches. Vesicle stipe 0.5–7.5 μm long, septate (1–2 septa). Phialides formed on vesicles, 5–13 μm long, lageniform, 1–2 × 0.5–2 μm at the base (sometimes base absent), 3–7.5 × 2–4 μm at the swollen cell and 0.5–7 × 0.5–1 μm at the neck. Conidia formed in chains, subglobose, 3–7 × 2.5–4.5 μm, Olive-Ochre (XXX21′′), with smooth and thick wall. Chlamydospores absent.

Culture characteristics: Colonies growing at 20, and 25 °C on CMD, PDA, and MEA. Growth starts on the first day at both temperatures, on all media. Colony radius, after 4 d at 20 °C: 32–33 mm on CMD, 33–37 mm on MEA and 40 mm on PDA; at 25 °C: 12–19 mm on CMD and 40 mm on MEA and PDA. Colony morphology — CMD 25 °C, 7 d: Colonies with scattered aerial mycelium, spread by stolons, few short White (LIII73(10)) pustule-like formations, White (LIII73(10)) to Margerite Yellow (XXX23′′f). MEA 25 °C, 7 d: Colonies with abundant cottony aerial mycelium (sometimes forming concentric rings), spread by stolons, without pustule-like formations, White (LIII73(10)) to Margerite Yellow (XXX23′′f). PDA 25 °C, 7 d: Colonies with abundant dense aerial mycelium (sometimes forming concentric rings), spread by stolons, abundant White (LIII73(10)) to Colonial Buff (XXX21′′d) pustule-like formations, White (LIII73(10)) to Colonial buff (XXX21′′d). Soluble pigments absent.

Ecology: Unknown.

Distribution: This species is found in Bahia-Brazil in fungus gardens of the attine ant Atta cephalotes.

Additional materials examined: Brazil, Bahia, Camacan, Fazenda Paris, 14°47’51.18’’S, 39°10’17.4’’W, fungus garden of Atta cephalotes, 15 Mar. 2013, A. Rodrigues, LESF 843; Bahia, Camacan, Serra Bonita, 15°23’14.82’’S, 39°33’28.38’’W, fungus garden of Atta cephalotes, 21 Feb. 2013, A. Rodrigues, LESF 844.

Notes: Escovopsis gracilis is closely related to E. breviramosa. Unlike strains of the latter species, E. gracilis does not grow at 10 or 30 °C. Conidiophores of E. gracilis are usually thinner, longer and more branched than those of E. breviramosa.

Escovopsis lentecrescens H.C. Evans & J.O. Augustin, PLoS ONE 8 (12): e82265, 5. 2013. MycoBank MB 800441. Fig. 11.

Diagnosis: Escovopsis lentecrescens has the slowest growth rate in culture among the known species of the genus.

Typus: Brazil, Minas Gerais, Viçosa, Mata do Paraíso, elev. 700 m, fungal garden of Acromyrmex subterraneus subterraneus, Apr. 2010, J.O. Augustin & H.C. Evans, AUJ9 (holotype IMI 501179, isotypes CBS 135750, DOA628 and VIC 31755).

Description: Conidiophores forming 1–10 vesicles, hyaline, of irregular shape, smooth-walled, alternate or opposite, formed on aerial hyphae. Mono-vesiculate conidiophores 36–150 μm, polyvesiculate 57–200 μm long. Conidiophore stipes 28–49 μm × 5–7 μm, with a septum 2–6 μm from the foot cell. Conidiophore branches 20–80 μm long, formed in one to three levels, in almost right angles, alternate. The second branching level is usually much longer than other branching levels. Stipes on branches 7–31 μm long, with a septum up to 9 μm from conidiophore axis. Vesicles of various shapes, i.e., predominantly globose, subglobose, spathulate, oblanceolate and cylindric, 14–27 μm × 13–27 μm, aseptate, formed on the tips of conidiophore and branches. Vesicle stipe 10–94 μm long with 1–6 septa. Phialides formed on vesicles, 6–8.5 μm long, ampulliform, 0.5–1 × 1–1.5 μm at the base, 4–5 × 2.5–3 μm at the swollen section and 2–3 × 0.5–0.6 μm at the neck. Conidia formed in chains, globose to oblong, 2–3.5 × 1.5–2 μm, Olive-Ochre (XXX21′′), with smooth and slightly thick walls. Rarely chlamydospores intercalary, hyaline, 9.5–23 × 8.5–16 μm.

Culture characteristics: Colonies growing at 20, and 25 °C on CMD, PDA, and MEA. At 20 °C, growth starts on the third day, and at 25 °C, growth starts on the second day, on all media. Colony radius, after 4 d at 20 °C: 0–2 mm on CMD, 0–1 mm on MEA and 0–1 mm on PDA; at 25 °C: 2–3 mm on CMD, 2–5 mm on MEA and 2–3 mm on PDA. Colony morphology — CMD 25 °C, 7 d: Colonies with diffuse aerial mycelium, spread by stolons, *Vinaceous-Cinnamon (XXIX13′′b) to Colonial Buff (XXX21′′d). MEA 25 °C, 7 d: Colonies with dense cottony aerial mycelium, forming concentric rings, White (LIII73(10)) to Margerite Yellow (XXX23′′f). PDA 25 °C, 7 d: Colonies with dense cottony aerial mycelium, forming concentric rings, White (LIII73(10)) to Light Brownish olive (XXX19′′k) (Colonial buff (XXX21′′d) to Light Brownish Olive (XXX19′′k) at centre and White (LIII73(10)) at margin). Rarely forming stolons. Pustule-like formations and soluble pigments absent.

Ecology: Unknown.

Distribution: This species has been found only in one region in Brazil in fungus garden of Acromyrmex subterraneus.

Notes: Escovopsis lentecrescens is closely related to E. diminuta. Unlike strains of E. diminuta, which form yellowish-brown to brown colonies, E. lentecrescens usually has white to light-brown or beige colonies. In addition, conidiophores formed by E. lentecrescens are slightly longer and more branched than those of E. diminuta.

Escovopsis maculosa Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. MycoBank MB 847815. Fig. 12.

Etymology: “maculosa” (maculosa = mottled, full of spots) in reference to the mottled aspect of the mycelial growth displayed by strains of this species on PDA.

Diagnosis: Escovopsis maculosa displays a mottled aspect on the base of plates containing PDA. This is caused by a dense pattern of stolons that give the appearance of spots on the reverse of the colonies.

Typus: Brazil, Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°16’15.7’’S, 61°01’8.5’’W, fungus garden of Acromyrmex sp., 24 Jan. 2017, Q.V. Montoya, LESF 962 (holotype CBS 149746 preserved as metabolically inactive culture, ex-type culture CBS 149746).

Description: Conidiophores forming 2–14 vesicles, hyaline, irregularly shaped, smooth-walled, alternate or opposite, formed on aerial hyphae. Mono-vesiculate conidiophores 44–82 μm (less frequent), polyvesiculate 57–180 μm long. Conidiophore stipes 10–83 × 4–8 μm, with a septum 0.5–15 μm from the foot cell. Conidiophore branches 26–100 μm long, formed in one level, in almost right angles, alternate or opposite. Stipes on branches 2–75 μm long, with a septum 1–8 μm from conidiophore axis. Vesicles globose, 13–24 × 12–22 μm, aseptate, formed on the tips of conidiophore and branches. Vesicle stipe 5–70 μm long, usually with two to three septa. Phialides formed on vesicles, 5–8 μm long, lageniform, 0.5–1.5 × 0.5–2 μm at the base, 2–4.5 × 2–3.5 μm at the swollen cell and 1–3.5 × 0.5–1 μm at the neck. Conidia formed in chains, oblong, 2–4 × 1.5–2.5 μm, Olive-Ochre (XXX21′′, smooth and thick walls. Chlamydospores absent.

Culture characteristics: Colonies growing at 20, and 25 °C on CMD, PDA, and MEA. At 20 °C, growth starts on third day, on all media. At 25 °C growth starts on third day, on CMA and MEA and on first day on PDA. Colony radius, after 4 d at 20 °C: 2–4 mm on CMD, 2–5 mm on MEA and 2–7 mm on PDA; at 25 °C: 3–5 mm on CMD, 5–7 mm on MEA and 19–30 mm on PDA. Colony morphology — CMD 25 °C, 7 d: colonies with diffuse aerial mycelium, usually spread by stolons, with abundant conidia, White (LIII73(10)) to Olive-Ochre (XXX21′′). MEA 25 °C, 7 d: colonies with diffuse aerial mycelium, spread by stolons, Margerite Yellow (XXX23′′f) to Light Yellow-Green (VI31d). PDA 25 °C, 7 d: colonies with cottony aerial mycelium, abundant stolons, Margerite Yellow (XXX23′′f) to Light Yellow-Green (VI31d). colonies with a mottled aspect on the reverse of the plate on all media, but more visible on PDA. Pustule-like formations and soluble pigments absent.

Ecology: Unknown.

Distribution: This species was found in the amazon regions of Brazil in fungus garden of the attine ant genus Acromyrmex.

Notes: Escovopsis maculosa is closely related to E. aspergilloides. However, E. maculosa grows faster and forms shorter and less branched conidiophores than E. aspergilloides. Unlike E. aspergilloides, which forms vesicles of various shapes i.e., globose, sub-globose, capitate, obovoid, prolate and spatulate, E. maculosa forms mainly globose vesicles.

Escovopsis moelleri H.C. Evans & J.O. Augustin, PLoS ONE 8 (12): e82265, 4. 2013. MycoBank MB 800440. Fig. 13.

Diagnosis: Escovopsis moelleri forms mostly subulate vesicles and conidia with thickened cell walls and ornamentations.

Typus: Brazil, Minas Gerais, Viçosa, Mata do Paraíso, elev. 700 m, fungus garden of Acromyrmex subterraneus molestans Forel, Mar. 2010, J.O. Augustin & H.C. Evans, AUJ5 (holotype IMI 501176, ex-type culture CBS 135748 = DOA626 = VIC 31753). GenBank: JQ815077 (ITS); JQ855715 (28S); MT305413 (rpb1); MT305538(rpb2); JQ855712 (tef1).

Description: Conidiophores forming 2–9 vesicles, hyaline, usually pyramidal, less frequently of irregular shape, smooth-walled, mostly alternate, less frequently opposite, formed on aerial hyphae. Mono-vesiculate conidiophores, rare, 34–54 μm long, and polyvesiculate 70–230 μm long. Conidiophores stipes 2–52 μm × 6–10 μm, with 1–5 septa, first septum 2–7 μm from the foot cell. Conidiophore branches 30–89 μm long, formed in one or two levels, in almost right angles and sometimes slightly curved upward, mostly alternated, less frequent opposite. Stipes on branches 2–20 μm long, with a septum at 2–8.5 μm from conidiophore axis. Vesicles of various shapes, i.e., subulate, oblanceolate, and clavate, 22–60 μm × 5–10 μm, predominantly aseptate and rarely with one septum (clavate-septate), formed on the tips of conidiophore and branches. Vesicle stipe 1.5–17 μm long, with one or three septa. Phialides formed on vesicles, 5–7 μm long, ampulliform, 1.7–3 × 0.5–1 μm at the base, 4.4–5.6 × 3.6–4.8 μm at the swollen section and 1–1.7 × 1–2 μm at the neck. Conidia formed on phialides, predominantly solitary, less frequent in short chains, oblong-ornamented, 6–7 × 3–3.8 μm, Olive-Ochre (XXX21′′), with ornamentation and thick walls. Chlamydospores absent.

Culture characteristics: Colonies growing at 10, 20, and 25 °C on CMD, PDA and MEA. At 10 °C, growth starts between second and third day. At 20 °C, growth starts between first and second day and at 25 °C, growth starts on the first day, on all media. Colony radius, after 4 d at 10 °C: Inconspicuous growth (the colony barely grows on the inoculum); at 20 °C: 23–38 mm on CMD, 35–40 mm on MEA and 31–40 mm on PDA; at 25 °C: >40 mm on CMD, MEA and PDA (colonies reach the plate edge between the third and fourth day). Colony morphology — CMD 25 °C, 7 d: Colonies with thin aerial mycelium, spread by stolons and submerged mycelium, Margerite Yellow (XXX23′′f) to Colonial Buff (XXX21′′d). MEA 25 °C, 7 d: colonies with short aerial mycelium, mostly spread by submerged mycelium, White (LIII73(10)) to Margerite Yellow (XXX23′′f). PDA 25 °C, 7 d: Colonies with cottony aerial mycelium, spread predominantly by submerged mycelium and less by stolons, Margerite Yellow (XXX23′′f) to Olive-Ochre (XXX21′′) (Olive-Ochre (XXX21′′) at centre and Margerite Yellow (XXX23′′f) at margin). Pustule-like formations and soluble pigments absent.

Ecology: Unknown.

Distribution: This species has been found only in one region in Brazil in fungus garden of Acromyrmex subterraneus molestans.

Notes: Escovopsis moelleri is closely related to E. spicaticlavata. Unlike species of its sister clade, which form clavate vesicles, those of E. moelleri are mostly subulate. In addition, E. moelleri does not grow at 30 °C and at 25 °C its colonies grow faster than those of E. spicaticlavata.

Escovopsis multiformis Q.V. Montoya et al., Mycokeys 46: 106. 2019. MycoBank MB 828329. Fig. 14.

Diagnosis: Escovopsis multiformis is characterized by forming vesicles of multiple shapes. Swollen cells are commonly present on the conidiophores.

Typus: Brazil, Santa Catarina, Florianópolis, 27°28’11.28’’S, 48°22’39.48’’W, elev. 119 m, fungus garden of Apterostigma sp., Aug. 2015, A. Rodrigues, LESF 847 (holotype CBS H-23846, ex-type culture CBS 145327). GenBank: MH715091 (ITS); MH715105 (28S); MT305420 (rpb1); MT305545 (rpb2); MH724265 (tef1).

Description: Conidiophores forming 2–9 vesicles, sometimes with swollen cells, hyaline, usually of irregular shape, smooth-walled, alternate or opposite, formed on aerial hyphae. Mono-vesiculate conidiophores 66–130 μm, and polyvesiculate 82–290 μm long. Conidiophore stipes 16–56 μm × 7–9 μm, with 1–3 septa, first septum 1–2 μm from the foot cell. Conidiophore axis usually ends in a vesicle, and sometimes in a swollen cell 16–34 μm × 9–20 μm. Conidiophore branches 32–84 μm long (usually short, sometimes as long as the conidiophore axis), formed in one or three branching levels, usually at right angles and sometimes slightly curved upward, alternate. Swollen cells form 2–6 branches, 28–35 μm long, mostly curved upward, less frequently at right angles. Swollen-cell branch usually ends in a vesicle but sometimes forms an additional swollen cell with 2–4 new branches. Stipes on branches 22–70 μm long, with a septum at 1–2 μm from conidiophore axis. Vesicles of various shapes, i.e., globose, predominantly subglobose, capitate, obovoid, prolate, spatulate, cymbiform, and cylindric, 12–27 × 9–17 μm, aseptate, formed on the tips of conidiophore and branches. Vesicle stipe 22–70 μm long, with one or four septa. Phialides formed on vesicles, 6–10 μm long, lageniform, 1–2.5 × 0.5–1μm at the base, 2.5–4.5 × 2–3.5 μm at the swollen section, 1–4.5 × 0.5–1 μm at the neck. Conidia formed in chains, globose to oblong, 2.5–3.5 μm × 1.5–2.5 μm, Olive-Ochre (XXX21′′), with smooth and slightly thick wall. Chlamydospores absent.

Culture characteristics: Colonies growing at 10 °C on PDA and MEA, and at 20, 25 and 30 °C on CMD, PDA and MEA. At 10 °C growth starts between the second and third day on PDA and MEA and after fourth day on CMD. At 20 °C and 30 °C, growth starts on second day on CMD and on third day on MEA and PDA. At 25 °C, growth starts on second day on all media. Colony radius, after 4 d at 10 °C: Inconspicuous growth (the colony barely grows on the inoculum); at 20 °C: 4–10 mm on CMD, 3–6 mm on MEA and 2–5 mm on PDA; at 25 °C: 6–10 mm on CMD, 4–7 mm on MEA and 4–7 mm on PDA; at 30 °C: 4–7 mm on CMD, mm on 0–3 MEA and 0–2 mm on PDA. Colony morphology — CMD 25 °C, 7 d: Colonies with diffuse aerial mycelium, spread by stolons, submerged mycelium forming dense circular zones, pustule-like formations, Margerite Yellow (XXX23′′f) to Colonial buff (XXX21′′d). MEA 25 °C, 7 d: Colonies with dense cottony mycelium, White (LIII73(10)) to Margerite Yellow (XXX23′′f), forming Margerite Yellow (XXX23′′f) exudates. PDA 25 °C, 7 d: Colonies with raised cottony mycelium, White (LIII73(10)) to Olive-Ochre (XXX21′′) colours (Olive-Ochre (XXX21′′) at centre and White (LIII73(10)) at margin). Rarely forming stolons on MEA and PDA. Soluble pigments absent.

Ecology: Unknown.

Distribution: This species is found in different regions in Brazil and Panama in fungus gardens of the attine genus Apterostigma.

Additional material examined: Brazil, Mato Grosso, Cotriguaçu, 09°49’22.74’’S, 58°15’32.04’’W, elev. 252 m, fungus garden of Apterostigma sp., Oct. 2017. Q.V. Montoya, LESF 1136.

Notes: Escovopsis multiformis is closely related to E. clavata. Unlike strains of E. clavata, which grow only at 20 and 25 °C, E. multiformis also grows at 10 and 30 °C. Conidiophores of E. multiformis are usually shorter and less branched than those of E. clavata, and frequently with swollen cells more frequently, which are larger than those of E. clavata.

Escovopsis papillata Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. MycoBank MB 847816. Fig. 15.

Etymology: “papillata” (papillata = shaped like a nipple) in reference to the nippled aspect of some immature vesicles before they form phialides.

Diagnosis: Escovopsis papillata usually has some vesicles that have a papilla at the terminal part (nipple-shaped). This is more common on immature vesicles when these start to form the phialides.

Typus: Brazil, Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°31’25.8’’S, 60°49’28.62’’W, fungus garden of Apterostigma sp., 23 Jan. 2017, Q.V. Montoya, LESF 960 (holotype CBS 149745 preserved as metabolically inactive culture, ex-type culture CBS 149745). GenBank: OQ589840 (ITS); OQ589790 (28S); OQ596413 (rpb1); OQ603883 (rpb2); OQ603933 (tef1).

Description: Conidiophores forming 2–7 vesicles, hyaline, irregularly shaped, smooth-walled, mostly alternate and less opposite, formed on aerial hyphae. Mono-vesiculate conidiophores 6.5–116 μm, polyvesiculate 45–170 μm long. Conidiophore stipes 7–76 × 3–7 μm, with a septum 0.5–13 μm from the foot cell. Conidiophore branches 25–72 μm long, formed in one level, at right and less than 90° angles, commonly opposite and less frequently alternate. Stipes on branches 9–84 μm long, with a septum 0–4 μm from conidiophore axis. Vesicles mostly obovoid, 18–59 × 15–31 μm, aseptate, formed on the tips of conidiophore and branches. Vesicle stipe 6.5–115 μm long with two to three septa. Phialides formed on vesicles, 5–8 μm long, lageniform, 0.5–2 × 1–2 μm at the base, 2.5–5 × 1.5–3 μm at the swollen cell and 2–3 × 0.5–1 μm at the neck. Conidia formed in chains, oblong, 2–5 × 1.5–2.5 μm, Olive-Ochre (XXX21′′, smooth and thick wall. Chlamydospores absent.

Culture characteristics: Colonies growing at 20, and 25 °C on CMD, PDA, and MEA. At 20 °C, growth starts on the third day, and between the second and third day at 25 °C. Colony radius, after 4 d at 20 °C: 2–5 mm on CMD, 1–2 mm on MEA and 5–10 mm on PDA; at 25 °C: 1–4 mm on CMD, 2–4 mm on MEA and 5–10 mm on PDA. Colony morphology — CMD 25 °C, 7 d: colonies with diffuse aerial mycelium, White (LIII73(10)) to Margerite Yellow (XXX23′′f). MEA 25 °C, 7 d: colonies with dense aerial mycelium, few stolons, Margerite Yellow (XXX23′′f) to Light Yellow-Green (VI31d). PDA 25 °C, 7 d: colonies with diffuse fluffy aerial mycelium, few stolons, White (LIII73(10)) and Margerite Yellow (XXX23′′f) to Colonial Buff (XXX21′′d) (Colonial buff (XXX21′′d) at centre, White (LIII73(10)) and Margerite Yellow (XXX23′′f) at margin). Pustule-like formations and pigments absent.

Ecology: Unknown.

Distribution: This species was found in the Amazon regions of Brazil in fungus gardens of the attine ant genus Apterostigma.

Additional material examined: Brazil, Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°31’25.8’’S, 60°49’28.62’’W, fungus garden of Apterostigma sp., 20 Jan. 2017, Q.V. Montoya, LESF 959.

Notes: Escovopsis papillata is closely related to E. clavata and E. multiformis. Escovopsis papillata grows slower than E. clavata and E. multiformis and does not grow at 30 °C, as is also the case for some strains of E. multiformis. In addition, unlike strains of E. clavata and E. multiformis, which form conidiophores with swollen cells, E. papillata lacks such structures on its conidiophores.

Escovopsis peniculiformis Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. MycoBank MB 847804. Fig. 16.

Etymology: “peniculiformis” (peniculus = duster, formis = shape) in reference to the duster shape of the conidiophores.

Diagnosis: Escovopsis peniculiformis is characterized by forming conidiophores with short branches and very long and thin vesicles at the apex of their conidiophores.

Typus: Panama, Gamboa, fungus garden of Atta colombica, 19 Jan. 2001, N.M. Gerardo, LESF 876 (holotype CBS 149744 preserved as metabolically inactive culture, ex-type culture CBS 149744). GenBank: KM817101 (ITS); OQ589724 (28S); OQ596347 (rpb1); OQ603817 (rpb2); KM817162 (tef1).

Description: Conidiophores forming 2–25 vesicles, hyaline, usually pyramidal, smooth-walled, alternate or less frequent opposite, formed on aerial hyphae. Mono-vesiculate conidiophores 9–77 μm, polyvesiculate 40–1 380 μm long. Conidiophore stipes 12– 570 × 3.5–7 μm, with a septum 1.5–29.5 μm from the foot cell. Conidiophore branches 11–86 μm long, mostly formed by long vesicles, rarely in one or two levels, in almost right angles, alternate and opposite. Stipes on branches 1–24 μm long, with a septum 1–9 μm from conidiophore axis. Vesicles cylindrical, 12–280 × 4.5–7 μm, predominantly aseptate and less frequently septate, predominantly formed on conidiophore axis, less frequently on the axis of branches. Vesicle stipe 0.5–49 μm long, with one or two septa. The terminal vesicle is usually the longest and thinnest and appear to be an extension of the conidiophore apex rather than a vesicle. Phialides formed mainly on vesicles and less frequently on the aerial mycelium, 4.5–10 μm long, lageniform, 0.5–1 × 0.5–1.5 μm at the base, 2–4 × 1.5–3 μm at the swollen section and 1–6 × 0.5–1 μm at the neck. Conidia formed in chains, ellipsoidal, 1.5–3.5 × 1–2.5 μm, Olive-Ochre (XXX21′′), with smooth and thick wall. Chlamydospores absent.

Culture characteristics: Colonies growing at 20, 25, and 30 °C on CMD, PDA, and MEA. Growth starts between the first and second day at all temperatures and on all media. Colony radius, after 4 d at 20 °C: 10–12 mm on CMD, 14–20 mm on MEA and 18–22 mm on PDA; at 25 °C: 18–30 mm on CMD, 39–40 mm on MEA and > 40 mm on PDA (colonies reach plate edge on third day); at 30 °C: 19–20 mm on CMD, 20–25 mm on MEA and 40 mm on PDA. Colony morphology — CMD 25 °C, 7 d: Colonies with submerged and diffuse aerial mycelium, spread by stolons, White (LIII73(10)) to Olive-Ochre (XXX21′′). MEA 25 °C, 7 d: Colonies with dense aerial mycelium, spread by stolons, Colonial buff (XXX21′′d) to Light Brownish olive (XXX19′′k) at centre and Light Yellow-Green (VI31d) to White (LIII73(10)) at margin. On this medium, colonies sometimes Deep Colonial Buff (XXX21′′b) and *Vinaceous-Cinnamon (XXIX13′′b), with submerged mycelium forming dense circular zones. PDA 25 °C, 7 d: Colonies forming abundant aerial mycelium, spread by stolons, White (LIII73(10)) and *Olive-Yellow (XXX23′′) to Ecru-Olive (XXX21′′i) at the centre and White (LIII73(10)) to Margerite Yellow (XXX23′′f) at margin. Commonly forming pustule-like formations. Rarely forming soluble pigments.

Ecology: Unknown.

Distribution: This species is found in Panama and Austin (Texas, USA) in fungus gardens of the attine ant genera Atta, Acromyrmex, and Apterostigma.

Additional materials examined: Panama, fungus garden of Apterostigma sp., 6 Jan. 2003, U.G. Mueller, LESF878. USA, Texas, Austin, 30°22’9.9”N; 97°47’49.8”W, elev. 157.8 m, fungus garden of fungus-growing ant, 19 Nov. 2005, U.G. Mueller, LESF 297.

Notes: Escovopsis peniculiformis is closely related to E. weberi. However, unlike strains of E. weberi, E. peniculiformis does not grow at 10 °C. Conidiophores of E. peniculiformis are usually longer and less branched than those of E. weberi and unlike strains of E. weberi (which form phialides only on vesicles), E. peniculiformis forms phialides on both the vesicles and aerial mycelium (less frequently).

Escovopsis phialicopiosa Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. MycoBank MB 847809. Fig. 17.

Etymology: “phialicopiosa” (phiali = phialide, copiosa = abundant) in reference to the abundant number of phialides formed by strains of this species on their vesicles.

Diagnosis: Escovopsis phialicopiosa forms conidiophores with vesicles covered with phialides to such an extent that they are difficult to observe individually.

Typus: Brazil, Minas Gerais, Uberlândia, Panga Ecological Station, 19°17’17.5”S, 48°39’40.2”W, fungus garden of Trachymyrmex sp., 22 Sep. 2008, A. Rodrigues, LESF 048 (holotype CBS 149738 preserved as metabolically inactive culture, ex-type culture CBS 149738). GenBank: KM817088 (ITS); OQ589739 (28S); OQ596362 (rpb1); OQ603832 (rpb2); KF240731 (tef1).

Description: Conidiophores forming 2–11 vesicles, hyaline, pyramidal, smooth-walled, alternate, formed on aerial hyphae. Mono-vesiculate conidiophores 14–41 μm, polyvesiculate 12–150 μm long. Conidiophore stipes 0–79 μm × 3–7.5 μm, with a septum 0–14 μm from the foot cell. Conidiophore branches 11–62 μm long, formed mostly by a vesicle, rarely with two levels, usually at right angles, alternate or opposite. Stipes on branches 0.5–6 μm long, with a septum 0–1.5 μm from conidiophore axis. Vesicles mostly prolate, 13–42 × 6–12.5 μm, aseptate, formed on conidiophore axis or on the axis of branches. Vesicle stipe 0–1 μm long, aseptate. Phialides formed on vesicles, 4.5–8 μm long, lageniform, 0.5–1 × 0.5–1.5 μm at the base, 2–3 × 1.5–2.5 μm at the swollen section and 2–4 × 0.5–1 μm at the neck. Conidia formed in chains, ellipsoidal, 1.5–4 × 1–2.5 μm, Olive-Ochre (XXX21′′), with smooth and thick wall. Chlamydospores absent.

Culture characteristics: Colonies growing at 20, 25 °C, on CMD, PDA, and MEA and only on PDA and MEA at 30 °C. Growth starts on the third day at 20, and 25 °C on CMD, and between the first and second day at all temperatures, on PDA, and MEA. Colony radius, after 4 d at 20 °C: 1–2 mm on CMD, 4–10 mm on MEA and 12–33 mm on PDA; at 25 °C: 4–7 mm on CMD, 11–25 mm on MEA and 10–25 mm on PDA; at 30 °C: 10–23 mm on MEA and 10–24 mm on PDA. Colony morphology — CMD 25 °C, 7 d: colonies with scatter aerial mycelium, few conidia, without pustule-like formation, White (LIII73(10)) to Margerite Yellow (XXX23′′f). MEA 25 °C, 7 d: colonies with dense cottony aerial mycelium, spread by stolons, few pustule-like formations, White (LIII73(10)) to Margerite Yellow (XXX23′′f) PDA 25 °C, 7 d: colonies with wispy cottony aerial mycelium, spread by stolons, pustule-like formations, White (LIII73(10)) to Olive-Ochre (XXX21′′). Soluble pigments absent.

Ecology: Unknown.

Distribution: This species is distributed in different regions in Brazil in fungus gardens of the attine ants Atta sexdens, Mycetomoellerius dichrous, and Trachymyrmex sp. sensu lato.

Additional materials examined: Brazil, Goiás, Fazenda Pau, fungus garden of Trachymyrmex sp., 8 Apr. 2008, A. Rodrigues, LESF 047; Minas Gerais, Uberlândia, Panga Ecological Station, 19°17’17.5”S, 48°39’40.2”W, fungus garden of Mycetomoellerius dichrous, 22 Sep. 2008, A. Rodrigues, LESF 106; São Paulo, Rio Claro, São Paulo State University (UNESP), fungus garden of Atta sexdens, unknown date, A. Rodrigues, LESF 021.

Notes: Escovopsis phialicopiosa is closely related to E. elongatistipitata. Unlike strains of the latter species, which do not grow at 30 °C and eventually form concentric rings on MEA and PDA, colonies of E. phialicopiosa grow at 30 °C on MEA and PDA and does not produce concentric rings on any media. Escovopsis phialicopiosa forms conidiophores with shorter stipes than those of E. elongatistipitata.

Escovopsis pseudocylindrica Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. MycoBank MB 847811. Fig. 18.

Etymology: “pseudocylindrica” (pseudo = false, cylindrica = Latin feminine of cylindrical) in reference to the “cylindrical” collapsed vesicles observed in old colonies of this species.

Diagnosis: Escovopsis pseudocylindrica forms conidiophores with oblong vesicles that start collapsing after 7 d, as they form phialides and conidia.

Typus: Brazil, Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°31’29.64’’S, 60°49’28.92’’W, fungus garden of Trachymyrmex sp., 20 Jan. 2017, Q.V. Montoya, LESF 993 (holotype CBS 149749 preserved as metabolically inactive culture, ex-type culture CBS 149749). GenBank: OQ589819 (ITS); OQ589769 (28S); OQ596392 (rpb1); OQ603862 (rpb2); OQ603912 (tef1).

Description: Conidiophores forming 2–14 vesicles, hyaline, irregularly shaped, smooth-walled, alternate, less frequent opposite, formed on aerial hyphae. Mono-vesiculate conidiophores 20–36 μm, polyvesiculate 46–270 μm long. Conidiophore stipes 2–112 × 4–8 μm, with a septum 2–14 μm from the foot cell. Conidiophore branches 21–148 μm long, formed in one or two levels, at angles less than 90°, alternate or opposite. Stipes on branches 1.5–38.5 μm long, with a septum 0.5–4 μm from conidiophore axis. Vesicles mainly prolate, 9–45 × 4–12 μm, aseptate, formed on the tips of conidiophore and branches. Vesicle stipe 1–26 μm long, with one or three septa. Phialides formed on vesicles, 4–7 μm long, lageniform, 0–1.5 × 1–2 μm at the base, 2–4 × 2–3 μm at the swollen section and 1–2.5 × 0.5–1 μm at the neck. Conidia formed in chains, oblong, 2–6 × 3–4 μm, Olive-Ochre (XXX21′′), with ornamented and thick wall. Chlamydospores absent.

Culture characteristics: Colonies growing at 20, 25 °C on CMD, PDA, and MEA, and only on PDA at 30 °C. At 20 °C growth starts on the second day, at 25 °C on the first day, and at 30 °C on third day. Colony radius, after 4 d at 20 °C: 3–9 mm on CMD, 9–14 mm on MEA and 10–15 mm on PDA; at 25 °C: 10–15 mm on CMD, 16–20 mm on MEA and 26–35 mm on PDA; at 30 °C: 2–6 mm on PDA. Colony morphology — CMD 25 °C, 7 d: colonies with diffuse aerial mycelium, Margerite Yellow (XXX23′′f) and White (LIII73(10)) to Colonial Buff (XXX21′′d). MEA and PDA 25 °C, 7 d: colonies with cottony aerial mycelium, spread by stolons; White (LIII73(10)), Colonial buff (XXX21′′d), Olive-Ochre (XXX21′′) and Ecru-Olive (XXX21′′i) (Ecru-Olive (XXX21′′i) at centre, White (LIII73(10)) at margin); sometimes Light Yellow-Green (VI31d), *Olive-Yellow (XXX23′′). Pustule-like formations and soluble pigments absent.

Ecology: Unknown.

Distribution: This species was found in the amazon regions of Brazil in fungus garden of the attine ant Trachymyrmex.

Additional material examined: Brazil, Amazonas, Novo Airão, Parque Nacional de Anavilhanas, S2°16’9.3’’S, 59° 27’32.54’’W, fungus garden of Trachymyrmex sp., 24 Jan. 2017, Q.V. Montoya, QVM157, LESF 1029.

Notes: Escovopsis pseudocylindrica is closely related to E. spicaticlavata. Unlike strains of the latter species, which grow only on PDA at 30 °C, E. pseudocylindrica can grow on all media at this temperature. In addition, conidiophores of E. pseudocylindrica are more branched than those of E. spicaticlavata.

Escovopsis rectangula Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. MycoBank MB 847808. Fig. 19.

Etymology: “rectangula” (rectangula = right angled) in reference to the slightly rectangular shape of the conidiophores formed by strains of this species.

Diagnosis: Escovopsis rectangula forms slightly rectangular conidiophores, usually with branches formed by a long cylindrical vesicle.

Typus: Brazil, Rondônia, Fazenda São Sebastião, fungus garden of Acromyrmex sp., 7 Oct. 2018, A. Rodrigues, LESF 050 (holotype CBS 149739 preserved as metabolically inactive culture, ex-type culture CBS 149739). GenBank: KM817091 (ITS); OQ589729 (28S); OQ596352 (rpb1); OQ603822 (rpb2); KM817152 (tef1).

Description: Conidiophores forming 2–34 vesicles, hyaline, slightly rectangular shape, smooth-walled, alternately, formed on aerial hypha. Mono-vesiculate conidiophores 24–56 μm, polyvesiculate 47–250 μm long. Conidiophore stipe 2.5–72.5 μm × 4–6.5 μm, with a septum 0–12.5 μm from the foot cell. Conidiophore branches 16.5–220 μm long, formed in one or two levels, usually at right angles, alternate. Stipes on branches 1–87 μm long, with a septum 1–28 μm from conidiophore axis. Vesicles cylindrical, 20–58 × 4–9 μm, predominantly non-septate, less frequently septate (1 septum), formed on conidiophore axis or on the axis of branches. Vesicle stipe 1–12 μm long, septate (1 septum). Phialides formed on vesicles, 5–8 μm long, lageniform, 0.5–1 × 0.5–2 μm at the base, 2–3.5 × 1–3 μm at the swollen section and 1–5 × 0.5 μm at the neck. Conidia formed in chains, subglobose, 2–4 × 1.5–3 μm, Olive-Ochre (XXX21′′), with smooth and thick wall. Chlamydospores absent.

Culture characteristics: Colonies growing at 10, 20, 25, and 30 °C on CMD, PDA, and MEA. At 10 °C growth starts between second and third day, and at 20, 25, and 30 °C growth starts on the first day, on all media. Colony radius, after 4 d at 10 °C: Inconspicuous growth (the colony barely grows on the inoculum) but with few conidia production; at 20 °C: 8–11 mm on CMD, 6–24 mm on MEA and 13–35 mm on PDA; at 25 and 30 °C: 10–20 mm on CMD, 27–40 mm on MEA and 40 mm on PDA. Colony morphology — CMD 25 °C, 7 d: colonies with scattered aerial mycelium, abundant short pustule-like formations, White (LIII73(10)) to Olive-Ochre (XXX21′′) (Olive-Ochre (XXX21′′) at centre, White (LIII73(10)) at margin). MEA 25 °C, 7 d: colonies with dense cottony aerial mycelium, without pustule-like formations, White (LIII73(10)) to Margerite Yellow (XXX23′′f). PDA 25 °C, 7 d: colonies with dense cottony aerial mycelium, spread by stolons, abundant pustule-like formations, White (LIII73(10)) to Light Brownish olive (XXX19′′k) (White (LIII73(10)) at centre, Light Brownish olive (XXX19′′k) at margin forming a ring). Soluble pigments absent.

Ecology: Unknown.

Distribution: This species is found in Brazil, Mexico and Panama in fungus gardens of the attine ant genera Acromyrmex, Apterostigma, and Trachymyrmex.

Additional materials examined: Brazil, Pernambuco, Frei Caneca, fungus garden of Atta cephalotes, 21 Jan. 2004, A. Rodrigues, LESF 022; Bahia, Camacan, Santa Cruz State University (UESC), 14°47’56.8’’S, 39°10’16.4’’W, fungus garden of Atta cephalotes, 15 Mar. 2013, A. Rodrigues, LESF 326. Mexico, Guadeloupe island, fungus garden of Acromyrmex octospinosus, 24 Dec. 2003, N.M. Gerardo, LESF 865. Panama, fungus garden of Apterostigma dentigerum, 9 Jul. 2002, N.M. Gerardo, LESF 863.

Notes: Escovopsis rectangula is closely related to E. chlamydosporosa. Unlike strains of the latter species, which do not grow at 10 °C and usually form chlamydospores, E. rectangula grows at 10 °C and rarely forms these structures. Conidiophores of E. rectangula are short, less branched and have a slightly rectangular shape, while conidiophores of E. chlamydosporosa are longer, more branched, and irregularly shaped.

Escovopsis rosisimilis Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. MycoBank MB 847813. Fig. 20.

Etymology: “rosisimilis” (rosi = roses, similis = like) in reference to the shape of blooming roses displayed by the conidiophore aggregations on the aerial mycelium.

Diagnosis: Escovopsis rosisimilis forms clusters of short, tangled conidiophores on the aerial mycelium that resemble blooming roses.

Typus: Brazil, Minas Gerais, Uberlândia, Panga Ecological Station, 19°17’17.5”S, 48°39’40.2”W, fungus garden of Trachymyrmex sp., 20 Aug. 2008, A. Rodrigues, LESF 135 (holotype CBS 149742 preserved as metabolically inactive culture, ex-type culture CBS 149742). GenBank: KM817086 (ITS); OQ589740 (28S); OQ596363 (rpb1); OQ603833 (rpb2); KM817148 (tef1).

Description: Conidiophores forming 2–16 vesicles, hyaline, irregularly shaped, smooth-walled, alternate or opposite, formed on aerial hyphae. Mono-vesiculate conidiophores 21–80 μm, polyvesiculate 47–210 μm long. Conidiophore stipes 5–65 × 5–15 μm, with a septum 1–7 μm from the foot cell. Conidiophore branches 21–110 μm long, formed in up to two levels, in almost right angles, alternate or opposite. Stipes on branches 5–38 μm long, with a septum 1–9 μm from conidiophore axis. Vesicles globose, 13–62 × 14–58 μm, aseptate, formed on the tips of conidiophore and branches. Vesicle stipe 2–34 μm long, with two septa. Phialides formed on vesicles, 5–8 μm long, lageniform, 0.5–1 × 0.5–2 μm at the base, 2–3 × 1–3 μm at the swollen section and 1.5–3 × 0.5–1 μm at the neck. Conidia formed in chains, oblong, 1.5–3 × 1–2 μm, Olive-Ochre (XXX21′′), smooth and thick wall. Chlamydospores absent.

Culture characteristics: Colonies growing at 20, and 25 °C on CMD, PDA, and MEA. At 20 and 25 °C growth starts on the third day on CMD and MEA, and on the second day on PDA, on all media. Colony radius, after 4 d at 20 °C: 2–18 mm on CMD, 4–7 mm on MEA and 15–22 mm on PDA; at 25 °C: 5–7 mm on CMD, 5–10 mm on MEA and 20–32 mm on PDA. Colony morphology — CMD 25 °C, 7 d: colonies with diffuse aerial mycelium, Margerite Yellow (XXX23′′f) to Light Yellow-Green (VI31d). MEA 25 °C, 7 d: colonies with dense aerial mycelium, Margerite Yellow (XXX23′′f) to Picnic Yellow (IV23d) and *Olive-Yellow (XXX23′′). PDA 25 °C, 7 d: colonies with dense cottony aerial mycelium, spread by stolons, mostly White (LIII73(10)) and less frequently Light Yellow-Green (VI31d) (Light Yellow-Green (VI31d) at centre, White (LIII73(10)) at margin). Pustule-like formations and soluble pigments absent.

Ecology: Unknown.

Distribution: This species was found in Minas Gerais and in the Amazon regions of Brazil in fungus gardens of the attine ant Trachymyrmex.

Notes: Escovopsis rosisimilis is closely related to E. diminuta and E. lentecrescens. Escovopsis rosisimilis grows faster than

E. lentecrescens, but slower than E. diminuta. Furthermore, E. rosisimilis forms slightly longer and more entangled conidiophores on the aerial mycelium than E. lentecrescens and E. diminuta.

Escovopsis spicaticlavata Q.V. Montoya, M.J.S. Martiarena & A. Rodrigues, sp. nov. MycoBank MB 847812. Fig. 21.

Etymology: “spicaticlavata” (spicati = spikes, clava = club) in reference to the spiked club shape of the vesicles formed by this species.

Diagnosis: Escovopsis spicaticlavata forms irregularly shaped conidiophores with mostly prolate vesicles that resemble a spiked club because of the phialides jutting out from it.

Typus: Brazil, Amazonas, Manaus, Biological Dynamics of Forest Fragments Project (PDBFF–Camp 41), 2°26’54.84’’S, 59°46’10.02’’W, fungus garden of Paratrachymyrmex diversus, 9 Jan. 2009, A. Rodrigues, LESF 052 (holotype CBS 149740 preserved as metabolically inactive culture, ex-type culture CBS 149740). GenBank: KM817093 (ITS); MH715124 (28S); MT305437 (rpb1); MT305562 (rpb2); KM817154 (tef1).

Description: Conidiophores forming 2–15 vesicles, sometimes with swollen cells, hyaline, irregular shaped, smooth-walled, alternate or opposite, formed on aerial hyphae. Mono-vesiculate conidiophores rarely, 22–110 μm long, polyvesiculate 63.5–400 μm long. Conidiophore stipe 18.5–150 × 3–10 μm, with a septum mostly 0–5 μm and rarely 8–15 μm from the foot cell. Conidiophore axis usually ends in a vesicle, less frequently in a terminal swollen cell. Conidiophore branches 28–120 μm long, formed on conidiophore axis or on swollen cells, in one level, almost at right angles, sometimes curved upward or down, alternate or opposite. Conidiophore branches sometimes ends in a swollen cell. Swollen cells 11–25 × 9–17 μm, form up to three branches. Stipes on branches 5–38 μm long, with a septum 0–7 μm from conidiophore axis. Vesicles mainly prolate, 14.5–39 × 7–15 μm, aseptate, formed on conidiophore axis or on swollen cells. Vesicle stipe 2–69 μm long, with one or four septa. Phialides formed on vesicles, 5–9.5 μm long, lageniform, 0–2.5 × 1–2 μm at the base, 2–5.5 × 2–3 μm at the swollen section and 1–3 × 0.5–1.5 μm at the neck. Conidia formed in chains, oblong, 2–5 × 2–3.5 μm, Olive-Ochre (XXX21′′), with ornamented thick wall. Chlamydospores absent.

Culture characteristics: Colonies growing at 20, 25, and 30 °C on CMD, PDA, and MEA. At 20 °C, growth starts on the second day and at 25 and 30 °C on the first day. Colony radius, after 4 d at 20 °C: 9–14 mm on CMD, 10–30 mm on MEA and 15–28 mm on PDA; at 25 °C: 15–20 mm on CMD, 25–35 mm on MEA and 20–30 mm on PDA; at 30 °C: 15–20 mm on CMD, 25–35 mm on MEA and 20–28 mm on PDA. Colony morphology — CMD 25 °C, 7 d: colonies with diffuse aerial mycelium, White (LIII73(10)) or Margerite Yellow (XXX23′′f) to Colonial buff (XXX21′′d). MEA 25 °C, 7 d: colonies with diffuse cottony aerial mycelium, spread by stolons, White (LIII73(10)) or Margerite Yellow (XXX23′′f) to *Olive-Yellow (XXX23′′) (*Olive-Yellow (XXX23′′) at centre, White (LIII73(10)) to Margerite Yellow (XXX23′′f) at margin). PDA 25 °C, 7 d: Colonies with cottony aerial mycelium, spread by stolons, White (LIII73(10)) and Colonial Buff (XXX21′′d) (Colonial Buff (XXX21′′d) at centre, White (LIII73(10)) at margin). Pustule-like formations and soluble pigments absent.

Ecology: Unknown.

Distribution: This species was found in the Amazon regions of Brazil in fungus garden of the attine ant Trachymyrmex.

Additional materials examined: Brazil, Amazonas, Novo Airão, Parque Nacional de Anavilhanas, 2°31’25.3’’S, 60°49’33.1’’W, fungus garden of Trachymyrmex sp., 20 Jan. 2017, Q.V. Montoya, LESF 975; Amazonas, Novo Airão, Parque Nacional de Anavilhanas, fungus garden of Trachymyrmex sp., 24 Jan. 2017, Q.V. Montoya, LESF 979.

Notes: Escovopsis spicaticlavata is closely related to E. pseudocylindrica. Unlike strains of the latter species, which grow at 30 °C on all media, E. spicaticlavata grows only on PDA at this temperature. Conidiophores of E. spicaticlavata are less branched than those of E. pseudocylindrica.

Escovopsis weberi J.J. Muchovej & Della Lucia, Mycotaxon 37: 192. 1990. MycoBank MB 127786. Fig. 22.

Synonym: Escovopsis microspora H.C. Evans & J.O. Augustin, PLoS ONE 8: e82265, 4. 2013. MycoBank MB 800442. Diagnostic characters: Escovopsis weberi grows faster than other known Escovopsis species and exhibits the most variable colony colours in the genus.

Typus: Brazil, Minas Gerais, Viçosa, ant colony, 25 Mar. 1987, Della Lucia (Herbário, UFV–Universidade Federal de Viçosa) (holotype ATCC 64542 preserved as metabolically inactive culture). GenBank: KF293285 (ITS); KF293281 (28S); MT305412 (rpb1); MT305537 (rpb2); MZ170961 (tef1).

Description: Conidiophores forming 1–48 vesicles, hyaline, usually pyramidal, less frequently of irregular shape, smooth-walled, alternate or less frequent opposite, formed on aerial hyphae. Mono-vesiculate conidiophores 20–60 μm, polyvesiculate 30–570 μm long. Conidiophore stipes 45–90 × 5–7 μm, with a septum 2–5 μm from the foot cell. Conidiophore branches 34–120 μm long, formed in one or two levels, in almost right angles and sometimes slightly curved upward, mostly alternate and occasionally opposite. Stipes on branches 10–36 μm long, with a septum 1.5–3 μm from conidiophore axis. Vesicles of various shapes, i.e., cylindrical, clavate, or filiform, 21–63 × 6–12 μm, predominantly aseptate, less frequently septate (1–2 septa), formed directly on conidiophore axis or on the axis of branches. Vesicle stipe 1–12 μm long, without septa. Phialides formed on vesicles, 7–9 μm long, lageniform, 0.5– 1 × 1–1.5 μm at the base, 2.5–3 × 2.5–3 μm at the swollen section and 3–4 × 0.5–0.8 μm at the neck. Conidia formed in chains, ellipsoidal to oblong, 2.5–3 × 1.5–2.5 μm, Olive-Ochre (XXX21′′), with smooth and thick wall. Chlamydospores absent.

Culture characteristics: Colony growing at 10, 20, 25, and 30 °C on CMD, PDA, and MEA. At 10 °C, growth starts on the third day, and at 20, 25, and 30 °C, growth starts on the first day on all media. Colony radius, after 4 d at 10 °C: Inconspicuous growth (the colony barely grows on the inoculum); at 20 °C: 20–24 mm on CMD, 30– 40 mm on MEA and 40 mm on PDA; at 25 °C: 17–36 mm on CMD, 24–40 mm on MEA and > 40 mm on PDA (in this case colonies reach plate edge on third day); at 30 °C: 37–40 mm on CMD, 12–15 mm on MEA and 37–40 mm on PDA. Colony morphology — CMD 25 °C, 7 d: Colonies with diffuse aerial mycelium, spread by stolons, forming small pustule-like structures, White (LIII73(10)) to Olive-Ochre (XXX21′′). MEA 25 °C, 7 d: colonies with abundant aerial mycelium; varying in colour, usually Colonial buff (XXX21′′d) to Olive-Ochre (XXX21′′) at centre (often Picnic Yellow (IV23d) and Deep Colonial Buff (XXX21′′b) are also observed), surrounded by *Vinaceous-Cinnamon (XXIX13′′b) to Colonial buff (XXX21′′d) and Margerite Yellow (XXX23′′f) to Ecru-Olive (XXX21′′i) regions, White (LIII73(10)) to Light Yellow-Green (VI31d) at margin; submerged mycelium forming dense circular zones, with White (LIII73(10)) to Olive-Ochre (XXX21′′) pustules. PDA 25 °C, 7 d: colonies with abundant aerial mycelium spread by stolons; White (LIII73(10)) to Olive-Ochre (XXX21′′), sometimes Picnic Yellow (IV23d) to Ecru-Olive (XXX21′′i) and *Vinaceous-Cinnamon (XXIX13′′b) to Deep Colonial Buff (XXX21′′b); eventually with pustule-like formations. Occasionally forming soluble pigments.

Ecology: Some representatives of this species are opportunists in the fungus gardens of leaf-cutting ants and a few strains were reported as mycoparasites of Leucoagaricus gongylophorus, the fungal cultivar of Atta.

Distribution: Across Brazil.

Additional materials examined: Brazil, Bahia, Ilhéus, Santa Cruz State University (UESC), 14°47’56.8’’S, 39°10’16.4’’W, fungus garden of Acromryrmex balzanii, unknown collection date, A. Rodrigues, LESF 054; Mato Grosso, Alta Floresta, fungus garden of Atta cephalotes, unknown collection date, A. Rodrigues, LESF 023; Rio Grande do Sul, Chuvisca, grassland, 30°50’10.2”S, 51°55’10.4”W, fungus garden of Acromyrmex lundii, unknown collection date, A. Rodrigues, LESF 042; Rio Grande do Sul, Chuvisca, grassland, 30°50’10.2”S, 51°55’10.4”W, fungus garden of Acromyrmex heyeri, unknown collection date, A. Rodrigues, LESF 043; São Paulo, Botucatu, Fazenda Santana, 22°50’45.8’’S, 48°26’09.4’’W, fungus garden of Atta sexdens rubropilosa, unknown collection date, A. Rodrigues, LESF 019; São Paulo, Botucatu, Fazenda Santana, 22°50’46.4”S, 48°26’09.6”W, fungus garden of Atta capiguara, unknown collection date, A. Rodrigues, LESF 292; São Paulo, Corumbataí, Fazenda Corumbataí, 22°17’22’’S, 47°39’23’’W, fungus garden of Atta sexdens, unknown collection date, A. Rodrigues, LESF 031; São Paulo, Corumbataí, Fazenda Corumbataí, 22°17’21.7’’S, 47°39’22.8’’W, fungus garden of Atta sexdens rubropilosa, unknown collection date, A. Rodrigues, LESF 156; São Paulo, Thermas de Santa Bárbara, 22°49’10.6”S, 49°16’06.2”W, fungus garden of Atta laevigata, unknown collection date, A. Rodrigues, LESF 324.

Notes: Escovopsis weberi is closely related to E. peniculiformis. The conidiophores of E. weberi are usually shorter but more branched than those of E. peniculiformis. Furthermore, the vesicles of E. weberi are shorter and wider than those of E. peniculiformis. The morphological characters of E. weberi do not differentiate it from E. microspora. In addition, the ex-type strains have only one nucleotide difference in the ITS, rpb1 and rpb2 sequences, no difference in the 28S and tef1, and they form together with other isolates of E. weberi a well-supported clade. Although E. microspora was described based on the supposition that the conidial sizes differ from E. weberi, the measurements of Augustin et al. (2013) are within the range observed in the broader sampling of E. weberi examined here.

Dichotomous key to known Escovopsis species

1a. Colony growth < 20 mm at 25 °C on PDA ................................................................................................................................................. 2

1b. Colony growth > 20 mm at 25 °C on PDA ................................................................................................................................................. 8

2a. Aerial mycelium Margerite Yellow (XXX23′′f), Light Yellow-Green (VI31d) to Picnic Yellow (IV23d) on CMD ........................................... 3

2b. Aerial mycelium White (LIII73(10)) on CMD .............................................................................................................................................. 6

3a. Colonies growing at 10 °C on CMD, PDA, and MEA ............................................................................................................ E. multiformis

3b. Colonies not growing at 10 °C ................................................................................................................................................................... 4

4a. Aerial mycelium Light Yellow-Green (VI31d) to Picnic Yellow (IV23d) on CMD ................................................................ E. aspergilloides

4b. Aerial mycelium Light Brownish olive (XXX19′′k) on CMD ........................................................................................................................ 5

5a. Aerial mycelium Margerite Yellow (XXX23′′f) on CMD ................................................................................................................. E. clavata

5b. Aerial mycelium Light Yellow-Green (VI31d) on CMD ...................................................................................................... E. lentecrescens

6a. Aerial mycelium Margerite Yellow (XXX23′′f) on CMD ............................................................................................................................... 7

6b. Aerial mycelium *Olive-Yellow (XXX23′′) on CMD ..................................................................................................................... E. diminuta

7a. Aerial mycelium White (LIII73(10)) on MEA ........................................................................................................................ E. phialicopiosa

7b. Aerial mycelium Light Yellow-Green (VI31d) on MEA ................................................................................................................ E. papillata

8a. Aerial mycelium Margerite Yellow (XXX23′′f) on MEA ............................................................................................................................... 9

8b. Aerial mycelium Colonial buff (XXX21′′d) on MEA ................................................................................................................................... 16

9a. Colonies with clusters of short, tangled conidiophores on the aerial mycelium ....................................................................... E. rosisimilis

9b. Colonies without clusters of short, tangled conidiophores on the aerial mycelium .................................................................................. 10

10a. Colonies not growing at 10 °C ............................................................................................................................................................... 11

10b. Colonies growing at 10 °C on CMD, PDA, and MEA ............................................................................................................................ 14

11a. Colonies growing at 30 °C on CMD, PDA, and MEA ............................................................................................................................. 12

11b. Colonies do not grow at 30 °C on CMD, PDA, and MEA ....................................................................................................................... 13

12a. Colonies with a mottled aspect on the reverse of the plate ................................................................................................... E. maculosa

12b. Colonies with a uniform aspect on the reverse of the plate ....................................................................................................... E. gracilis

13a. Colonies forming abundant chlamydospores ............................................................................................................ E. chamydosporosa

13b. Colonies rarely forming chlamydospores ........................................................................................................................ E. spicaticlavata

14a. Aerial mycelium forming slightly rectangular conidiophores ................................................................................................. E. rectangula

14b. Aerial mycelium forming pyramidal or irregularly shaped conidiophores ............................................................................................... 15

15a. Colonies growing at 30 °C on CMD, PDA, and MEA, conidia ornamented .............................................................................. E. moelleri

15b. Colonies not growing at 30 °C on any media, conidia without ornamentations ......................................................................... E. weberi

16a. Colonies growing at 10 °C on CMD, PDA, and MEA ........................................................................................................ E. breviramosa

16b. Colonies not growing at 10 °C on CMD, PDA, and MEA ...................................................................................................................... 17

17a. Aerial mycelium white on CMD, Light Yellow-Green (VI31d) on PDA and *Olive-Yellow (XXX23′′) and Ecru-Olive (XXX21′′i) on MEA ............................................................................................................................................................................................. E. pseudocylindrica

17b. Aerial mycelium, Colonial buff (XXX21′′d) or Margerite Yellow (XXX23′′f) on CMD, Margerite Yellow (XXX23′′f) on PDA and without *Olive-Yellow (XXX23′′) and Ecru-Olive (XXX21′′i) colours on MEA .............................................................................................................. 18

18a. Colonies growing at 30 °C .............................................................................................................................................. E. peniculiformis

18b. Colonies not growing at 30 °C ..................................................................................................................................... E. elongatistipitata

DISCUSSION

Here we provide a new taxonomic framework comprising a set of laboratory conditions (media, temperatures and time of evaluation), morphological characters and phylogenetic markers to evaluate the morphology and species concepts in the genus Escovopsis. Following this framework, we redescribed the ex-type cultures of six Escovopsis species (Figs 4, 7, 11, 13, 14, 22), including the type of the genus, E. weberi, synonymised E. microspora with E. weberi, and introduced thirteen new species. Our standardised approach provides a solid basis for future phylogenetic and morphological studies of the diversity and speciation of these Hypocreaceae fungi.

The description of new fungal species is not a simple task (Raja et al. 2017, 2021), as an integrated molecular and morphological analysis is needed for accurate species delimitation (Taylor et al. 2000, Lücking et al. 2020, 2021). This forms a basis for a taxonomic framework that enables to meet the challenges of describing of new fungal species (Raja et al. 2017, 2021, Senanayake et al. 2020, Koukol & Delgado 2021). Since the discovery of Escovopsis by Möller (1893), only twelve species of this genus have been described (Seifert et al. 1995, Augustin et al. 2013, Masiulionis et al. 2015, Meirelles et al. 2015a). This is mainly because: (i) for a long time, fungi of different genera were treated as Escovopsis without any taxonomic support, (ii) only the ITS region or tef1 genes were sequenced for most of the isolates (which prevented a multilocus analysis), and (iii) the taxonomic uncertainties have long hampered interspecific morphological comparisons and assessment of the morphological diversity of described and new species in the genus (Montoya et al. 2019, 2021).

Although the disagreements between alternative phylogenetic hypotheses of Escovopsis were recently solved (Montoya et al. 2021), this is the first time that a multilocus analysis following the GCPSR species concept is used in combination with a standardised morphological evaluation to assess the diversity of these attine colony inhabitants. Our results show that the combined analysis of the five molecular markers, sequenced in this study, provides a strong support to distinguish the species of Escovopsis and to clarify their phylogenetic relationships. However, separate analyses performed with each of the molecular markers shows that the 28S region does not resolve species in this genus. The limitation of the 28S region to distinguish phylogenetic relationships between other Hypocreaceae genera, i.e., Protocrea, Sphaerostilbella, Hypomyces and Trichoderma, has been reported in several studies (Põldmaa et al. 1999, Põldmaa 2000, Druzhinina & Kubicek 2005, Jaklitsch & Samuels 2011). Therefore, future studies may consider to exclude this molecular marker from the sequencing. On the other hand, while the ITS region and the rpb1 gene provide adequate resolution for some species, these are unable to distinguish others (mainly those that form clade I, Fig. S1C, D). Although the trees reconstructed with ITS, rpb1 and 28S have different topologies, the species E. clavata, E. diminuta, E. maculosa, E. multiformis, and E. rectangula remain as well-supported and separate clades in the three trees (Fig. S1). On the other hand, rpb2 and tef1 were the most suitable genes to delimitate well-supported Escovopsis species and larger monophyletic groups. The tree of rpb2 and that of the five markers combined share the same topology and differ slightly from that of tef1 (Fig. S1). Interestingly, rpb2 and tef1 genes are considered molecular barcodes for genus Trichoderma (Chaverri et al. 2015), a sister clade of Escovopsis. Future studies should analyse the application of these genes as barcodes to assess the diversity and identify new species in Escovopsis.

Based on the high genetic diversity, as shown here and in ecological studies (Gerardo et al. 2006a, Meirelles et al. 2015b), a comparable morphological diversity was also expected in Escovopsis. While our results show abundant morphological and physiological differentiation among Escovopsis species; growth rates at different temperatures, colony colours and vesicle shapes appear to be the most diagnostic characters. Briefly, species in clades I, II, and III (in this order) are fast-growing, grow over wider temperature ranges and have cylindrical vesicles, while species in clades IV and V, grow slowly and at narrow temperature ranges, and form globose vesicles (Figs 2, 3). Future studies are needed to evaluate, from an evolutionary perspective, whether these characters are related to the diversification or the ecology of species in this genus.

On the other hand, many species in the family Hypocreaceae are ecologically associated with plants as versatile symbionts (Jaklitsch 2009, Jaklitsch & Samuels 2011, Bailey & Melnick 2013, Guzmán-Guzmán et al. 2019). However, in the genera Hypomyces and Trichoderma that are closely related to Escovopsis, many species also act as mycoparasites (Põldmaa 2000, Druzhinina et al. 2011, Atanasova et al. 2013, Chaverri & Samuels 2013, Kubicek et al. 2019, Mukherjee et al. 2022). Species of Trichoderma, that are mycoparasites, can form specialized structures, such as hooks, papilla-like, and coiling hyphae, and produce enzymes that help the fungus penetrate and degrade host cell walls (Brotman et al. 2010, Druzhinina et al. 2011). In Escovopsis, only few strains of E. weberi have been reported to be specialized, and virulent mycoparasites of the attine cultivars, Leucoagaricus sp. (Currie et al. 1999, Currie 2001, Currie et al. 2003), or to form specialized structures, apparently to parasitise it (Marfetán et al. 2015). Isolates of this species are also able to produce metabolites that are harmful to the fungal cultivars, the ants, and the ants’ associated bacteria Pseudonocardia (Boya et al. 2017, Heine et al. 2018, Batey et al. 2020). Despite this, recent studies using many Escovopsis species (including many isolates of E. weberi) have proven that most of the species of this genus have low virulence (Mendonça et al. 2021) and an opportunistic nature modulated by the susceptibility of the ant cultivars (Jiménez-Gómez et al. 2021). In this study, we carried out a detailed analysis of the microscopic structures of Escovopsis. Notwithstanding, we did not observe any structure that would resemble a specialized structure, i.e., hooks, papilla-like, and coiling hyphae (Druzhinina et al. 2011), related to parasitizing other fungi. However, we evaluated the isolates in axenic culture conditions. Considering the variability of synapomorphic characters of the close relatives of Escovopsis, it is expected that species of this genus present not only characters of mycoparasites but also related to other lifestyles. Future studies are needed to evaluate all Escovopsis species in co-cultures with the ant cultivars or other microorganisms and to check whether these species (other than E. weberi) are capable of producing specific structures or secondary metabolites to parasitize other fungi or damage the fungal cultivars, the ants, or their associated bacteria.

Finally, in contrast to their closest relatives (e.g., Trichoderma and Hypomyces sensu lato, among others), many of which are ubiquitous (Jaklitsch 2009), and can infect various host fungi cultivated by humans (Tamm & Põldmaa 2013), Escovopsis has only been found in association with attine ant colonies. Cocladogenesis and genomic analyses suggested a coevolutionary history between Escovopsis (as the ant fungus garden parasites), the attine ants, and their mutualistic Basidiomycota fungi (Currie et al. 2003, Gotting et al. 2022). Although these studies did not consider the taxonomic analyses that revealed that the group of fungi they named as Escovopsis correspond to different genera, i.e., Escovopsis, Sympodiorosea and Luteomyces (Montoya et al. 2021), the data suggests that Escovopsis maintains an ancient symbiotic relationship with the ants. Considering that close ecological relationships maintained for millions of years, such as mutualism or parasitism, influence the adaptation of the species by multiple selection pressures (Kessler & Halitschke 2009, Hutchinson et al. 2018), it is expected that morphological variations, observed in this study, throughout the Escovopsis phylogeny are related to its symbiotic relationships with the attine ants and/ or their fungal cultivars. Studies on the taxonomy of Escovopsis are, like those on the ecological (Currie et al. 2003, Gerardo et al. 2004, 2006b, Taerum et al. 2007, Folgarait et al. 2011, Diego et al. 2014, Marfetán et al. 2015, Birnbaum & Gerardo 2016), biochemical (Boya et al. 2017, Heine et al. 2018), and genomic (De Man et al. 2016) aspects, important to answer this question. Future studies should combine all these approaches to shed light on the environmental and ecological pressures that affect morphological diversity in Escovopsis and their influence on the evolution of attine ants.

Acknowledgments

We would like to thank the research team of the Laboratory of Fungal Ecology and Systematics (LESF) - São Paulo State University, Rio Claro, SP, Brazil), especially Ariane Janaina Rodrigues for her valuable help in the laboratory. We would also like to thank Dr Keith Seifert for all valuable comments and edits on this manuscript. Similarly, we would like to thank Dr Mônica T. Pupo and her research team for organizing the collection in the Brazilian Amazon Forest (Novo Airão, Amazonas) from where we obtained some of the isolates used in this study, and Dr Nicole M. Gerardo and Dr Ulrich G. Mueller for providing some isolates for this study. Finally, we would like to thank the editors and the two reviewers for valuable comments on this manuscript. We are grateful to Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) for financial support to AR (grants # 2014/24298-1, # 2017/12689-4 and #2019/03746-0) and for scholarships to QVM (# 2016/04955-3, # 2018/07931-3 and # 2021/04706- 1). AR also thanks Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) for a fellowship (grant # 305269/2018-6).

DECLARATION ON CONFLICT OF INTEREST

The authors declare that there is no conflict of interest.

AUTHORS’ CONTRIBUTIONS

QVM, MJSM and AR designed the study. QVM carried out the morphological and phylogenetic analyses. QVM and MJSM carried out in vitro growth experiments and statistical analysis. QVM wrote the manuscript. QVM, MJSM and AR reviewed and proofread the manuscript. All authors read and approved the final manuscript.

Supplementary material

https://studiesinmycology.org/

Table S1 .

Culture media used to standardize the parameters to assess morphological characters of Escovopsis species.

Media	Formula or Brand	References
CMD (cornmeal agar)	NEOGEN Culture Media	Meirelles et al. (2015a), Montoya et al. (2019)
CYA (Czapek yeast extract agar)	30 g L^{^-1} of Sucrose (Labsynth^{^®}), 5 g L^{^-1} of Yeast extract (NEOGEN Culture Media), 1 g L^{^-1} of KH2PO4 (Labsynth^{^®}), 0.3 g L^{^-1} of NaNO3 (Synth), 0.05 g L^{^-1} of KCl (Labsynth®), 0.05 g L^{^-1} of MgSO4(7H2O) (Labsynth^{^®}), 0.001 g L^{^-1} of FeSO4 (Labsynth^{^®}), 0.001 g L^{^-1} of ZnSO4 (Labsynth^{^®}), 0.0005 g L^{^-1} of CuSO4 (Labsynth^{^®}), 15 g L^{^-1} of Agar (NEOGEN Culture Media)]	Seifert et al. (1995), Montoya et al. (2019)
MA2% (malt agar 2%)	20 g L^{^-1} of malt extract (NEOGEN Culture Media) and 15 g L^{^-1} of agar (NEOGEN Culture Media)	Augustin et al. (2013), Meirelles et al. (2015a), Montoya et al. (2019)
MEA (malt extract agar 2%)	30 g L^{^-1} of malt extract (NEOGEN Culture Media), 5 g L^{^-1} of bacteriological peptone (NEOGEN Culture Media), 20 g L^{^-1} of glucose (Labsynth^{^®}), and 15 g L^{^-1} of Agar (NEOGEN Culture Media)]	Seifert et al. (1995), Masiulionis et al. (2015), Montoya et al. (2019)
OA (oatmeal agar)	60g L^{^-1} Oatmeal and 15 g L^{^-1} of Agar (NEOGEN Culture Media)	Augustin et al. (2013), Masiulionis et al. (2015), Montoya et al. (2019)
PCA (potato carrot agar)	HiMedia^{^®}	Augustin et al. (2013), Montoya et al. (2019)
PDA (potato dextrose Agar)	NEOGENE Culture Media	Seifert et al. (1995), Augustin et al. (2013), Meirelles et al. (2015a), 40, Montoya et al. (2019)
SNA (synthetic nutrient agar)	0.1 g L^{^-1} of KH2PO4 (Labsynth^{^®}), 1 g L^{^-1} of KNO3 (Labsynth^{^®}), 0.5 g L-1 of MgSO4(7H2O) (Labsynth^{^®}), 0.5 g L^{^-1} of KCl (Labsynth^{^®}), 0.2 g L^{^-1} of Glucose (Labsynth^{^®}), 0.2 g L^{^-1} of Sucrose (Labsynth^{^®}) and 15 g L^{^-1} of Agar (NEOGEN Culture Media)	Meirelles et al. (2015a), Montoya et al. (2019)

Open in a new tab

Table S2 .

Measurements of the colony radius of the Escovopsis ex-type cultures, and the new described species.

	Growth radius after 4 d (mm)
	20 °C			25 °C			30 °C
Species	CMD	MEA	PDA	CMD	MEA	PDA	CMD	MEA	PDA
E. aspergiloides	1	2	5	1	5	6	0	0	0
	0	2	3	1	6	8	0	0	0
	1	2	5	1	6	8	0	0	0
	1	1	4	3	5	9	0	0	0
	1	2	5	1	5	6	0	0	0
	0	2	5	1	6	6	0	0	0
	0	3	5	3	6	7	0	0	0
	1	1	4	1	5	6	0	0	0
	1	3	3	1	6	6	0	0	0
	1	2	4	1	6	5	0	0	0
	0	1	3	1	6	6	0	0	0
	1	2	3	2	6	5	0	0	0
	1	2	4	2	6	6	0	0	0
	1	3	4	3	5	10	0	0	0
	1	2	4	2	6	7	0	0	0
	1	2	4	2	7	8	0	0	0
E. breviramosa	10	36	40	16	40	40	16	16	40
	10	36	40	16	40	40	16	17	40
	10	35	40	17	40	40	17	16	40
	10	35	40	17	40	40	17	15	40
	7	40	40	16	40	40	16	17	40
	10	35	40	16	40	40	16	15	40
	10	40	40	16	40	40	16	17	40
	10	37	40	16	40	40	16	17	40
	10	24	40	18	40	40	18	19	40
	12	10	40	18	40	40	18	19	40
	11	15	40	16	40	40	16	35	40
	11	25	40	15	40	40	15	18	40
	11	27	40	16	40	40	16	30	40
	12	20	40	16	40	40	16	18	40
	12	25	40	17	40	40	17	15	40
	12	25	40	15	40	40	15	33	40
E. chlamydosporosa	13	18	30	15	32	40	14	40	40
	13	20	30	15	34	40	14	40	40
	13	18	30	15	32	40	14	35	40
	13	20	30	15	32	40	14	35	40
	13	20	30	15	34	40	15	35	40
	10	16	40	15	32	40	15	35	40
	10	20	40	14	32	40	15	35	40
	14	20	35	14	32	40	15	35	40
	12	17	35	15	35	40	15	40	40
	12	18	35	15	35	40	15	40	40
	12	18	35	15	34	40	15	40	40
	12	20	34	15	40	40	15	40	40
	10	16	34	14	40	40	15	40	40
	10	18	34	15	40	40	15	40	40
	9	16	35	13	40	40	10	35	40
	9	20	34	13	35	40	10	35	40
E. clavata	0	1	3	4	5	8	0	0	0
	0	3	4	5	4	8	0	0	0
	0	4	4	4	4	7	0	0	0
	0	1	3	4	4	6	0	0	0
	0	3	4	4	4	8	0	0	0
	0	2	4	3	4	10	0	0	0
	0	2	5	2	4	9	0	0	0
	0	2	4	4	4	9	0	0	0
	2	3	3	2	5	11	0	0	0
	3	3	4	3	4	11	0	0	0
	2	2	4	2	4	10	0	0	0
	2	2	3	3	6	9	0	0	0
	1	0	3	7	4	10	0	0	0
	3	0	4	6	3	9	0	0	0
	3	0	3	6	4	11	0	0	0
	2	0	3	8	5	10	0	0	0
E. diminuta	10	7	15	10	15	16	0	0	0
	4	13	14	10	15	17	0	0	0
	8	8	12	10	17	15	0	0	0
	10	8	12	12	17	14	0	0	0
	7	7	15	14	16	20	0	0	0
	6	10	14	13	16	18	0	0	0
	8	11	15	12	17	17	0	0	0
	8	15	15	11	18	18	0	0	0
	10	5	14	10	18	21	0	0	0
	4	5	14	12	18	18	0	0	0
	5	8	12	11	18	19	0	0	0
	5	3	15	15	15	19	0	0	0
	9	14	14	14	18	18	0	0	0
	10	13	14	14	18	15	0	0	0
	10	10	12	15	15	15	0	0	0
	6	12	13	16	18	17	0	0	0
E. elongatistipitata	10	12	14	10	25	20	0	0	0
	6	11	14	10	25	21	0	0	0
	8	10	11	9	26	21	0	0	0
	7	12	12	10	28	23	0	0	0
	5	12	14	10	26	21	0	0	0
	6	11	14	12	22	20	0	0	0
	6	11	13	10	30	20	0	0	0
	6	11	13	12	28	22	0	0	0
	5	14	14	10	25	19	0	0	0
	9	12	14	12	30	19	0	0	0
	7	12	14	12	28	16	0	0	0
	7	13	13	10	28	21	0	0	0
	8	15	10	8	25	21	0	0	0
	10	12	13	9	26	20	0	0	0
	7	10	15	8	27	16	0	0	0
	6	14	13	8	28	21	0	0	0
E. gracilis	15	33	40	18	40	40	0	0	0
	15	35	40	17	40	40	0	0	0
	12	35	40	14	40	40	0	0	0
	22	35	40	19	40	40	0	0	0
	15	34	40	15	40	40	0	0	0
	33	37	40	13	40	40	0	0	0
	21	35	40	16	40	40	0	0	0
	19	35	40	13	40	40	0	0	0
	22	35	40	12	40	40	0	0	0
	24	34	40	15	40	40	0	0	0
	25	34	40	14	40	40	0	0	0
	28	35	40	15	40	40	0	0	0
	15	35	40	15	40	40	0	0	0
	20	33	40	17	40	40	0	0	0
	12	33	40	16	40	40	0	0	0
	19	33	40	15	40	40	0	0	0
E. lentecrescens	1	0	1	3	4	4	0	0	0
	2	1	1	3	3	2	0	0	0
	2	1	1	2	3	5	0	0	0
	1	0	0	2	3	3	0	0	0
	1	1	1	3	2	3	0	0	0
	1	1	1	3	3	3	0	0	0
	1	1	1	3	2	3	0	0	0
	2	1	1	3	2	2	0	0	0
	1	0	1	3	2	2	0	0	0
	1	0	1	3	2	4	0	0	0
	2	0	1	4	2	3	0	0	0
	1	0	1	3	2	3	0	0	0
	1	0	1	2	2	4	0	0	0
	1	0	1	3	2	3	0	0	0
	1	0	1	3	3	3	0	0	0
	1	0	0	2	3	2	0	0	0
E. maculosa	2	3	3	6	6	19	0	0	0
	2	4	3	5	6	21	0	0	0
	3	4	2	5	5	24	0	0	0
	4	5	2	5	5	23	0	0	0
	2	2	2	4	6	30	0	0	0
	3	4	4	4	7	23	0	0	0
	3	4	2	5	5	25	0	0	0
	3	5	3	5	5	24	0	0	0
	3	4	7	3	6	24	0	0	0
	3	3	4	4	5	30	0	0	0
	3	2	5	5	5	28	0	0	0
	3	5	4	5	5	24	0	0	0
	2	2	4	3	6	24	0	0	0
	2	4	2	3	6	30	0	0	0
	2	4	2	4	5	26	0	0	0
	3	3	2	5	5	23	0	0	0
E. moelleri	22	19	23	9	23	25	0	0	0
	25	24	25	9	22	23	0	0	0
	23	22	24	8	20	24	0	0	0
	22	20	22	9	20	22	0	0	0
	13	21	22	10	22	23	0	0	0
	11	21	23	10	21	27	0	0	0
	21	26	21	11	21	23	0	0	0
	21	23	21	10	23	24	0	0	0
	7	23	23	11	20	23	0	0	0
	6	24	24	11	20	25	0	0	0
	19	23	23	9	20	26	0	0	0
	6	23	23	10	20	27	0	0	0
	5	6	22	11	21	32	0	0	0
	15	7	23	12	23	22	0	0	0
	14	6	24	10	20	22	0	0	0
	5	7	24	11	22	28	0	0	0
E. multiformis	5	4	4	9	5	5	5	3	0
	4	4	4	9	4	6	6	1	0
	4	3	4	6	4	7	6	1	0
	6	4	5	7	4	5	6	1	0
	6	4	3	6	5	5	6	1	1
	5	4	3	7	5	5	5	1	1
	4	6	2	7	5	5	4	2	1
	5	4	3	8	5	4	5	0	1
	6	3	3	7	7	5	7	3	1
	6	4	4	7	7	5	6	1	2
	7	5	4	7	7	5	7	0	2
	8	4	4	6	5	5	5	1	1
	10	4	3	9	5	6	6	1	2
	6	5	3	9	5	6	6	2	2
	6	5	4	9	6	6	6	2	2
	7	5	4	10	6	7	6	1	1
E. papillata	5	2	12	2	3	7	0	0	0
	4	1	10	2	4	9	0	0	0
	4	1	10	2	2	8	0	0	0
	5	1	9	2	3	10	0	0	0
	4	1	10	1	3	5	0	0	0
	3	1	10	2	4	5	0	0	0
	3	2	11	2	4	5	0	0	0
	1	2	9	2	4	5	0	0	0
	2	1	7	2	4	7	0	0	0
	3	1	10	2	3	7	0	0	0
	3	1	9	2	3	9	0	0	0
	2	2	10	2	3	7	0	0	0
	2	2	7	3	4	8	0	0	0
	2	1	7	2	3	7	0	0	0
	2	1	7	2	4	7	0	0	0
	1	2	6	3	4	7	0	0	0
E. peniculiformis	10	16	18	18	39	40	19	20	40
	10	16	18	20	39	40	19	20	40
	10	15	20	19	39	40	19	20	40
	10	14	19	19	39	40	19	20	40
	10	14	19	19	40	40	19	30	40
	10	14	19	19	40	40	19	23	40
	12	14	19	20	40	40	19	23	40
	12	15	19	20	40	40	19	23	40
	12	15	19	19	40	40	19	23	40
	12	15	22	20	40	40	19	23	40
	12	18	22	19	40	40	19	23	40
	10	18	22	20	40	40	19	25	40
	10	18	20	19	39	40	20	25	40
	10	18	20	19	39	40	20	25	40
	10	20	20	20	39	40	20	25	40
	12	20	20	19	39	40	20	25	40
E. phialicopiosa	1	4	12	5	25	20	0	10	15
	1	4	12	5	13	10	0	10	20
	1	4	12	5	16	15	0	10	14
	1	4	12	5	24	13	0	12	20
	1	4	33	6	11	25	0	13	11
	2	4	20	7	24	20	0	13	13
	2	4	20	6	14	15	0	13	14
	2	5	30	5	14	12	0	23	23
	2	5	14	5	15	30	0	20	16
	2	5	15	4	15	20	0	18	16
	1	5	14	4	24	10	0	17	24
	1	6	14	7	20	22	0	16	24
	1	6	13	7	15	13	0	16	10
	1	9	15	4	10	19	0	19	10
	1	8	13	7	16	13	0	19	10
	1	10	30	8	13	15	0	19	10
E. pseudocylindrica	4	10	14	10	18	29	0	0	6
	6	10	10	10	18	30	0	0	3
	7	10	12	10	18	25	0	0	3
	7	10	13	10	18	29	0	0	3
	4	12	13	10	18	26	0	0	6
	6	14	10	10	18	32	0	0	2
	5	14	14	10	18	31	0	0	2
	4	12	14	10	16	29	0	0	2
	4	9	14	10	16	28	0	0	2
	9	11	12	10	18	31	0	0	6
	6	13	15	11	18	30	0	0	6
	6	11	15	12	18	30	0	0	4
	6	10	15	13	20	29	0	0	8
	6	10	12	15	18	35	0	0	6
	3	10	12	15	16	30	0	0	6
	5	10	10	15	16	35	0	0	6
E. rectangula	11	8	15	12	34	40	10	40	40
	11	7	28	13	34	40	10	40	40
	11	6	28	12	34	40	10	40	40
	11	8	30	12	34	40	10	40	40
	9	15	29	10	32	40	10	32	40
	9	14	28	10	32	40	10	32	40
	8	22	24	10	32	40	10	32	40
	7	24	29	11	27	40	11	27	40
	10	17	28	10	40	40	10	40	40
	11	15	30	10	38	40	10	38	40
	11	18	34	12	35	40	12	35	40
	9	24	33	11	40	40	11	40	40
	9	14	28	18	34	40	18	40	40
	10	18	30	18	34	40	18	34	40
	8	17	31	12	34	40	12	34	40
	11	19	35	20	36	40	20	36	40
E. rosisimilis	5	7	21	7	6	25	0	0	0
	9	7	20	7	6	22	0	0	0
	8	7	21	7	5	22	0	0	0
	2	5	22	7	5	22	0	0	0
	6	5	15	7	6	24	0	0	0
	5	5	20	5	6	24	0	0	0
	4	5	20	5	5	30	0	0	0
	3	5	17	5	5	20	0	0	0
	6	7	15	7	6	32	0	0	0
	5	6	15	7	6	30	0	0	0
	2	5	18	5	6	25	0	0	0
	5	5	20	6	5	25	0	0	0
	3	5	20	7	10	28	0	0	0
	5	5	20	8	9	30	0	0	0
	4	5	22	5	7	24	0	0	0
	4	4	20	5	8	30	0	0	0
E. spicaticlavata	9	11	18	15	28	20	15	10	25
	10	11	18	15	25	25	15	10	20
	11	10	16	15	26	20	17	10	19
	10	11	20	15	30	20	15	10	20
	11	10	12	15	30	28	17	10	26
	11	14	20	16	30	28	20	12	20
	11	12	16	16	25	28	17	12	22
	11	30	23	19	28	30	15	10	25
	10	10	21	16	33	25	15	12	20
	10	14	24	16	35	28	15	12	19
	10	12	20	15	30	28	15	12	20
	10	12	21	17	35	28	16	10	20
	11	10	28	15	30	30	15	13	21
	10	14	15	11	27	20	15	15	17
	11	14	17	16	30	20	15	13	15
	14	12	17	20	30	20	15	10	17
E. weberi	24	32	40	20	40	40	37	38	34
	23	35	40	19	40	40	40	38	35
	22	34	40	19	39	40	40	38	32
	22	34	40	17	40	40	40	38	40
	20	31	40	24	40	40	40	37	31
	22	30	40	24	40	40	40	34	40
	21	31	40	24	40	40	40	34	30
	22	35	40	26	40	40	40	34	28
	23	32	40	26	40	40	40	34	40
	24	34	40	26	40	40	40	40	40
	23	33	40	25	40	40	40	40	30
	23	34	40	22	39	40	40	35	40
	24	40	40	23	40	40	40	35	28
	22	40	40	24	40	40	40	35	34
	22	40	40	20	40	40	40	40	29
	24	40	40	20	40	40	40	40	24

Open in a new tab

Table S3 .

Molecular markers, primers and Polymerase Chain Reaction (PCR) conditions.

Marker	Primers	PCR conditions	References
ITS	ITS4 (5’TCCTCCGCTTATTGATATGC3’) ITS5 (5’GGAAGTAAAAGTCGTAACAAGG3’)	96 °C for 3 min, 35 cycles at 94 °C for 1 min, 55 °C for 1 min and a final extension step at 72 °C for 2 min	White et al. (1990); Schoch et al. (2012)
tef1	EF6–20F (5’AAGAACATGATCACTGGTACCT3’) EF6–1000R (5’CGCATGTCRCGGACGGC3’)	96 °C for 3 min, 35 cycles at 96 °C for 30 s, 61 °C for 45 s and a final extension step at 72 °C for 1 min	Taerum et al. (2007)
LSU	CLA-F (5’GCATATCAATAAGCGGAGGA3’) CLA-R (5’GACTCCTTGGTCCGTGTTTCA3’)	96 °C for 3 min, 35 cycles at 94 °C for 1 min, 55 °C for 1 min and a final extension step at 72 °C for 2 min	White et al. (1990); Haugland & Heckman (1998); Currie et al. (2003)
rpb1	RPB1-Af, RPB1Ac (5’GARTGYCCDGGDCAYTTYGG3’) RPB1-Cr (5’CCNGCDATNTCRTTRTCCATRTA3’)	96 °C for 5 min followed by 15 cycles at 94 °C for 30 s, 65 °C for 1.5 min, (the annealing temperature gradually decreased 1 °C by cycle), and 72 °C for 1.5 min; and 35 cycles at 94 °C for 30 s, 50 °C for 1 min and 72 °C for 1 min.	Liu et al. (1999) (primers); This study (conditions)
rpb2	fRPB2-5F (F) (5’GA(T/C)GA(T/C)(A/C)G(A/T)GATCA(T/C)TT(T/C)GG-3’) fRPB2-7cR (R) (5’CCCAT(A/G)GCTTG(T/C)TT(A/G)CCCAT3’)	96 °C for 5 min followed by 15 cycles at 94 °C for 30 s, 65 °C for 1 min, (the annealing temperature gradually decreased 1 °C by cycle), and 72 °C for 1 min; and 35 cycles at 94 °C for 30 s, 50 °C for 1min and 72 °C for 1 min.	Liu et al. (1999) (primers); This study (conditions)

Open in a new tab

Table S4 .

Strains and their associated metadata used to reveal the phylogenetic relationships of Escovopsis species described by Marfetán et al. (2019) (Fig. S2).

Fungal species name	Strain ID	Specimen voucher	City, State, Country	Habitat	LSU GenBank accessions	References
E. atlas	UNQ E28	E28	Salta, Argentina	Fungus garden of Acromyrmex lundii	KU298288	Marfetán et al. (2019)
E. atlas	UNQ E35	E35	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298289	Marfetán et al. (2019)
E. aspergilloides	CBS 423.93 ^ET	DAOM:216382	Trinidad and Tobago: Trinidad	Fungus garden of Trachymyrmex ruthae	KF293283	Augustin et al. (2013)
E. catenulata	UNQ E17	E17	Corrientes, Argentina	Fungus gardens of Acromyrmex lobcornis	KU298285	Marfetán et al. (2019)
	UNQ E18	E18	Santa Fé, Argentina	Fungus garden of Atta vollenweideri	KU298295	Marfetán et al. (2019)
	UNQ E19	E19	Santa Fé, Argentina	Fungus garden of Acromyrmex heyeri	KU298286	Marfetán et al. (2019)
	UNQ E34	E34	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298287	Marfetán et al. (2019)
E. breviramosa	LESF 039^$	RS019	Nova Petrópolis, Rio Grande do Sul, Brazil	Fungus garden of Acromyrmex ambiguus	OQ589725	This study
	LESF 045	RS076	Vacaria, Rio Grande do Sul, Brazil	Fungus garden of Acromyrmex coronatus	OQ589726	This study
	CBS 149741^T	LESF 055 AR022	Camacan, Bahia, Brazil	Fungus garden of Acromyrmex sp.	OQ589727	This study
	LESF 041	RS030	São Marcos, Rio Grande do Sul, Brazil	Fungus garden of Acromyrmex lundii	OQ589728	This study
	LESF 316	ES001	Rio Claro, São Paulo, Brazil	Fungus garden of Mycetomoellerius sp.	OQ589720	This study
	LESF 040	RS020	Nova Petrópolis, Rio Grande do Sul, Brazil	Fungus garden of Acromyrmex laticeps	OQ589721	This study
E. chlamydosporosa	LESF 970	QVM57	Novo Airão, Amazonas, Brazil	Fungus garden of Apterostigma sp.	OQ589744	This study
	LESF 971	QVM58	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ589745	This study
	LESF 972	QVM59	Novo Airão, Amazonas, Brazil	Fungus garden of Apterostigma sp.	OQ589746	This study
	LESF 974	QVM61	Novo Airão, Amazonas, Brazil	---	OQ589747	This study
	LESF 986	QVM73	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589748	This study
	LESF 1001	QVM88	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp	OQ589749	This study
	LESF 1002	QVM89	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp	OQ589750	This study
	LESF 961^$	QVM48	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ589751	This study
	LESF 963^$	QVM50	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ589752	This study
	LESF 966	QVM53	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589753	This study
	LESF 967	QVM54	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589754	This study
	LESF 981	QVM68	Novo Airão, Amazonas, Brazil	Fungus garden of attini	OQ589755	This study
	LESF 982	QVM69	Novo Airão, Amazonas, Brazil	Fungus garden of attini	OQ589756	This study
	LESF 1026^$	QVM154	Manaus, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589757	This study
	LESF 976	QVM63	Novo Airão, Amazonas, Brazil	---	OQ589758	This study
	CBS 149748^T	LESF 984 QVM71	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589759	This study
	LESF 995	QVM82	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ589760	This study
	LESF 977	QVM64	Novo Airão, Amazonas, Brazil	---	OQ589761	This study
	LESF 978	QVM65	Novo Airão, Amazonas, Brazil	---	OQ589762	This study
	LESF 991^$	QVM78	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589763	This study
	LESF 1000	QVM87	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ589764	This study
E. clavata	LESF 854^$	1704A	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	MH715111	Montoya et al. (2019)
	LESF 855^$	1705B	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	MH715112	Montoya et al. (2019)
	CBS 145326 ^ET	1707	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	MH715110	Montoya et al. (2019)
E. diminuta	CBS 149747^T	LESF 969, QVM56	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273565	Montoya et al. (2021)
	LESF 996^$	QVM83	Novo Airão, Amazonas, Brazil	Fungus garden of Apterostigma sp.	MT273569	Montoya et al. (2021)
	LESF 997	QVM84	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273570	Montoya et al. (2021)
	LESF 1003^$	QVM90	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273571	Montoya et al. (2021)
E. elongatistipitata	LESF 1021^$	QVM149	Manaus, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589779	This study
	LESF 985^$	QVM72	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589780	This study
	CBS 149750^T	LESF 999 QVM86	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589781	This study
	---	QVM285⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ708420	This study
	---	QVM286⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ708421	This study
E. gracilis	CBS 149743^T	LESF 325, BA004	Camacan, Bahia, Brazil	Fungus garden of Atta cephalotes	MH715127	Montoya et al. (2019)
	LESF 843^$	B120301, BA003	Camacan, Bahia, Brazil	Fungus garden of Atta cephalotes	OQ589722	This study
	LESF 844^$	B410301, BA005	Camacan, Bahia, Brazil	Fungus garden of Atta cephalotes	OQ589723	This study
E. lentecrescens	CBS 135750 ^T	AUJ9	Viçosa, Minas Gerais, Brazil	Fungus garden of Acromyrmex subterraneus molestans	JQ855717	Augustin et al. (2013)
E. maculosa	CBS 149746^T	LESF 962, QVM49	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	MT273564	Montoya et al. (2021)
	---	QVM281⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ708416	This study
	---	QVM282⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ708417	This study
	---	QVM283⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ708418	This study
	---	QVM284⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ708419	This study
E. microspora	CBS 135751^ET	VIC:31756	Viçosa, Minas Gerais, Brazil	Fungus garden of Acromyrmex subterraneus molestans	KF293284	Augustin et al. (2013)
E. moelleri	CBS 135748 ^ET	VIC:31753	Viçosa, Minas Gerais, Brazil	Fungus garden of Acromyrmex subterraneus molestans	JQ855715	Augustin et al. (2013)
E. multiformis	LESF 1136^$	QVM277	Alta Floresta, Mato Grosso, Brazil	Fungus garden of Apterostigma sp.	MH715106	Montoya et al. (2019)
	CBS 145327 ^ET	LESF 847	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	MH715105	Montoya et al. (2019)
	LESF 852	1706B	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	MT273549	Montoya et al. (2021)
	LESF 849	1612	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	OQ589782	This study
	LESF 1134	QVM275	Cotrigaçu, Mato Grosso, Brazil	Fungus garden of Apterostigma sp	OQ589783	This study
	LESF 1135	QVM276	Cotrigaçu, Mato Grosso, Brazil	Fungus garden of Apterostigma sp.	OQ589784	This study
	LESF 850	1703	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	OQ589785	This study
	LESF 1007	QVM135	Florianópolis, Santa Catarina, Brazil	Fungus garden of attine ant	OQ589787	This study
	LESF 884	U42	Argentina	Fungus garden of Apterostigma sp.	OQ589788	This study
E. papillata	LESF 959	QVM46	Novo Airão, Amazonas, Brazil	Fungus garden of Apterostigma sp.	OQ589789	This study
	CBS 149745^T	LESF 960, QVM47	Novo Airão, Amazonas, Brazil	Fungus garden of Apterostigma sp.	OQ589790	This study
E. peniculiformis	LESF 297^$	RC005	Austin, Texas, USA	Fungus garden of Trachymyrmex turrifex	OQ589742	This study
	LESF 878^$	U59	Panama	Fungus garden of Apterostigma sp. G4	OQ589743	This study
	LESF 881	U51	Panama	Fungus garden of attine ant	OQ589786	This study
	CBS 149744^T	LESF 876 UT008	Gamboa - Panama	Fungus garden of Atta colombica	OQ589724	This study
E. phialicopiosa	LESF 047^$	SES002	Fazenda Pau, Goias, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589737	This study
	LESF 106^$	SES006	Uberlândia, Minas Gerais, Brazil	Fungus garden of Mycetomoellerius dichrous	OQ589738	This study
	CBS 149738^T	LESF 048 SES005	Uberlândia, Minas Gerais, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589739	This study
	LESF 021^$	ES002	Rio Claro, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilos	OQ589778	This study
E. primorosea	UNQ E29	E29	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298290	Marfetán et al. (2019)
	UNQ E30	E30	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298291	Marfetán et al. (2019)
	UNQ E42	E42	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298293	Marfetán et al. (2019)
	UNQ E42(2)	E42(2)	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298306	Marfetán et al. (2019)
E. pseudocylindrica	LESF 1029^$	QVM157	Manaus, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589768	This study
	CBS 149749^T	LESF 993 QVM80	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589769	This study
	LESF 1018	QVM146	Manaus, Amazonas, Brazil	Fungus garden of Apterostigma sp.	OQ589770	This study
	LESF 1024	QVM152	Manaus, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589771	This study
E. pseudoweberi	UNQ E4	E4	Buenos Aires, Argentina	Fungus garden of Acromyrmex lundii	KU298300	Marfetán et al. (2019)
	UNQ E10(2)	E10(2)	Corrientes, Argentina	Fungus garden of Acromyrmex lundii	KU298297	Marfetán et al. (2019)
	UNQ E12	E12	Corrientes, Argentina	Fungus garden of Acromyrmex heyeri	KU298298	Marfetán et al. (2019)
	UNQ E13	E13	Corrientes, Argentina	Fungus garden of Acromyrmex lundii	KU298307	Marfetán et al. (2019)
	UNQ E20	E20	Santa Fé, Argentina	Fungus garden of Acromyrmex lobcornis	KU298299	Marfetán et al. (2019)
	UNQ E24	E24	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298301	Marfetán et al. (2019)
E. rectangula	CBS 149739^T	LESF 050 SES008	RO	Fungus garden of Acromyrmex sp.	OQ589729	This study
	LESF 883	UT005	Argentina	Fungus garden of Acromyrmex sp.	OQ589730	This study
	LESF 892	UT020	México	Fungus garden of Trachymyrmex sp. sensu lato	OQ589731	This study
	LESF 318	ES029	Palmas, Tocantins, Brazil	Fungus garden of Acromyrmex sp.	OQ589732	This study
	LESF 326^$	BA006	Ilhéus, Bahia, Brazil	Fungus garden of Atta cephalotes	OQ589733	This study
	LESF 032	ES008	Santarém, Pará, Brazil	Fungus garden of Acromyrmex sp.	OQ589734	This study
	LESF 865^$	UT001	Guadalupe Island, Mexico	Fungus garden of Acromyrmex octospinosus	OQ589735	This study
	LESF 022^$	ES003	Frei Caneca, Pernambuco, Brazil	Fungus garden of Atta cephalotes	OQ589736	This study
	LESF 863^$	U31	Panama	Fungus garden of Apterostigma dentigerum	OQ589741	This study
E. rosisimilis	CBS 135748^T	AUJ5	Viçosa, Minas Gerais, Brazil	Fungus garden of Acromyrmex subterraneus molestans	OQ589719	This study
	CBS 149742^T	LESF 135 SES003	Uberlândia, Minas Gerais, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589740	This study
	---	QVM287⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ708422	This study
	---	QVM288⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ708423	This study
	---	QVM289⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ708424	This study
Escovopsis sp.	LESF 860	U35	Panama	---	OQ589765	This study
Escovopsis sp.	LESF 038	RS004	Registro, Santa Catarina, Brazil	Fungus garden of Acromyrmex coronatus	OQ589766	This study
E. spicaticlavata	CBS 149740^T	LESF 052,	Manaus, Amazonas, Brazil	Fungus garden of Paratrachymyrmex diversus	MH715124	Montoya et al. (2019)
	LESF 975^$	QVM62	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273566	Montoya et al. (2021)
	LESF 979^$	QVM66	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273567	Montoya et al. (2021)
E. weberi	ATCC 64542 ^ET	---	Viçosa, Minas Gerais, Brazil	Carpenter ant fungal mass	KF293281	Augustin et al. (2013)
	LESF 046	SES001	Rio Claro, São Paulo, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273511	Montoya et al. (2021)
	LESF 355	ES021	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273534	Montoya et al. (2021)
	LESF 017	NL001	Botucatu, São Paulo, Brazil	Midden of Atta capiguara	MH715113	Montoya et al. (2019)
	LESF 019^$	NL005	Botucatu, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MH715115	Montoya et al. (2019)
	LESF 020	NL006	Botucatu, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273503	Montoya et al. (2021)
	LESF 023^$	ES005	Alta Floresta, Mato Grosso, Brazil	Fungus garden of Atta cephalotes	MH715117	Montoya et al. (2019)
	LESF 024	ES006	Alta Floresta, Mato Grosso, Brazil	Fungus garden of Acromyrmex coronatus	MT273504	Montoya et al. (2021)
	LESF 025	ES007	Alta Floresta, Mato Grosso, Brazil	Fungus garden of Acromyrmex coronatus	MT273505	Montoya et al. (2021)
	LESF 027	ES010	Rio Claro, São Paulo, Brazil	Fungus garden of Acromyrmex landolti	MH715119	Montoya et al. (2019)
	LESF 029	ES012	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MH715120	Montoya et al. (2019)
	LESF 030	ES013	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MH715121	Montoya et al. (2019)
	LESF 031^$	ES014	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MT273506	Montoya et al. (2021)
	LESF 033	ES004	Bahia, Brazil	Fungus garden of Acromyrmex sp.	MT273507	Montoya et al. (2021)
	LESF 034	ES024	Botucatu, São Paulo, Brazil	Fungus garden of Acromyrmex balzanii	MT273508	Montoya et al. (2021)
	LESF 042^$	RS053	Chuvisca, Rio Grande do Sul, Brazil	Fungus garden of Acromyrmex lundii	MT273509	Montoya et al. (2021)
	LESF 043^$	RS055	Chuvisca, Rio Grande do Sul, Brazil	Fungus garden of Acromyrmex heyeri	MT273510	Montoya et al. (2021)
	LESF 054^$	AR003	Ilhéus, Bahia, Brazil	Fungus garden of Acromyrmex balzanii	MT273512	Montoya et al. (2021)
	LESF 056	AR033	Camacan, Bahia, Brazil	Fungus garden of Acromyrmex sp.	MT273513	Montoya et al. (2021)
	LESF 136	4a	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273514	Montoya et al. (2021)
	LESF 146	1cT4	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273515	Montoya et al. (2021)
	LESF 156^$	A088	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273516	Montoya et al. (2021)
	LESF 178	A086a	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273517	Montoya et al. (2021)
	LESF 239	13B	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273518	Montoya et al. (2021)
	LESF 241	H1b	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273519	Montoya et al. (2021)
	LESF 292^$	NL003	Botucatu, São Paulo, Brazil	Fungus garden of Atta capiguara	MT273520	Montoya et al. (2021)
	LESF 294	H33	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273521	Montoya et al. (2021)
	LESF 295	NL009	Botucatu, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273522	Montoya et al. (2021)
	LESF 298	NL004	Botucatu, São Paulo, Brazil	Fungus garden of Atta capiguara	MT273523	Montoya et al. (2021)
	LESF 315	NL007	Botucatu, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MH715125	Montoya et al. (2019)
	LESF 317	ES026	Rio Claro, São Paulo, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273531	Montoya et al. (2021)
	LESF 319	ES030	Palmas, Tocantins, Brazil	Fungus garden of Acromyrmex sp.	MT273532	Montoya et al. (2021)
	LESF 324^$	RS105	Thermas de Santa Bárbara, São Paulo, Brazil	Fungus garden of Atta laevigata	MT273533	Montoya et al. (2021)
	LESF 356	ES032	Botucatu, São Paulo, Brazil	Fungus garden of Atta laevigata	MT273535	Montoya et al. (2021)
	LESF 359	ES019	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MT273536	Montoya et al. (2021)
	LESF 362	ES028	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MT273537	Montoya et al. (2021)
	LESF 363	ES023	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MT273538	Montoya et al. (2021)
	LESF 364	ES015	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MT273539	Montoya et al. (2021)
	LESF 519	ES016	---	Fungus garden of Atta sexdens rubropilosa	MT273540	Montoya et al. (2021)
	LESF 575	RS087	Indaial, Santa Catarina, Brazil	Fungus garden of Acromyrmex diciger	MT273541	Montoya et al. (2021)
	LESF 858	A210201	Camacan, Bahia, Brazil	Fungus garden of Atta cephalotes	MT273550	Montoya et al. (2021)
	LESF 859	B110302	Camacan, Bahia, Brazil	Fungus garden of Atta cephalotes	MT273551	Montoya et al. (2021)
	LESF 877	NL010	---	---	MT273555	Montoya et al. (2021)
	LESF 880	2aT=3	---	---	MT273556	Montoya et al. (2021)
	LESF 994	QVM81	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	MT273568	Montoya et al. (2021)
	UNQ E16	E16	Santa Fé, Argentina	Fungus garden of Acromrmex lundii	KU298308	Marfetán et al. (2019)
	UNQ E22	E22	La Pampa, Argentina	Fungus garden of Acromyrmex striatus	KU298304	Marfetán et al. (2019)
	UNQ E26	E26	La Pampa, Argentina	Fungus garden of Acromyrmex striatus	KU298305	Marfetán et al. (2019)
	UNQ E31	E31	Salta, Argentina	Fungus garden of Acromrmex lundii	KU298292	Marfetán et al. (2019)
	UNQ E41	E41	Salta, Argentina	Fungus garden of Acromrmex lundii	KU298294	Marfetán et al. (2019)
Sympodiorosea kreiselii	CBS 139320^ET	LESF 053	Florianópolis, Santa Catarina, Brazil	Fungus garden of Mycetophylax morschi	KJ808765	Meirelles et al. (2015a)

Open in a new tab

^T Holotype;^ET Ex-type cultures; +: Inactive strains; LESF: Laboratory of Fungal Ecology and Systematics (UNESP, Rio Claro, Brazil); QVM: Quimi Vidaurre Montoya.

Table S5 .

Morphological features used to construct the dichotomous key of Escovopsis species.

			E. weberii	E. microspora	E. peniculiformis	E. breviramosa	E. gracilis	E. chamydosporosa	E. rectangula	E. pseudocylindrica	E. spicaticlavata	E. moelleri	E. phialicopiosa	E. elongatistipitata	E. diminuta	E. lentecrescens	E. rosisimilis	E. maculosa	E. aspergiloides	E. multiformis	E. clavata	E. papillata
Growth temperature	10 °C	x1	yes	yes	no	yes	no	no	yes	no	no	yes	no	no	no	no	no	no	no	yes	no	no
	20 °C	x2	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes
	25 °C	x3	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes
	30 °C	x4	yes	yes	yes	yes	no	yes	yes	no	yes	no	no	no	no	no	no	no	no	yes	no	no
Growth at 25 °C, 4 d	MEA	x5	39.88	39.88	39.5	40	40	34.94	34.38	17.63	29.5	21.13	16.81	26.69	16.81	2.5	6.31	5.5	5.75	5.31	4.25	3.44
	PDA	x6	40	40	40	40	40	40	40	29.94	24.88	24.75	17	20.06	17.31	3.06	25.81	24.88	6.81	5.44	9.13	7.06
	CMD	x7	22.44	22.44	19.31	16.31	15.25	14.56	12.56	11.31	15.75	10.06	5.63	10	12.44	2.81	6.25	4.44	1.63	7.69	4.19	2.06
Colony on CMD	White (LIII73(10))	x8	yes	yes	yes	yes	yes	yes	yes	no	yes	no	yes	yes	yes	no	no	yes	no	no	no	yes
	Colonial buff (XXX21‣d)	x9	yes	yes	yes	no	no	no	yes	yes	yes	yes	no	no	yes	yes	no	yes	no	yes	yes	no
	Olive-Ocher (XXX21‣)	x10	yes	yes	yes	yes	no	no	yes	no	no	no	no	no	no	no	no	yes	yes	no	no	no
	Light Brownnish olive (XXX19‣k)	x11	no	no	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no	no
	Margerite Yellow (XXX23‣f)	x12	no	no	no	no	yes	yes	yes	yes	yes	yes	yes	yes	no	no	yes	no	no	yes	yes	yes
	Light Yellow-Green (VI31d)	x13	no	no	no	no	no	no	yes	no	no	no	no	no	no	no	yes	no	yes	no	no	no
	Picnic Yellow (IV23d)	x14	no	no	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no	no
	*Olive-Yellow (XXX23‣)	x15	no	no	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no	no
	Ecru-Olive (XXX21‣i)	x16	no	no	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no	no
	*Vinaceous-Cinnamon (XXIX13‣b)	x17	no	no	no	no	no	no	yes	no	no	no	no	no	no	yes	no	no	no	no	no	no
	Deep Colonial Buff (XXX21‣b)	x18	no	no	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no	no
Colony on MEA	White (LIII73(10))	x19	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	no	no	yes	yes	no	no
	Colonial buff (XXX21‣d)	x20	yes	yes	yes	yes	no	no	no	yes	no	no	no	yes	no	no	no	no	no	no	yes	no
	Olive-Ocher (XXX21‣)	x21	yes	yes	yes	yes	no	no	no	yes	no	no	no	no	yes	no	no	no	no	no	no	no
	Light Brownnish olive (XXX19‣k)	x22	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no	no		no	no	no
	Margerite Yellow (XXX23‣f)	x23	yes	yes	no	no	yes	yes	yes	no	yes	yes	yes	no	yes	yes	yes	yes	no	yes	yes	yes
	Light Yellow-Green (VI31d)	x24	yes	yes	yes	no	no	no	no	yes	no	no	no	no	no	no	no	yes	no	no	no	yes
	Picnic Yellow (IV23d)	x25	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	yes	no	yes	no	no	no
	*Olive-Yellow (XXX23‣)	x26	no	no	no	no	no	no	no	yes	yes	no	no	no	yes	no	yes	no	yes	no	no	no
	Ecru-Olive (XXX21‣i)	x27	yes	yes	no	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no
	*Vinaceous-Cinnamon (XXIX13‣b)	x28	yes	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no
	Deep Colonial Buff (XXX21‣b)	x29	yes	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no
Colony on PDA	White (LIII73(10))	x30	yes	yes	yes	yes	yes	yes	yes	yes	yes	no	yes	yes	yes	yes	yes	no	no	yes	no	yes
	Colonial buff (XXX21‣d)	x31	yes	yes	no	yes	yes	yes	yes	yes	yes	yes	yes	no	yes	yes	no	no	yes	yes	yes	yes
	Olive-Ocher (XXX21‣)	x32	yes	yes	no	yes	no	no	yes	yes	no	yes	yes	no	yes	yes	no	no	no	yes	no	no
	Light Brownnish olive (XXX19‣k)	x33	no	no	no	no	no	no	yes	no	no	no	no	no	no	yes	no	no		no	no	no
	Margerite Yellow (XXX23‣f)	x34	no	no	yes	no	no	no	no	no	no	yes	no	yes	no	no	no	yes	no	no	yes	yes
	Light Yellow-Green (VI31d)	x35	yes	yes	no	no	no	no	no	yes	no	no	no	no	no	no	yes	yes	yes	no	no	no
	Picnic Yellow (IV23d)	x36	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	no	no	no
	*Olive-Yellow (XXX23‣)	x37	no	no	yes	no	no	no	no	yes	no	no	no	no	no	no	no	no	yes	no	no	no
	Ecru-Olive (XXX21‣i)	x38	yes	yes	yes	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no
	*Vinaceous-Cinnamon (XXIX13‣b)	x39	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no
	Deep Colonial Buff (XXX21‣b)	x40	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no
Colonies forming	pustule-like	x41	yes	yes	yes	yes	yes	yes	yes	no	no	no	yes	no	yes	no	no	no	no	yes	no	no
	Soluble pigments	x42	yes	yes	yes	no	no	no	no	no	no	no	no	no	yes	no	no	no	no	no	no	no
	Stolons	x43	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	no	yes	yes	yes	rare	rare	rare
	submerged	x44	yes	yes	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	no	no
	circular zones
	aerial circular	x45	yes	yes	no	no	yes	no	yes	no	no	no	no	yes	no	yes	no	no	yes		yes	no
	shapes
	mottled aspect	x46	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	no	no	no	no
conidiophores	shape	x47	pyramidal	pyramidal	pyramidal	pyramidal	pyramidal	pyramidal	rectangular	irregular	irregular	irregular	irregular	irregular	irregular	irregular	irregular	irregular	irregular	irregular	irregular	irregular
	swollen cell	x48	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	no
	infertile hypha	x49	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	no
vesicles	cylindrical	x50	yes	yes	yes	yes	yes	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no
	clavate	x51	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	no	no	no	no	no	yes	yes	yes
	cymbiform	x52	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	no	no	no	no	no	yes	yes	yes
	subulate	x53	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	no	no	no	no	no	yes	yes	yes
	lanceolate	x54	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	no	no	no	no	no	yes	yes	yes
	globose	x55	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	yes	yes	yes
	subglobose	x56	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	yes	yes	yes
	capitate	x57	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	yes	yes	yes
	obovoid	x58	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	yes
	prolate	x59	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	yes
	spatulate	x60	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	yes
	septate	x61	less frequent	less frequent	common	common	common	less frequent	less frequent	less frequent	less frequent	less frequent	less frequent	less frequent	no	no	no	no	no	less frequent	less frequent	less frequent
conidia	Cell wall	x62	smooth	smooth	smooth	smooth	smooth	smooth	smooth	thickened	thickened	thickened	thickened	thickened	smooth	smooth	smooth	smooth	smooth	smooth	smooth	smooth
	ornamentation	x63	no	no	no	no	no	no	no	yes	yes	yes	no	yes	no	no	no	no	no	no	no	no
	long chains	x64	yes	yes	yes	yes	yes	yes	yes	no	no	no	no	no	yes	yes	yes	yes	yes	yes	yes	yes
	short chains	x65	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	no	no	no	no	no	no	no	no
phialides on aerial mycelium	x66	no	no	yes	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no
chlamydospores	x67	rare	rare	rare	rare	rare	common	rare	rare	rare	rare	rare	rare	rare	rare	rare	rare	rare	rare	rare	rare
blooming roses formation	x68	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	no	no	no	no	no

Open in a new tab

Table S6 .

Data recoding sheet to evaluate the macroscopic characters of the colonies of Escovopsis species.

		Grow after 4 d on CMD/MEA/PDA
		1 wk				2 wk				3 wk				4 wk
		10°C	20°C	25°C	30°C	10°C	20°C	25°C	30°C	10°C	20°C	25°C	30°C	10°C	20°C	25°C	30°C
Colonies growing at
Colony radius (mm)
Start of Germination (day)
Colony morphology after 7 d, on CMD/MEA/PDA at 25 °C
Colony shape
Stolons
Mycelium forming rings
Submerged mycelium forming circular zone
Pustule like formations
Soluble pigments
Colour (Ridgway 1912)	White (LIII73(10))
	Colonial buff (XXX21‣d)
	Olive-Ocher (XXX21‣)
	Light Brownish olive (XXX19‣k)
	Margerite Yellow (XXX23‣f)
	Light Yellow-Green (VI31d)
	Picnic Yellow (IV23d)
	*Olive-Yellow (XXX23‣)
	Ecru-Olive (XXX21‣i)
	*Vinaceous-Cinnamon (XXIX13‣b)
	Deep Colonial Buff (XXX21‣b)
Notes

Open in a new tab

Table S7 .

Data recoding sheet to evaluate the microscopic characters of Escovopsis species.

Micromorphology on PDA at 25 °C
CONIDIOPHORE
Type	Mono-vesiculate	Yes	No	Notes:
Type	Poly-vesiculate	Yes	No	Notes:
Number of vesicles	Min =.......... .Max = ..........
Length	Min =.......... .Max = ..........
Stipe length	Min =.......... .Max = ..........
Stipe septum	Yes	No	Notes:
Distance of septum from the foot cell	Min =.......... .Max = ..........
Shape		Notes:
Colour		Notes:
Cell wall	Smooth	Yes	No	Notes:
Cell wall	Rough	Yes	No	Notes:
Arrangement		Notes:
Swollen cell		Yes	No	Notes:
Swollen cell length	Min =.......... .Max = ..........
Swollen cell width	Min =.......... .Max = ..........
Infertile hypha	Yes	No	Notes:
CONIDIOPHORE BRANCHES
Length	Min =.......... .Max = ..........
Branching levels	Yes	No	Notes:
Branching angle	Notes:
Arrangement	Notes:
Stipe length	Min =.......... .Max = ..........
Stipe septum	Yes	No	Notes:
Distance of septum from from conidiophore axis	Min =.......... .Max = ..........
VESICLES
Shape (Montoya et al. 2021)		Notes:
Length	Min =.......... .Max = ..........
width	Min =.......... .Max = ..........
Formed on	Conidiophore	Yes	No	Notes:
	Aerial mycelium	Yes	No	Notes:
	Other structure	Notes:
Stipe length	Min =.......... .Max = ..........
Stipe septum	Yes	No	Notes:
PHIALIDES
Formed on	Vesicles	Yes	No	Notes:
	Aerial mycelium	Yes	No	Notes:
	Other structure	Yes	No	Notes:
Total length	Min =.......... .Max = ..........
Shape		Notes:
Length at the base	Min =.......... .Max = ..........
Width at the base	Min =.......... .Max = ..........
Length at the swollen cell	Min =.......... .Max = ..........
Width at the swollen cell	Min =.......... .Max = ..........
Length at the neck	Min =.......... .Max = ..........
Width at the neck	Min =.......... .Max = ..........
CONIDIA
Formed in	long chains	Yes	No	Notes:
	short chains	Yes	No	Notes:
	solitary	Yes	No	Notes:
Shape		Notes:
Colour		Notes:
Cell wall	Smooth	Yes	No	Notes:
	Rough	Yes	No	Notes:
	Ornamented	Yes	No	Notes:
CHLAMYDOSPORES
Formed	Intercalary	Yes	No	Notes:
Formed	Terminal	Yes	No	Notes:
Length	Min =.......... .Max = ..........
Width	Min =.......... .Max = ..........
Notes

Open in a new tab

Fig. S1.

Phylogeny revealing relationship among 19 species of Escovopsis, based on each molecular marker: (A) rpb2, (B) tef1, (C) ITS, (D) rpb1, (E) LSU, and (E) the combination of all of them (concatenated). Phylogenies shown were inferred using Bayesian Inference (BI) and Sympodiorosea kreiselii CBS 139320 was used as the outgroup. Numbers on branches indicate BI posterior probabilities (PP) and Maximum Likelihood bootstrap support values (MLB), respectively. Hyphens (--) indicate MLB < 70 %. ET indicates ex-type cultures and red crosses the non-viable strains. See Table 1 for all strains and their associated metadata used to infer these phylogenetic trees.

SIM_vol106_art6_SF1.jpg^{(12.6MB, jpg)}

Fig. S2.

Phylogeny revealing the relationship between Escovopsis species described by Marfetán et al. (2018). The tree was reconstructed to include the LSU sequences (in the green box) generated by Marfetán et al. (2018). The phylogeny was reconstructed using Bayesian Inference (BI) and Maximum Likelihood (ML) and and Sympodiorosea kreiselii CBS 139320 was used as the outgroup. Numbers on branches indicate BI posterior probabilities (PP) and Maximum Likelihood bootstrap support values (MLB), respectively. Hyphens (--) indicate MLB < 70 %. ET indicates extype cultures and red crosses the non-viable strains. See Table S4 for all strains and their associated metadata.

SIM_vol106_art6_SF2.jpg^{(1.8MB, jpg)}

Fig. S3.

Dichotomous key, in a cladogram format, revealing the relationship among Escovopsis species. The cladogram was reconstructed using 68 morphological features from species of Escovopsis in “rpart” library (Therneau & Atkinson 2019) in R v. 3.6.3. The final cladogram was manually edited using Adobe Illustrator CC v. 17.1. Information on branches was used to construct the taxonomic key and the leaves correspond to each Escovopsis species. See Table S5 for all associated data used to infer this cladogram.

SIM_vol106_art6_SF3.pdf^{(1.4MB, pdf)}

REFERENCES

Atanasova L, Le Crom S, Gruber S, et al. (2013). Comparative transcriptomics reveals different strategies of Trichoderma mycoparasitism. BMC Genomics 14: 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
Augustin JO, Groenewald JZ, Nascimento RJ, et al. (2013). Yet more “weeds” in the garden: Fungal novelties from nests of leaf-cutting ants. PLoS One 8: 1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
Bailey BA, Melnick RL, (2013). The Endophytic Trichoderma. In: Trichoderma: biology and applications (Mukherjee PK, Horwitz BA, Singh US, Mukherjee Schmoll MM.). CABI, UK (London): 152–172. [Google Scholar]
Batey SFD, Greco C, Hutchings MI, et al. (2020). Chemical warfare between fungus-growing ants and their pathogens. Current Opinion Chemical Biology 59: 172–181. [DOI] [PMC free article] [PubMed] [Google Scholar]
Birnbaum SSL, Gerardo NM, (2016). Patterns of specificity of the pathogen Escovopsis across the fungus-growing ant symbiosis. The American Naturalist 188: 52–65. [DOI] [PubMed] [Google Scholar]
Boya CA, Fernández-Marín H, Mejiá LC, et al. (2017). Imaging mass spectrometry and MS/MS molecular networking reveals chemical interactions among cuticular bacteria and pathogenic fungi associated with fungus-growing ants. Scientific Report 7: 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
Brotman Y, Kapuganti JG, Viterbo A, (2010). Trichoderma. Current Biology 20: 390–391. [DOI] [PubMed] [Google Scholar]
Caldera EJ, Poulsen M, Suen G, et al. (2009). Insect symbioses: a case study of past, present, and future fungus-growing ant research. Environmental Entomology 38: 78–92. [DOI] [PubMed] [Google Scholar]
Chaverri P, Branco-Rocha F, Jaklitsch W, et al. (2015). Systematics of the Trichoderma harzianum species complex and the re-identification of commercial biocontrol strains. Mycologia 107: 558–590. [DOI] [PMC free article] [PubMed] [Google Scholar]
Chaverri P, Samuels GJ, (2013). Evolution of habitat preference and nutrition mode in a cosmopolitan fungal genus with evidence of interkingdom host jumps and major shifts in ecology. Evolution 67: 2823–2837. [DOI] [PubMed] [Google Scholar]
Currie CR, Wong B, Stuart AE, et al. (2003). Ancient tripartite coevolution in the attine ant-microbe symbiosis. Science 299: 386–388. [DOI] [PubMed] [Google Scholar]
Currie CR, (2001). Prevalence and impact of a virulent parasite on a tripartite mutualism. Oecologia 128: 99–106. [DOI] [PubMed] [Google Scholar]
Currie CR, Mueller UG, Malloch D, (1999). The agricultural pathology of ant fungus gardens. Proceedings of the National Academy of Sciences of the United States of America 96: 7998–8002. [DOI] [PMC free article] [PubMed] [Google Scholar]
Darriba D, Taboada GL, Doallo R, et al. (2012). jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9: 772–772. [DOI] [PMC free article] [PubMed] [Google Scholar]
De Man TJB, Stajich JE, Kubicek CP, et al. (2016). Small genome of the fungus Escovopsis weberi, a specialized disease agent of ant agriculture. Proceedings of the National Academy of Sciences of the United States of America 113: 3567–3572. [DOI] [PMC free article] [PubMed] [Google Scholar]
Diego EW, Juan Adrián G VA, A PT, (2014). Correlation between virulence and genetic structure of Escovopsis strains from leaf-cutting ant colonies in Costa Rica. Microbiology (Reading) 160: 1727–1736. [DOI] [PubMed] [Google Scholar]
Druzhinina I, Kubicek CP, (2005). Species concepts and biodiversity in Trichoderma and Hypocrea: From aggregate species to species clusters. Journal of Zhejiang University. Science B 6: 100–112. [DOI] [PMC free article] [PubMed] [Google Scholar]
Druzhinina IS, Seidl-Seiboth V, Herrera-Estrella A, et al. (2011). Trichoderma: The genomics of opportunistic success. Nature Reviews Microbiology 9: 749–759. [DOI] [PubMed] [Google Scholar]
Folgarait P, Gorosito N, Poulsen M, et al. (2011). Preliminary in vitro insights into the use of natural fungal pathogens of leaf-cutting ants as biocontrol agents. Current Microbiology 63: 250–258. [DOI] [PubMed] [Google Scholar]
Gerardo NM, Jacobs SR, Currie CR, et al. (2006a). Ancient host-pathogen associations maintained by specificity of chemotaxis and antibiosis. PLoS Biology 4: 1358–1363. [DOI] [PMC free article] [PubMed] [Google Scholar]
Gerardo NM, Mueller UG, Currie CR, (2006b). Complex host-pathogen coevolution in the Apterostigma fungus-growing ant-microbe symbiosis. BMC Ecology and Evolution 6: 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
Gerardo NM, Mueller UG, Price SL, et al. (2004). Exploiting a mutualism: parasite specialization on cultivars within the fungus-growing ant symbiosis. Proceedings of the Royal Society B: Biological Sciences 271: 1791–1798. [DOI] [PMC free article] [PubMed] [Google Scholar]
Gotting K, May DS, Sosa-Calvo J, et al. (2022). Genomic diversification of the specialized parasite of the fungus-growing ant symbiosis. Proceedings of the National Academy of Sciences of the United States of America 119: 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
Guzmán-Guzmán P, Porras-Troncoso MD, Olmedo-Monfil V, et al. (2019). Trichoderma species: Versatile plant symbionts. Phytopathology 109: 6–16. [DOI] [PubMed] [Google Scholar]
Heine D, Holmes NA, Worsley SF, et al. (2018). Chemical warfare between leafcutter ant symbionts and a co-evolved pathogen. Nature Communications 9: 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
Hutchinson MC, Gaiarsa MP, Stouffer DB, (2018). Contemporary ecological interactions improve models of past trait evolution. Systematic Biology 67: 861–872. [DOI] [PubMed] [Google Scholar]
Indunil CS, Achala RR, Diana SM, et al. (2020). Morphological approaches in studying fungi: collection, examination, isolation, sporulation and preservation. Mycosphere 11: 2678–2754. [Google Scholar]
Jaklitsch WM, (2009). European species of Hypocrea Part I. The green-spored species. Studies Mycology 63: 1–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
Jaklitsch WM, Samuels GJ, (2011). Reconsideration of Protocrea (Hypocreales, Hypocreaceae). Mycologia 100: 962–984. [DOI] [PMC free article] [PubMed] [Google Scholar]
Jiménez-Gómez I, Barcoto MO, Montoya QV, et al. (2021). Host susceptibility modulates Escovopsis pathogenic potential in the fungiculture of Higher Attine Ants. Frontiers in Microbiology 12: 1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
Katoh K, Standley DM, (2013). MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kearse M, Moir R, Wilson A, et al. (2012). Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kessler A, Halitschke R, (2009). Testing the potential for conflicting selection on floral chemical traits by pollinators and herbivores: Predictions and case study. Functional Ecology 23: 901–912. [Google Scholar]
Koukol O, Delgado G, (2021). Why morphology matters: the negative consequences of hasty descriptions of putative novelties in asexual ascomycetes. IMA Fungus 12: 2–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kubicek CP, Steindorff AS, Chenthamara K, et al. (2019). Evolution and comparative genomics of the most common Trichoderma species. BMC Genomics 20: 1–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lücking R, Aime MC, Robbertse B, et al. (2020). Unambiguous identification of fungi: Where do we stand and how accurate and precise is fungal DNA barcoding? IMA Fungus 11: 1–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lücking R, Aime MC, Robbertse B, et al. (2021). Fungal taxonomy and sequence-based nomenclature. Nature Microbiology 6: 540–548. [DOI] [PMC free article] [PubMed] [Google Scholar]
Marfetán JA, Romero AI, Cafaro MJ, et al. (2018). Five new Escovopsis species from Argentina. Mycotaxon 133: 569–589. [Google Scholar]
Marfetán JA, Romero AI, Folgarait PJ, (2015). Pathogenic interaction between Escovopsis weberi and Leucoagaricus sp.: Mechanisms involved and virulence levels. Fungal Ecology 17: 52–61. [Google Scholar]
Masiulionis VE, Cabello MN, Seifert KA, et al. (2015). Escovopsis trichodermoides sp. nov., isolated from a nest of the lower attine ant Mycocepurus goeldii. Antonie van Leeuwenhoek 107: 731–740. [DOI] [PubMed] [Google Scholar]
Meirelles LA, Montoya QV, Solomon SE, et al. (2015a). New light on the systematics of fungi associated with attine ant gardens and the description of Escovopsis kreiselii sp. nov. PLoS ONE 10: 1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
Meirelles LA, Solomon SE, Bacci M, et al. (2015b). Shared Escovopsis parasites between leaf-cutting and non-leaf-cutting ants in the higher attine fungus-growing ant symbiosis. Royal Society Open Science 2: 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
Mendonça DMF, Caixeta MCS, Martins GL, et al. (2021). Low virulence of the fungi Escovopsis and Escovopsioides to a leaf-cutting ant-fungus symbiosis. Frontiers in Microbiology 12: 1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
Möller A, (1941). As hortas de fungos de algumas formigas sul-Americanas, 1st edn. SCP, Brazil. [Google Scholar]
Möller E, Bahnweg G, Sandermann H, et al. (1992). A simple and efficient protocol for isolation of high molecular weight DNA from filamentous fungi, fruit bodies, and infected plant tissues. Nucleic Acids Research 20: 6115–6116. [DOI] [PMC free article] [PubMed] [Google Scholar]
Montoya QV, Martiarena MJS, Bizarria R, et al. (2021). Fungi inhabiting attine ant colonies: reassessment of the genus Escovopsis and description of Luteomyces and Sympodiorosea gens. nov. IMA Fungus 12: 1–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
Montoya QV, Martiarena MJS, Polezel DA, et al. (2019). More pieces to a huge puzzle: Two new Escovopsis species from fungus gardens of attine ants. MycoKeys 46: 97–118. [DOI] [PMC free article] [PubMed] [Google Scholar]
Muchovej Della JJ, Lucia TC, (1990). Escovopsis, a new genus from leaf-cutting ants nests to replace Phailocladus nomem invalidum. Mycotaxon 37: 191–195. [Google Scholar]
Mueller UG, Gerardo N, (2002). Fungus-farming insects: multiple origins and diverse evolutionary histories. Proceedings of the National Academy of Sciences of the United States of America 99: 15247–15249. [DOI] [PMC free article] [PubMed] [Google Scholar]
Mueller UG, Rehner SA, Schultz TR, (1998). The evolution of agriculture in ants. Science 281: 2034–2038 [DOI] [PubMed] [Google Scholar]
Mukherjee PK, Mendoza-Mendoza A, Zeilinger S, et al. (2022). Mycoparasitism as a mechanism of Trichoderma-mediated suppression of plant diseases. Fungal Biology Reviews 39: 15–33. [Google Scholar]
Nixon KC, (2002). WinClada ver. 1.0000. Published by the author, Ithaca, New York, USA. [Google Scholar]
Põldmaa K, (2011). Tropical species of Cladobotryum and Hypomyces producing red pigments. Studies in Mycology 68: 1–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
Põldmaa K, (2000). Generic delimitation of the fungicolous Hypocreaceae. Studies in Mycology 45: 83–94. [Google Scholar]
Põldmaa K, Larsson E, Kõljalg U, (1999). Phylogenetic relationships in Hypomyces and allied genera, with emphasis on species growing on wood-decaying homobasidiomycetes. Canadian Journal of Botany 77: 1756–1768 [Google Scholar]
Raja HA, Miller AN, Pearce CJ, et al. (2017). Fungal identification using molecular tools: A primer for the natural products research community. Journal of Natural Products 80: 756–770. [DOI] [PMC free article] [PubMed] [Google Scholar]
Raja HA, Oberlies NH, Stadler M, (2021). Occasional comment: Fungal identification to species-level can be challenging. Phytochemistry 190: 1–3. [DOI] [PubMed] [Google Scholar]
Ridgway R, (1912). Color Standards and Color Nomenclature. Washington, DC, USA: published by the author. [Google Scholar]
Ronquist F, Teslenko M, van der Mark P, et al. (2012). MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematic Biology 61: 539–542. [DOI] [PMC free article] [PubMed] [Google Scholar]
Samson RA, Visagie CM, Houbraken J, et al. (2014). Phylogeny, identification and nomenclature of the genus Aspergillus. Studies in Mycology 78: 141–173. [DOI] [PMC free article] [PubMed] [Google Scholar]
Seifert KA, Samson RA, Chapela IH, (1995). Escovopsis aspergilloides, a rediscovered hyphomycete from leaf-cutting ant nests. Mycologia 87: 407–413. [Google Scholar]
Stamatakis A, (2014). RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30: 1312–1313. [DOI] [PMC free article] [PubMed] [Google Scholar]
Taerum SJ, Cafaro MJ, Little AEF, et al. (2007). Low host-pathogen specificity in the leaf-cutting ant-microbe symbiosis. Proceedings of the Royal Society B: Biological Sciences 274: 1971–1978. [DOI] [PMC free article] [PubMed] [Google Scholar]
Taylor JW, Jacobson DJ, Kroken S, et al. (2000). Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21–32. [DOI] [PubMed] [Google Scholar]
Therneau TM, Atkinson EJ, (2019). An Introduction to Recursive Partitioning Using the RPART Routines. Mayo Clinic Section Biostatistics Technical Report 61: 33. [Google Scholar]
Visagie CM, Houbraken J, Frisvad JC, et al. (2014). Identification and nomenclature of the genus Penicillium. Studies in Mycology 78: 343–371. [DOI] [PMC free article] [PubMed] [Google Scholar]
Williams G, (2011). Decision Trees. Data Mining with Rattle and R: The Art of Excavating Data for Knowledge Discovery Use R. 2nd edn. Springer, Germany. [Google Scholar]
Yek SH, Boomsma JJ, Poulsen M, (2012). Towards a better understanding of the evolution of specialized parasites of fungus-growing ant crops. Psyche: A Journal of Entomology 2012: 239–392. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1 .

Culture media used to standardize the parameters to assess morphological characters of Escovopsis species.

Media	Formula or Brand	References
CMD (cornmeal agar)	NEOGEN Culture Media	Meirelles et al. (2015a), Montoya et al. (2019)
CYA (Czapek yeast extract agar)	30 g L^{^-1} of Sucrose (Labsynth^{^®}), 5 g L^{^-1} of Yeast extract (NEOGEN Culture Media), 1 g L^{^-1} of KH2PO4 (Labsynth^{^®}), 0.3 g L^{^-1} of NaNO3 (Synth), 0.05 g L^{^-1} of KCl (Labsynth®), 0.05 g L^{^-1} of MgSO4(7H2O) (Labsynth^{^®}), 0.001 g L^{^-1} of FeSO4 (Labsynth^{^®}), 0.001 g L^{^-1} of ZnSO4 (Labsynth^{^®}), 0.0005 g L^{^-1} of CuSO4 (Labsynth^{^®}), 15 g L^{^-1} of Agar (NEOGEN Culture Media)]	Seifert et al. (1995), Montoya et al. (2019)
MA2% (malt agar 2%)	20 g L^{^-1} of malt extract (NEOGEN Culture Media) and 15 g L^{^-1} of agar (NEOGEN Culture Media)	Augustin et al. (2013), Meirelles et al. (2015a), Montoya et al. (2019)
MEA (malt extract agar 2%)	30 g L^{^-1} of malt extract (NEOGEN Culture Media), 5 g L^{^-1} of bacteriological peptone (NEOGEN Culture Media), 20 g L^{^-1} of glucose (Labsynth^{^®}), and 15 g L^{^-1} of Agar (NEOGEN Culture Media)]	Seifert et al. (1995), Masiulionis et al. (2015), Montoya et al. (2019)
OA (oatmeal agar)	60g L^{^-1} Oatmeal and 15 g L^{^-1} of Agar (NEOGEN Culture Media)	Augustin et al. (2013), Masiulionis et al. (2015), Montoya et al. (2019)
PCA (potato carrot agar)	HiMedia^{^®}	Augustin et al. (2013), Montoya et al. (2019)
PDA (potato dextrose Agar)	NEOGENE Culture Media	Seifert et al. (1995), Augustin et al. (2013), Meirelles et al. (2015a), 40, Montoya et al. (2019)
SNA (synthetic nutrient agar)	0.1 g L^{^-1} of KH2PO4 (Labsynth^{^®}), 1 g L^{^-1} of KNO3 (Labsynth^{^®}), 0.5 g L-1 of MgSO4(7H2O) (Labsynth^{^®}), 0.5 g L^{^-1} of KCl (Labsynth^{^®}), 0.2 g L^{^-1} of Glucose (Labsynth^{^®}), 0.2 g L^{^-1} of Sucrose (Labsynth^{^®}) and 15 g L^{^-1} of Agar (NEOGEN Culture Media)	Meirelles et al. (2015a), Montoya et al. (2019)

Open in a new tab

Table S2 .

Measurements of the colony radius of the Escovopsis ex-type cultures, and the new described species.

	Growth radius after 4 d (mm)
	20 °C			25 °C			30 °C
Species	CMD	MEA	PDA	CMD	MEA	PDA	CMD	MEA	PDA
E. aspergiloides	1	2	5	1	5	6	0	0	0
	0	2	3	1	6	8	0	0	0
	1	2	5	1	6	8	0	0	0
	1	1	4	3	5	9	0	0	0
	1	2	5	1	5	6	0	0	0
	0	2	5	1	6	6	0	0	0
	0	3	5	3	6	7	0	0	0
	1	1	4	1	5	6	0	0	0
	1	3	3	1	6	6	0	0	0
	1	2	4	1	6	5	0	0	0
	0	1	3	1	6	6	0	0	0
	1	2	3	2	6	5	0	0	0
	1	2	4	2	6	6	0	0	0
	1	3	4	3	5	10	0	0	0
	1	2	4	2	6	7	0	0	0
	1	2	4	2	7	8	0	0	0
E. breviramosa	10	36	40	16	40	40	16	16	40
	10	36	40	16	40	40	16	17	40
	10	35	40	17	40	40	17	16	40
	10	35	40	17	40	40	17	15	40
	7	40	40	16	40	40	16	17	40
	10	35	40	16	40	40	16	15	40
	10	40	40	16	40	40	16	17	40
	10	37	40	16	40	40	16	17	40
	10	24	40	18	40	40	18	19	40
	12	10	40	18	40	40	18	19	40
	11	15	40	16	40	40	16	35	40
	11	25	40	15	40	40	15	18	40
	11	27	40	16	40	40	16	30	40
	12	20	40	16	40	40	16	18	40
	12	25	40	17	40	40	17	15	40
	12	25	40	15	40	40	15	33	40
E. chlamydosporosa	13	18	30	15	32	40	14	40	40
	13	20	30	15	34	40	14	40	40
	13	18	30	15	32	40	14	35	40
	13	20	30	15	32	40	14	35	40
	13	20	30	15	34	40	15	35	40
	10	16	40	15	32	40	15	35	40
	10	20	40	14	32	40	15	35	40
	14	20	35	14	32	40	15	35	40
	12	17	35	15	35	40	15	40	40
	12	18	35	15	35	40	15	40	40
	12	18	35	15	34	40	15	40	40
	12	20	34	15	40	40	15	40	40
	10	16	34	14	40	40	15	40	40
	10	18	34	15	40	40	15	40	40
	9	16	35	13	40	40	10	35	40
	9	20	34	13	35	40	10	35	40
E. clavata	0	1	3	4	5	8	0	0	0
	0	3	4	5	4	8	0	0	0
	0	4	4	4	4	7	0	0	0
	0	1	3	4	4	6	0	0	0
	0	3	4	4	4	8	0	0	0
	0	2	4	3	4	10	0	0	0
	0	2	5	2	4	9	0	0	0
	0	2	4	4	4	9	0	0	0
	2	3	3	2	5	11	0	0	0
	3	3	4	3	4	11	0	0	0
	2	2	4	2	4	10	0	0	0
	2	2	3	3	6	9	0	0	0
	1	0	3	7	4	10	0	0	0
	3	0	4	6	3	9	0	0	0
	3	0	3	6	4	11	0	0	0
	2	0	3	8	5	10	0	0	0
E. diminuta	10	7	15	10	15	16	0	0	0
	4	13	14	10	15	17	0	0	0
	8	8	12	10	17	15	0	0	0
	10	8	12	12	17	14	0	0	0
	7	7	15	14	16	20	0	0	0
	6	10	14	13	16	18	0	0	0
	8	11	15	12	17	17	0	0	0
	8	15	15	11	18	18	0	0	0
	10	5	14	10	18	21	0	0	0
	4	5	14	12	18	18	0	0	0
	5	8	12	11	18	19	0	0	0
	5	3	15	15	15	19	0	0	0
	9	14	14	14	18	18	0	0	0
	10	13	14	14	18	15	0	0	0
	10	10	12	15	15	15	0	0	0
	6	12	13	16	18	17	0	0	0
E. elongatistipitata	10	12	14	10	25	20	0	0	0
	6	11	14	10	25	21	0	0	0
	8	10	11	9	26	21	0	0	0
	7	12	12	10	28	23	0	0	0
	5	12	14	10	26	21	0	0	0
	6	11	14	12	22	20	0	0	0
	6	11	13	10	30	20	0	0	0
	6	11	13	12	28	22	0	0	0
	5	14	14	10	25	19	0	0	0
	9	12	14	12	30	19	0	0	0
	7	12	14	12	28	16	0	0	0
	7	13	13	10	28	21	0	0	0
	8	15	10	8	25	21	0	0	0
	10	12	13	9	26	20	0	0	0
	7	10	15	8	27	16	0	0	0
	6	14	13	8	28	21	0	0	0
E. gracilis	15	33	40	18	40	40	0	0	0
	15	35	40	17	40	40	0	0	0
	12	35	40	14	40	40	0	0	0
	22	35	40	19	40	40	0	0	0
	15	34	40	15	40	40	0	0	0
	33	37	40	13	40	40	0	0	0
	21	35	40	16	40	40	0	0	0
	19	35	40	13	40	40	0	0	0
	22	35	40	12	40	40	0	0	0
	24	34	40	15	40	40	0	0	0
	25	34	40	14	40	40	0	0	0
	28	35	40	15	40	40	0	0	0
	15	35	40	15	40	40	0	0	0
	20	33	40	17	40	40	0	0	0
	12	33	40	16	40	40	0	0	0
	19	33	40	15	40	40	0	0	0
E. lentecrescens	1	0	1	3	4	4	0	0	0
	2	1	1	3	3	2	0	0	0
	2	1	1	2	3	5	0	0	0
	1	0	0	2	3	3	0	0	0
	1	1	1	3	2	3	0	0	0
	1	1	1	3	3	3	0	0	0
	1	1	1	3	2	3	0	0	0
	2	1	1	3	2	2	0	0	0
	1	0	1	3	2	2	0	0	0
	1	0	1	3	2	4	0	0	0
	2	0	1	4	2	3	0	0	0
	1	0	1	3	2	3	0	0	0
	1	0	1	2	2	4	0	0	0
	1	0	1	3	2	3	0	0	0
	1	0	1	3	3	3	0	0	0
	1	0	0	2	3	2	0	0	0
E. maculosa	2	3	3	6	6	19	0	0	0
	2	4	3	5	6	21	0	0	0
	3	4	2	5	5	24	0	0	0
	4	5	2	5	5	23	0	0	0
	2	2	2	4	6	30	0	0	0
	3	4	4	4	7	23	0	0	0
	3	4	2	5	5	25	0	0	0
	3	5	3	5	5	24	0	0	0
	3	4	7	3	6	24	0	0	0
	3	3	4	4	5	30	0	0	0
	3	2	5	5	5	28	0	0	0
	3	5	4	5	5	24	0	0	0
	2	2	4	3	6	24	0	0	0
	2	4	2	3	6	30	0	0	0
	2	4	2	4	5	26	0	0	0
	3	3	2	5	5	23	0	0	0
E. moelleri	22	19	23	9	23	25	0	0	0
	25	24	25	9	22	23	0	0	0
	23	22	24	8	20	24	0	0	0
	22	20	22	9	20	22	0	0	0
	13	21	22	10	22	23	0	0	0
	11	21	23	10	21	27	0	0	0
	21	26	21	11	21	23	0	0	0
	21	23	21	10	23	24	0	0	0
	7	23	23	11	20	23	0	0	0
	6	24	24	11	20	25	0	0	0
	19	23	23	9	20	26	0	0	0
	6	23	23	10	20	27	0	0	0
	5	6	22	11	21	32	0	0	0
	15	7	23	12	23	22	0	0	0
	14	6	24	10	20	22	0	0	0
	5	7	24	11	22	28	0	0	0
E. multiformis	5	4	4	9	5	5	5	3	0
	4	4	4	9	4	6	6	1	0
	4	3	4	6	4	7	6	1	0
	6	4	5	7	4	5	6	1	0
	6	4	3	6	5	5	6	1	1
	5	4	3	7	5	5	5	1	1
	4	6	2	7	5	5	4	2	1
	5	4	3	8	5	4	5	0	1
	6	3	3	7	7	5	7	3	1
	6	4	4	7	7	5	6	1	2
	7	5	4	7	7	5	7	0	2
	8	4	4	6	5	5	5	1	1
	10	4	3	9	5	6	6	1	2
	6	5	3	9	5	6	6	2	2
	6	5	4	9	6	6	6	2	2
	7	5	4	10	6	7	6	1	1
E. papillata	5	2	12	2	3	7	0	0	0
	4	1	10	2	4	9	0	0	0
	4	1	10	2	2	8	0	0	0
	5	1	9	2	3	10	0	0	0
	4	1	10	1	3	5	0	0	0
	3	1	10	2	4	5	0	0	0
	3	2	11	2	4	5	0	0	0
	1	2	9	2	4	5	0	0	0
	2	1	7	2	4	7	0	0	0
	3	1	10	2	3	7	0	0	0
	3	1	9	2	3	9	0	0	0
	2	2	10	2	3	7	0	0	0
	2	2	7	3	4	8	0	0	0
	2	1	7	2	3	7	0	0	0
	2	1	7	2	4	7	0	0	0
	1	2	6	3	4	7	0	0	0
E. peniculiformis	10	16	18	18	39	40	19	20	40
	10	16	18	20	39	40	19	20	40
	10	15	20	19	39	40	19	20	40
	10	14	19	19	39	40	19	20	40
	10	14	19	19	40	40	19	30	40
	10	14	19	19	40	40	19	23	40
	12	14	19	20	40	40	19	23	40
	12	15	19	20	40	40	19	23	40
	12	15	19	19	40	40	19	23	40
	12	15	22	20	40	40	19	23	40
	12	18	22	19	40	40	19	23	40
	10	18	22	20	40	40	19	25	40
	10	18	20	19	39	40	20	25	40
	10	18	20	19	39	40	20	25	40
	10	20	20	20	39	40	20	25	40
	12	20	20	19	39	40	20	25	40
E. phialicopiosa	1	4	12	5	25	20	0	10	15
	1	4	12	5	13	10	0	10	20
	1	4	12	5	16	15	0	10	14
	1	4	12	5	24	13	0	12	20
	1	4	33	6	11	25	0	13	11
	2	4	20	7	24	20	0	13	13
	2	4	20	6	14	15	0	13	14
	2	5	30	5	14	12	0	23	23
	2	5	14	5	15	30	0	20	16
	2	5	15	4	15	20	0	18	16
	1	5	14	4	24	10	0	17	24
	1	6	14	7	20	22	0	16	24
	1	6	13	7	15	13	0	16	10
	1	9	15	4	10	19	0	19	10
	1	8	13	7	16	13	0	19	10
	1	10	30	8	13	15	0	19	10
E. pseudocylindrica	4	10	14	10	18	29	0	0	6
	6	10	10	10	18	30	0	0	3
	7	10	12	10	18	25	0	0	3
	7	10	13	10	18	29	0	0	3
	4	12	13	10	18	26	0	0	6
	6	14	10	10	18	32	0	0	2
	5	14	14	10	18	31	0	0	2
	4	12	14	10	16	29	0	0	2
	4	9	14	10	16	28	0	0	2
	9	11	12	10	18	31	0	0	6
	6	13	15	11	18	30	0	0	6
	6	11	15	12	18	30	0	0	4
	6	10	15	13	20	29	0	0	8
	6	10	12	15	18	35	0	0	6
	3	10	12	15	16	30	0	0	6
	5	10	10	15	16	35	0	0	6
E. rectangula	11	8	15	12	34	40	10	40	40
	11	7	28	13	34	40	10	40	40
	11	6	28	12	34	40	10	40	40
	11	8	30	12	34	40	10	40	40
	9	15	29	10	32	40	10	32	40
	9	14	28	10	32	40	10	32	40
	8	22	24	10	32	40	10	32	40
	7	24	29	11	27	40	11	27	40
	10	17	28	10	40	40	10	40	40
	11	15	30	10	38	40	10	38	40
	11	18	34	12	35	40	12	35	40
	9	24	33	11	40	40	11	40	40
	9	14	28	18	34	40	18	40	40
	10	18	30	18	34	40	18	34	40
	8	17	31	12	34	40	12	34	40
	11	19	35	20	36	40	20	36	40
E. rosisimilis	5	7	21	7	6	25	0	0	0
	9	7	20	7	6	22	0	0	0
	8	7	21	7	5	22	0	0	0
	2	5	22	7	5	22	0	0	0
	6	5	15	7	6	24	0	0	0
	5	5	20	5	6	24	0	0	0
	4	5	20	5	5	30	0	0	0
	3	5	17	5	5	20	0	0	0
	6	7	15	7	6	32	0	0	0
	5	6	15	7	6	30	0	0	0
	2	5	18	5	6	25	0	0	0
	5	5	20	6	5	25	0	0	0
	3	5	20	7	10	28	0	0	0
	5	5	20	8	9	30	0	0	0
	4	5	22	5	7	24	0	0	0
	4	4	20	5	8	30	0	0	0
E. spicaticlavata	9	11	18	15	28	20	15	10	25
	10	11	18	15	25	25	15	10	20
	11	10	16	15	26	20	17	10	19
	10	11	20	15	30	20	15	10	20
	11	10	12	15	30	28	17	10	26
	11	14	20	16	30	28	20	12	20
	11	12	16	16	25	28	17	12	22
	11	30	23	19	28	30	15	10	25
	10	10	21	16	33	25	15	12	20
	10	14	24	16	35	28	15	12	19
	10	12	20	15	30	28	15	12	20
	10	12	21	17	35	28	16	10	20
	11	10	28	15	30	30	15	13	21
	10	14	15	11	27	20	15	15	17
	11	14	17	16	30	20	15	13	15
	14	12	17	20	30	20	15	10	17
E. weberi	24	32	40	20	40	40	37	38	34
	23	35	40	19	40	40	40	38	35
	22	34	40	19	39	40	40	38	32
	22	34	40	17	40	40	40	38	40
	20	31	40	24	40	40	40	37	31
	22	30	40	24	40	40	40	34	40
	21	31	40	24	40	40	40	34	30
	22	35	40	26	40	40	40	34	28
	23	32	40	26	40	40	40	34	40
	24	34	40	26	40	40	40	40	40
	23	33	40	25	40	40	40	40	30
	23	34	40	22	39	40	40	35	40
	24	40	40	23	40	40	40	35	28
	22	40	40	24	40	40	40	35	34
	22	40	40	20	40	40	40	40	29
	24	40	40	20	40	40	40	40	24

Open in a new tab

Table S3 .

Molecular markers, primers and Polymerase Chain Reaction (PCR) conditions.

Marker	Primers	PCR conditions	References
ITS	ITS4 (5’TCCTCCGCTTATTGATATGC3’) ITS5 (5’GGAAGTAAAAGTCGTAACAAGG3’)	96 °C for 3 min, 35 cycles at 94 °C for 1 min, 55 °C for 1 min and a final extension step at 72 °C for 2 min	White et al. (1990); Schoch et al. (2012)
tef1	EF6–20F (5’AAGAACATGATCACTGGTACCT3’) EF6–1000R (5’CGCATGTCRCGGACGGC3’)	96 °C for 3 min, 35 cycles at 96 °C for 30 s, 61 °C for 45 s and a final extension step at 72 °C for 1 min	Taerum et al. (2007)
LSU	CLA-F (5’GCATATCAATAAGCGGAGGA3’) CLA-R (5’GACTCCTTGGTCCGTGTTTCA3’)	96 °C for 3 min, 35 cycles at 94 °C for 1 min, 55 °C for 1 min and a final extension step at 72 °C for 2 min	White et al. (1990); Haugland & Heckman (1998); Currie et al. (2003)
rpb1	RPB1-Af, RPB1Ac (5’GARTGYCCDGGDCAYTTYGG3’) RPB1-Cr (5’CCNGCDATNTCRTTRTCCATRTA3’)	96 °C for 5 min followed by 15 cycles at 94 °C for 30 s, 65 °C for 1.5 min, (the annealing temperature gradually decreased 1 °C by cycle), and 72 °C for 1.5 min; and 35 cycles at 94 °C for 30 s, 50 °C for 1 min and 72 °C for 1 min.	Liu et al. (1999) (primers); This study (conditions)
rpb2	fRPB2-5F (F) (5’GA(T/C)GA(T/C)(A/C)G(A/T)GATCA(T/C)TT(T/C)GG-3’) fRPB2-7cR (R) (5’CCCAT(A/G)GCTTG(T/C)TT(A/G)CCCAT3’)	96 °C for 5 min followed by 15 cycles at 94 °C for 30 s, 65 °C for 1 min, (the annealing temperature gradually decreased 1 °C by cycle), and 72 °C for 1 min; and 35 cycles at 94 °C for 30 s, 50 °C for 1min and 72 °C for 1 min.	Liu et al. (1999) (primers); This study (conditions)

Open in a new tab

Table S4 .

Strains and their associated metadata used to reveal the phylogenetic relationships of Escovopsis species described by Marfetán et al. (2019) (Fig. S2).

Fungal species name	Strain ID	Specimen voucher	City, State, Country	Habitat	LSU GenBank accessions	References
E. atlas	UNQ E28	E28	Salta, Argentina	Fungus garden of Acromyrmex lundii	KU298288	Marfetán et al. (2019)
E. atlas	UNQ E35	E35	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298289	Marfetán et al. (2019)
E. aspergilloides	CBS 423.93 ^ET	DAOM:216382	Trinidad and Tobago: Trinidad	Fungus garden of Trachymyrmex ruthae	KF293283	Augustin et al. (2013)
E. catenulata	UNQ E17	E17	Corrientes, Argentina	Fungus gardens of Acromyrmex lobcornis	KU298285	Marfetán et al. (2019)
	UNQ E18	E18	Santa Fé, Argentina	Fungus garden of Atta vollenweideri	KU298295	Marfetán et al. (2019)
	UNQ E19	E19	Santa Fé, Argentina	Fungus garden of Acromyrmex heyeri	KU298286	Marfetán et al. (2019)
	UNQ E34	E34	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298287	Marfetán et al. (2019)
E. breviramosa	LESF 039^$	RS019	Nova Petrópolis, Rio Grande do Sul, Brazil	Fungus garden of Acromyrmex ambiguus	OQ589725	This study
	LESF 045	RS076	Vacaria, Rio Grande do Sul, Brazil	Fungus garden of Acromyrmex coronatus	OQ589726	This study
	CBS 149741^T	LESF 055 AR022	Camacan, Bahia, Brazil	Fungus garden of Acromyrmex sp.	OQ589727	This study
	LESF 041	RS030	São Marcos, Rio Grande do Sul, Brazil	Fungus garden of Acromyrmex lundii	OQ589728	This study
	LESF 316	ES001	Rio Claro, São Paulo, Brazil	Fungus garden of Mycetomoellerius sp.	OQ589720	This study
	LESF 040	RS020	Nova Petrópolis, Rio Grande do Sul, Brazil	Fungus garden of Acromyrmex laticeps	OQ589721	This study
E. chlamydosporosa	LESF 970	QVM57	Novo Airão, Amazonas, Brazil	Fungus garden of Apterostigma sp.	OQ589744	This study
	LESF 971	QVM58	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ589745	This study
	LESF 972	QVM59	Novo Airão, Amazonas, Brazil	Fungus garden of Apterostigma sp.	OQ589746	This study
	LESF 974	QVM61	Novo Airão, Amazonas, Brazil	---	OQ589747	This study
	LESF 986	QVM73	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589748	This study
	LESF 1001	QVM88	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp	OQ589749	This study
	LESF 1002	QVM89	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp	OQ589750	This study
	LESF 961^$	QVM48	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ589751	This study
	LESF 963^$	QVM50	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ589752	This study
	LESF 966	QVM53	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589753	This study
	LESF 967	QVM54	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589754	This study
	LESF 981	QVM68	Novo Airão, Amazonas, Brazil	Fungus garden of attini	OQ589755	This study
	LESF 982	QVM69	Novo Airão, Amazonas, Brazil	Fungus garden of attini	OQ589756	This study
	LESF 1026^$	QVM154	Manaus, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589757	This study
	LESF 976	QVM63	Novo Airão, Amazonas, Brazil	---	OQ589758	This study
	CBS 149748^T	LESF 984 QVM71	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589759	This study
	LESF 995	QVM82	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ589760	This study
	LESF 977	QVM64	Novo Airão, Amazonas, Brazil	---	OQ589761	This study
	LESF 978	QVM65	Novo Airão, Amazonas, Brazil	---	OQ589762	This study
	LESF 991^$	QVM78	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589763	This study
	LESF 1000	QVM87	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ589764	This study
E. clavata	LESF 854^$	1704A	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	MH715111	Montoya et al. (2019)
	LESF 855^$	1705B	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	MH715112	Montoya et al. (2019)
	CBS 145326 ^ET	1707	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	MH715110	Montoya et al. (2019)
E. diminuta	CBS 149747^T	LESF 969, QVM56	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273565	Montoya et al. (2021)
	LESF 996^$	QVM83	Novo Airão, Amazonas, Brazil	Fungus garden of Apterostigma sp.	MT273569	Montoya et al. (2021)
	LESF 997	QVM84	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273570	Montoya et al. (2021)
	LESF 1003^$	QVM90	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273571	Montoya et al. (2021)
E. elongatistipitata	LESF 1021^$	QVM149	Manaus, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589779	This study
	LESF 985^$	QVM72	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589780	This study
	CBS 149750^T	LESF 999 QVM86	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589781	This study
	---	QVM285⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ708420	This study
	---	QVM286⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ708421	This study
E. gracilis	CBS 149743^T	LESF 325, BA004	Camacan, Bahia, Brazil	Fungus garden of Atta cephalotes	MH715127	Montoya et al. (2019)
	LESF 843^$	B120301, BA003	Camacan, Bahia, Brazil	Fungus garden of Atta cephalotes	OQ589722	This study
	LESF 844^$	B410301, BA005	Camacan, Bahia, Brazil	Fungus garden of Atta cephalotes	OQ589723	This study
E. lentecrescens	CBS 135750 ^T	AUJ9	Viçosa, Minas Gerais, Brazil	Fungus garden of Acromyrmex subterraneus molestans	JQ855717	Augustin et al. (2013)
E. maculosa	CBS 149746^T	LESF 962, QVM49	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	MT273564	Montoya et al. (2021)
	---	QVM281⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ708416	This study
	---	QVM282⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ708417	This study
	---	QVM283⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	OQ708418	This study
	---	QVM284⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ708419	This study
E. microspora	CBS 135751^ET	VIC:31756	Viçosa, Minas Gerais, Brazil	Fungus garden of Acromyrmex subterraneus molestans	KF293284	Augustin et al. (2013)
E. moelleri	CBS 135748 ^ET	VIC:31753	Viçosa, Minas Gerais, Brazil	Fungus garden of Acromyrmex subterraneus molestans	JQ855715	Augustin et al. (2013)
E. multiformis	LESF 1136^$	QVM277	Alta Floresta, Mato Grosso, Brazil	Fungus garden of Apterostigma sp.	MH715106	Montoya et al. (2019)
	CBS 145327 ^ET	LESF 847	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	MH715105	Montoya et al. (2019)
	LESF 852	1706B	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	MT273549	Montoya et al. (2021)
	LESF 849	1612	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	OQ589782	This study
	LESF 1134	QVM275	Cotrigaçu, Mato Grosso, Brazil	Fungus garden of Apterostigma sp	OQ589783	This study
	LESF 1135	QVM276	Cotrigaçu, Mato Grosso, Brazil	Fungus garden of Apterostigma sp.	OQ589784	This study
	LESF 850	1703	Florianópolis, Santa Catarina, Brazil	Fungus garden of Apterostigma sp.	OQ589785	This study
	LESF 1007	QVM135	Florianópolis, Santa Catarina, Brazil	Fungus garden of attine ant	OQ589787	This study
	LESF 884	U42	Argentina	Fungus garden of Apterostigma sp.	OQ589788	This study
E. papillata	LESF 959	QVM46	Novo Airão, Amazonas, Brazil	Fungus garden of Apterostigma sp.	OQ589789	This study
	CBS 149745^T	LESF 960, QVM47	Novo Airão, Amazonas, Brazil	Fungus garden of Apterostigma sp.	OQ589790	This study
E. peniculiformis	LESF 297^$	RC005	Austin, Texas, USA	Fungus garden of Trachymyrmex turrifex	OQ589742	This study
	LESF 878^$	U59	Panama	Fungus garden of Apterostigma sp. G4	OQ589743	This study
	LESF 881	U51	Panama	Fungus garden of attine ant	OQ589786	This study
	CBS 149744^T	LESF 876 UT008	Gamboa - Panama	Fungus garden of Atta colombica	OQ589724	This study
E. phialicopiosa	LESF 047^$	SES002	Fazenda Pau, Goias, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589737	This study
	LESF 106^$	SES006	Uberlândia, Minas Gerais, Brazil	Fungus garden of Mycetomoellerius dichrous	OQ589738	This study
	CBS 149738^T	LESF 048 SES005	Uberlândia, Minas Gerais, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589739	This study
	LESF 021^$	ES002	Rio Claro, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilos	OQ589778	This study
E. primorosea	UNQ E29	E29	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298290	Marfetán et al. (2019)
	UNQ E30	E30	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298291	Marfetán et al. (2019)
	UNQ E42	E42	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298293	Marfetán et al. (2019)
	UNQ E42(2)	E42(2)	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298306	Marfetán et al. (2019)
E. pseudocylindrica	LESF 1029^$	QVM157	Manaus, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589768	This study
	CBS 149749^T	LESF 993 QVM80	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589769	This study
	LESF 1018	QVM146	Manaus, Amazonas, Brazil	Fungus garden of Apterostigma sp.	OQ589770	This study
	LESF 1024	QVM152	Manaus, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589771	This study
E. pseudoweberi	UNQ E4	E4	Buenos Aires, Argentina	Fungus garden of Acromyrmex lundii	KU298300	Marfetán et al. (2019)
	UNQ E10(2)	E10(2)	Corrientes, Argentina	Fungus garden of Acromyrmex lundii	KU298297	Marfetán et al. (2019)
	UNQ E12	E12	Corrientes, Argentina	Fungus garden of Acromyrmex heyeri	KU298298	Marfetán et al. (2019)
	UNQ E13	E13	Corrientes, Argentina	Fungus garden of Acromyrmex lundii	KU298307	Marfetán et al. (2019)
	UNQ E20	E20	Santa Fé, Argentina	Fungus garden of Acromyrmex lobcornis	KU298299	Marfetán et al. (2019)
	UNQ E24	E24	Tucumán, Argentina	Fungus garden of Acromyrmex aspersus	KU298301	Marfetán et al. (2019)
E. rectangula	CBS 149739^T	LESF 050 SES008	RO	Fungus garden of Acromyrmex sp.	OQ589729	This study
	LESF 883	UT005	Argentina	Fungus garden of Acromyrmex sp.	OQ589730	This study
	LESF 892	UT020	México	Fungus garden of Trachymyrmex sp. sensu lato	OQ589731	This study
	LESF 318	ES029	Palmas, Tocantins, Brazil	Fungus garden of Acromyrmex sp.	OQ589732	This study
	LESF 326^$	BA006	Ilhéus, Bahia, Brazil	Fungus garden of Atta cephalotes	OQ589733	This study
	LESF 032	ES008	Santarém, Pará, Brazil	Fungus garden of Acromyrmex sp.	OQ589734	This study
	LESF 865^$	UT001	Guadalupe Island, Mexico	Fungus garden of Acromyrmex octospinosus	OQ589735	This study
	LESF 022^$	ES003	Frei Caneca, Pernambuco, Brazil	Fungus garden of Atta cephalotes	OQ589736	This study
	LESF 863^$	U31	Panama	Fungus garden of Apterostigma dentigerum	OQ589741	This study
E. rosisimilis	CBS 135748^T	AUJ5	Viçosa, Minas Gerais, Brazil	Fungus garden of Acromyrmex subterraneus molestans	OQ589719	This study
	CBS 149742^T	LESF 135 SES003	Uberlândia, Minas Gerais, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ589740	This study
	---	QVM287⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ708422	This study
	---	QVM288⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ708423	This study
	---	QVM289⁺	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	OQ708424	This study
Escovopsis sp.	LESF 860	U35	Panama	---	OQ589765	This study
Escovopsis sp.	LESF 038	RS004	Registro, Santa Catarina, Brazil	Fungus garden of Acromyrmex coronatus	OQ589766	This study
E. spicaticlavata	CBS 149740^T	LESF 052,	Manaus, Amazonas, Brazil	Fungus garden of Paratrachymyrmex diversus	MH715124	Montoya et al. (2019)
	LESF 975^$	QVM62	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273566	Montoya et al. (2021)
	LESF 979^$	QVM66	Novo Airão, Amazonas, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273567	Montoya et al. (2021)
E. weberi	ATCC 64542 ^ET	---	Viçosa, Minas Gerais, Brazil	Carpenter ant fungal mass	KF293281	Augustin et al. (2013)
	LESF 046	SES001	Rio Claro, São Paulo, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273511	Montoya et al. (2021)
	LESF 355	ES021	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273534	Montoya et al. (2021)
	LESF 017	NL001	Botucatu, São Paulo, Brazil	Midden of Atta capiguara	MH715113	Montoya et al. (2019)
	LESF 019^$	NL005	Botucatu, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MH715115	Montoya et al. (2019)
	LESF 020	NL006	Botucatu, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273503	Montoya et al. (2021)
	LESF 023^$	ES005	Alta Floresta, Mato Grosso, Brazil	Fungus garden of Atta cephalotes	MH715117	Montoya et al. (2019)
	LESF 024	ES006	Alta Floresta, Mato Grosso, Brazil	Fungus garden of Acromyrmex coronatus	MT273504	Montoya et al. (2021)
	LESF 025	ES007	Alta Floresta, Mato Grosso, Brazil	Fungus garden of Acromyrmex coronatus	MT273505	Montoya et al. (2021)
	LESF 027	ES010	Rio Claro, São Paulo, Brazil	Fungus garden of Acromyrmex landolti	MH715119	Montoya et al. (2019)
	LESF 029	ES012	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MH715120	Montoya et al. (2019)
	LESF 030	ES013	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MH715121	Montoya et al. (2019)
	LESF 031^$	ES014	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MT273506	Montoya et al. (2021)
	LESF 033	ES004	Bahia, Brazil	Fungus garden of Acromyrmex sp.	MT273507	Montoya et al. (2021)
	LESF 034	ES024	Botucatu, São Paulo, Brazil	Fungus garden of Acromyrmex balzanii	MT273508	Montoya et al. (2021)
	LESF 042^$	RS053	Chuvisca, Rio Grande do Sul, Brazil	Fungus garden of Acromyrmex lundii	MT273509	Montoya et al. (2021)
	LESF 043^$	RS055	Chuvisca, Rio Grande do Sul, Brazil	Fungus garden of Acromyrmex heyeri	MT273510	Montoya et al. (2021)
	LESF 054^$	AR003	Ilhéus, Bahia, Brazil	Fungus garden of Acromyrmex balzanii	MT273512	Montoya et al. (2021)
	LESF 056	AR033	Camacan, Bahia, Brazil	Fungus garden of Acromyrmex sp.	MT273513	Montoya et al. (2021)
	LESF 136	4a	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273514	Montoya et al. (2021)
	LESF 146	1cT4	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273515	Montoya et al. (2021)
	LESF 156^$	A088	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273516	Montoya et al. (2021)
	LESF 178	A086a	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273517	Montoya et al. (2021)
	LESF 239	13B	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273518	Montoya et al. (2021)
	LESF 241	H1b	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273519	Montoya et al. (2021)
	LESF 292^$	NL003	Botucatu, São Paulo, Brazil	Fungus garden of Atta capiguara	MT273520	Montoya et al. (2021)
	LESF 294	H33	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273521	Montoya et al. (2021)
	LESF 295	NL009	Botucatu, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MT273522	Montoya et al. (2021)
	LESF 298	NL004	Botucatu, São Paulo, Brazil	Fungus garden of Atta capiguara	MT273523	Montoya et al. (2021)
	LESF 315	NL007	Botucatu, São Paulo, Brazil	Fungus garden of Atta sexdens rubropilosa	MH715125	Montoya et al. (2019)
	LESF 317	ES026	Rio Claro, São Paulo, Brazil	Fungus garden of Trachymyrmex sp. sensu lato	MT273531	Montoya et al. (2021)
	LESF 319	ES030	Palmas, Tocantins, Brazil	Fungus garden of Acromyrmex sp.	MT273532	Montoya et al. (2021)
	LESF 324^$	RS105	Thermas de Santa Bárbara, São Paulo, Brazil	Fungus garden of Atta laevigata	MT273533	Montoya et al. (2021)
	LESF 356	ES032	Botucatu, São Paulo, Brazil	Fungus garden of Atta laevigata	MT273535	Montoya et al. (2021)
	LESF 359	ES019	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MT273536	Montoya et al. (2021)
	LESF 362	ES028	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MT273537	Montoya et al. (2021)
	LESF 363	ES023	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MT273538	Montoya et al. (2021)
	LESF 364	ES015	Corumbataí, São Paulo, Brazil	Fungus garden of Atta sexdens	MT273539	Montoya et al. (2021)
	LESF 519	ES016	---	Fungus garden of Atta sexdens rubropilosa	MT273540	Montoya et al. (2021)
	LESF 575	RS087	Indaial, Santa Catarina, Brazil	Fungus garden of Acromyrmex diciger	MT273541	Montoya et al. (2021)
	LESF 858	A210201	Camacan, Bahia, Brazil	Fungus garden of Atta cephalotes	MT273550	Montoya et al. (2021)
	LESF 859	B110302	Camacan, Bahia, Brazil	Fungus garden of Atta cephalotes	MT273551	Montoya et al. (2021)
	LESF 877	NL010	---	---	MT273555	Montoya et al. (2021)
	LESF 880	2aT=3	---	---	MT273556	Montoya et al. (2021)
	LESF 994	QVM81	Novo Airão, Amazonas, Brazil	Fungus garden of Acromyrmex sp.	MT273568	Montoya et al. (2021)
	UNQ E16	E16	Santa Fé, Argentina	Fungus garden of Acromrmex lundii	KU298308	Marfetán et al. (2019)
	UNQ E22	E22	La Pampa, Argentina	Fungus garden of Acromyrmex striatus	KU298304	Marfetán et al. (2019)
	UNQ E26	E26	La Pampa, Argentina	Fungus garden of Acromyrmex striatus	KU298305	Marfetán et al. (2019)
	UNQ E31	E31	Salta, Argentina	Fungus garden of Acromrmex lundii	KU298292	Marfetán et al. (2019)
	UNQ E41	E41	Salta, Argentina	Fungus garden of Acromrmex lundii	KU298294	Marfetán et al. (2019)
Sympodiorosea kreiselii	CBS 139320^ET	LESF 053	Florianópolis, Santa Catarina, Brazil	Fungus garden of Mycetophylax morschi	KJ808765	Meirelles et al. (2015a)

Open in a new tab

^T Holotype;^ET Ex-type cultures; +: Inactive strains; LESF: Laboratory of Fungal Ecology and Systematics (UNESP, Rio Claro, Brazil); QVM: Quimi Vidaurre Montoya.

Table S5 .

Morphological features used to construct the dichotomous key of Escovopsis species.

			E. weberii	E. microspora	E. peniculiformis	E. breviramosa	E. gracilis	E. chamydosporosa	E. rectangula	E. pseudocylindrica	E. spicaticlavata	E. moelleri	E. phialicopiosa	E. elongatistipitata	E. diminuta	E. lentecrescens	E. rosisimilis	E. maculosa	E. aspergiloides	E. multiformis	E. clavata	E. papillata
Growth temperature	10 °C	x1	yes	yes	no	yes	no	no	yes	no	no	yes	no	no	no	no	no	no	no	yes	no	no
	20 °C	x2	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes
	25 °C	x3	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes
	30 °C	x4	yes	yes	yes	yes	no	yes	yes	no	yes	no	no	no	no	no	no	no	no	yes	no	no
Growth at 25 °C, 4 d	MEA	x5	39.88	39.88	39.5	40	40	34.94	34.38	17.63	29.5	21.13	16.81	26.69	16.81	2.5	6.31	5.5	5.75	5.31	4.25	3.44
	PDA	x6	40	40	40	40	40	40	40	29.94	24.88	24.75	17	20.06	17.31	3.06	25.81	24.88	6.81	5.44	9.13	7.06
	CMD	x7	22.44	22.44	19.31	16.31	15.25	14.56	12.56	11.31	15.75	10.06	5.63	10	12.44	2.81	6.25	4.44	1.63	7.69	4.19	2.06
Colony on CMD	White (LIII73(10))	x8	yes	yes	yes	yes	yes	yes	yes	no	yes	no	yes	yes	yes	no	no	yes	no	no	no	yes
	Colonial buff (XXX21‣d)	x9	yes	yes	yes	no	no	no	yes	yes	yes	yes	no	no	yes	yes	no	yes	no	yes	yes	no
	Olive-Ocher (XXX21‣)	x10	yes	yes	yes	yes	no	no	yes	no	no	no	no	no	no	no	no	yes	yes	no	no	no
	Light Brownnish olive (XXX19‣k)	x11	no	no	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no	no
	Margerite Yellow (XXX23‣f)	x12	no	no	no	no	yes	yes	yes	yes	yes	yes	yes	yes	no	no	yes	no	no	yes	yes	yes
	Light Yellow-Green (VI31d)	x13	no	no	no	no	no	no	yes	no	no	no	no	no	no	no	yes	no	yes	no	no	no
	Picnic Yellow (IV23d)	x14	no	no	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no	no
	*Olive-Yellow (XXX23‣)	x15	no	no	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no	no
	Ecru-Olive (XXX21‣i)	x16	no	no	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no	no
	*Vinaceous-Cinnamon (XXIX13‣b)	x17	no	no	no	no	no	no	yes	no	no	no	no	no	no	yes	no	no	no	no	no	no
	Deep Colonial Buff (XXX21‣b)	x18	no	no	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no	no
Colony on MEA	White (LIII73(10))	x19	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	no	no	yes	yes	no	no
	Colonial buff (XXX21‣d)	x20	yes	yes	yes	yes	no	no	no	yes	no	no	no	yes	no	no	no	no	no	no	yes	no
	Olive-Ocher (XXX21‣)	x21	yes	yes	yes	yes	no	no	no	yes	no	no	no	no	yes	no	no	no	no	no	no	no
	Light Brownnish olive (XXX19‣k)	x22	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no	no		no	no	no
	Margerite Yellow (XXX23‣f)	x23	yes	yes	no	no	yes	yes	yes	no	yes	yes	yes	no	yes	yes	yes	yes	no	yes	yes	yes
	Light Yellow-Green (VI31d)	x24	yes	yes	yes	no	no	no	no	yes	no	no	no	no	no	no	no	yes	no	no	no	yes
	Picnic Yellow (IV23d)	x25	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	yes	no	yes	no	no	no
	*Olive-Yellow (XXX23‣)	x26	no	no	no	no	no	no	no	yes	yes	no	no	no	yes	no	yes	no	yes	no	no	no
	Ecru-Olive (XXX21‣i)	x27	yes	yes	no	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no
	*Vinaceous-Cinnamon (XXIX13‣b)	x28	yes	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no
	Deep Colonial Buff (XXX21‣b)	x29	yes	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no
Colony on PDA	White (LIII73(10))	x30	yes	yes	yes	yes	yes	yes	yes	yes	yes	no	yes	yes	yes	yes	yes	no	no	yes	no	yes
	Colonial buff (XXX21‣d)	x31	yes	yes	no	yes	yes	yes	yes	yes	yes	yes	yes	no	yes	yes	no	no	yes	yes	yes	yes
	Olive-Ocher (XXX21‣)	x32	yes	yes	no	yes	no	no	yes	yes	no	yes	yes	no	yes	yes	no	no	no	yes	no	no
	Light Brownnish olive (XXX19‣k)	x33	no	no	no	no	no	no	yes	no	no	no	no	no	no	yes	no	no		no	no	no
	Margerite Yellow (XXX23‣f)	x34	no	no	yes	no	no	no	no	no	no	yes	no	yes	no	no	no	yes	no	no	yes	yes
	Light Yellow-Green (VI31d)	x35	yes	yes	no	no	no	no	no	yes	no	no	no	no	no	no	yes	yes	yes	no	no	no
	Picnic Yellow (IV23d)	x36	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	no	no	no
	*Olive-Yellow (XXX23‣)	x37	no	no	yes	no	no	no	no	yes	no	no	no	no	no	no	no	no	yes	no	no	no
	Ecru-Olive (XXX21‣i)	x38	yes	yes	yes	no	no	no	no	yes	no	no	no	no	no	no	no	no	no	no	no	no
	*Vinaceous-Cinnamon (XXIX13‣b)	x39	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no
	Deep Colonial Buff (XXX21‣b)	x40	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no
Colonies forming	pustule-like	x41	yes	yes	yes	yes	yes	yes	yes	no	no	no	yes	no	yes	no	no	no	no	yes	no	no
	Soluble pigments	x42	yes	yes	yes	no	no	no	no	no	no	no	no	no	yes	no	no	no	no	no	no	no
	Stolons	x43	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	yes	no	yes	yes	yes	rare	rare	rare
	submerged	x44	yes	yes	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	no	no
	circular zones
	aerial circular	x45	yes	yes	no	no	yes	no	yes	no	no	no	no	yes	no	yes	no	no	yes		yes	no
	shapes
	mottled aspect	x46	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	no	no	no	no
conidiophores	shape	x47	pyramidal	pyramidal	pyramidal	pyramidal	pyramidal	pyramidal	rectangular	irregular	irregular	irregular	irregular	irregular	irregular	irregular	irregular	irregular	irregular	irregular	irregular	irregular
	swollen cell	x48	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	no
	infertile hypha	x49	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	no
vesicles	cylindrical	x50	yes	yes	yes	yes	yes	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no
	clavate	x51	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	no	no	no	no	no	yes	yes	yes
	cymbiform	x52	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	no	no	no	no	no	yes	yes	yes
	subulate	x53	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	no	no	no	no	no	yes	yes	yes
	lanceolate	x54	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	no	no	no	no	no	yes	yes	yes
	globose	x55	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	yes	yes	yes
	subglobose	x56	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	yes	yes	yes
	capitate	x57	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	yes	yes	yes
	obovoid	x58	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	yes
	prolate	x59	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	yes
	spatulate	x60	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	yes	yes
	septate	x61	less frequent	less frequent	common	common	common	less frequent	less frequent	less frequent	less frequent	less frequent	less frequent	less frequent	no	no	no	no	no	less frequent	less frequent	less frequent
conidia	Cell wall	x62	smooth	smooth	smooth	smooth	smooth	smooth	smooth	thickened	thickened	thickened	thickened	thickened	smooth	smooth	smooth	smooth	smooth	smooth	smooth	smooth
	ornamentation	x63	no	no	no	no	no	no	no	yes	yes	yes	no	yes	no	no	no	no	no	no	no	no
	long chains	x64	yes	yes	yes	yes	yes	yes	yes	no	no	no	no	no	yes	yes	yes	yes	yes	yes	yes	yes
	short chains	x65	no	no	no	no	no	no	no	yes	yes	yes	yes	yes	no	no	no	no	no	no	no	no
phialides on aerial mycelium	x66	no	no	yes	yes	yes	no	no	no	no	no	no	no	no	no	no	no	no	no	no	no
chlamydospores	x67	rare	rare	rare	rare	rare	common	rare	rare	rare	rare	rare	rare	rare	rare	rare	rare	rare	rare	rare	rare
blooming roses formation	x68	no	no	no	no	no	no	no	no	no	no	no	no	no	no	yes	no	no	no	no	no

Open in a new tab

Table S6 .

Data recoding sheet to evaluate the macroscopic characters of the colonies of Escovopsis species.

		Grow after 4 d on CMD/MEA/PDA
		1 wk				2 wk				3 wk				4 wk
		10°C	20°C	25°C	30°C	10°C	20°C	25°C	30°C	10°C	20°C	25°C	30°C	10°C	20°C	25°C	30°C
Colonies growing at
Colony radius (mm)
Start of Germination (day)
Colony morphology after 7 d, on CMD/MEA/PDA at 25 °C
Colony shape
Stolons
Mycelium forming rings
Submerged mycelium forming circular zone
Pustule like formations
Soluble pigments
Colour (Ridgway 1912)	White (LIII73(10))
	Colonial buff (XXX21‣d)
	Olive-Ocher (XXX21‣)
	Light Brownish olive (XXX19‣k)
	Margerite Yellow (XXX23‣f)
	Light Yellow-Green (VI31d)
	Picnic Yellow (IV23d)
	*Olive-Yellow (XXX23‣)
	Ecru-Olive (XXX21‣i)
	*Vinaceous-Cinnamon (XXIX13‣b)
	Deep Colonial Buff (XXX21‣b)
Notes

Open in a new tab

Table S7 .

Data recoding sheet to evaluate the microscopic characters of Escovopsis species.

Micromorphology on PDA at 25 °C
CONIDIOPHORE
Type	Mono-vesiculate	Yes	No	Notes:
Type	Poly-vesiculate	Yes	No	Notes:
Number of vesicles	Min =.......... .Max = ..........
Length	Min =.......... .Max = ..........
Stipe length	Min =.......... .Max = ..........
Stipe septum	Yes	No	Notes:
Distance of septum from the foot cell	Min =.......... .Max = ..........
Shape		Notes:
Colour		Notes:
Cell wall	Smooth	Yes	No	Notes:
Cell wall	Rough	Yes	No	Notes:
Arrangement		Notes:
Swollen cell		Yes	No	Notes:
Swollen cell length	Min =.......... .Max = ..........
Swollen cell width	Min =.......... .Max = ..........
Infertile hypha	Yes	No	Notes:
CONIDIOPHORE BRANCHES
Length	Min =.......... .Max = ..........
Branching levels	Yes	No	Notes:
Branching angle	Notes:
Arrangement	Notes:
Stipe length	Min =.......... .Max = ..........
Stipe septum	Yes	No	Notes:
Distance of septum from from conidiophore axis	Min =.......... .Max = ..........
VESICLES
Shape (Montoya et al. 2021)		Notes:
Length	Min =.......... .Max = ..........
width	Min =.......... .Max = ..........
Formed on	Conidiophore	Yes	No	Notes:
	Aerial mycelium	Yes	No	Notes:
	Other structure	Notes:
Stipe length	Min =.......... .Max = ..........
Stipe septum	Yes	No	Notes:
PHIALIDES
Formed on	Vesicles	Yes	No	Notes:
	Aerial mycelium	Yes	No	Notes:
	Other structure	Yes	No	Notes:
Total length	Min =.......... .Max = ..........
Shape		Notes:
Length at the base	Min =.......... .Max = ..........
Width at the base	Min =.......... .Max = ..........
Length at the swollen cell	Min =.......... .Max = ..........
Width at the swollen cell	Min =.......... .Max = ..........
Length at the neck	Min =.......... .Max = ..........
Width at the neck	Min =.......... .Max = ..........
CONIDIA
Formed in	long chains	Yes	No	Notes:
	short chains	Yes	No	Notes:
	solitary	Yes	No	Notes:
Shape		Notes:
Colour		Notes:
Cell wall	Smooth	Yes	No	Notes:
	Rough	Yes	No	Notes:
	Ornamented	Yes	No	Notes:
CHLAMYDOSPORES
Formed	Intercalary	Yes	No	Notes:
Formed	Terminal	Yes	No	Notes:
Length	Min =.......... .Max = ..........
Width	Min =.......... .Max = ..........
Notes

Open in a new tab

Fig. S1.

SIM_vol106_art6_SF1.jpg^{(12.6MB, jpg)}

Fig. S2.

SIM_vol106_art6_SF2.jpg^{(1.8MB, jpg)}

Fig. S3.

SIM_vol106_art6_SF3.pdf^{(1.4MB, pdf)}

[R1] Atanasova L, Le Crom S, Gruber S, et al. (2013). Comparative transcriptomics reveals different strategies of Trichoderma mycoparasitism. BMC Genomics 14: 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R2] Augustin JO, Groenewald JZ, Nascimento RJ, et al. (2013). Yet more “weeds” in the garden: Fungal novelties from nests of leaf-cutting ants. PLoS One 8: 1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R3] Bailey BA, Melnick RL, (2013). The Endophytic Trichoderma. In: Trichoderma: biology and applications (Mukherjee PK, Horwitz BA, Singh US, Mukherjee Schmoll MM.). CABI, UK (London): 152–172. [Google Scholar]

[R4] Batey SFD, Greco C, Hutchings MI, et al. (2020). Chemical warfare between fungus-growing ants and their pathogens. Current Opinion Chemical Biology 59: 172–181. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R5] Birnbaum SSL, Gerardo NM, (2016). Patterns of specificity of the pathogen Escovopsis across the fungus-growing ant symbiosis. The American Naturalist 188: 52–65. [DOI] [PubMed] [Google Scholar]

[R6] Boya CA, Fernández-Marín H, Mejiá LC, et al. (2017). Imaging mass spectrometry and MS/MS molecular networking reveals chemical interactions among cuticular bacteria and pathogenic fungi associated with fungus-growing ants. Scientific Report 7: 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R7] Brotman Y, Kapuganti JG, Viterbo A, (2010). Trichoderma. Current Biology 20: 390–391. [DOI] [PubMed] [Google Scholar]

[R8] Caldera EJ, Poulsen M, Suen G, et al. (2009). Insect symbioses: a case study of past, present, and future fungus-growing ant research. Environmental Entomology 38: 78–92. [DOI] [PubMed] [Google Scholar]

[R9] Chaverri P, Branco-Rocha F, Jaklitsch W, et al. (2015). Systematics of the Trichoderma harzianum species complex and the re-identification of commercial biocontrol strains. Mycologia 107: 558–590. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R10] Chaverri P, Samuels GJ, (2013). Evolution of habitat preference and nutrition mode in a cosmopolitan fungal genus with evidence of interkingdom host jumps and major shifts in ecology. Evolution 67: 2823–2837. [DOI] [PubMed] [Google Scholar]

[R11] Currie CR, Wong B, Stuart AE, et al. (2003). Ancient tripartite coevolution in the attine ant-microbe symbiosis. Science 299: 386–388. [DOI] [PubMed] [Google Scholar]

[R12] Currie CR, (2001). Prevalence and impact of a virulent parasite on a tripartite mutualism. Oecologia 128: 99–106. [DOI] [PubMed] [Google Scholar]

[R13] Currie CR, Mueller UG, Malloch D, (1999). The agricultural pathology of ant fungus gardens. Proceedings of the National Academy of Sciences of the United States of America 96: 7998–8002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R14] Darriba D, Taboada GL, Doallo R, et al. (2012). jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9: 772–772. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R15] De Man TJB, Stajich JE, Kubicek CP, et al. (2016). Small genome of the fungus Escovopsis weberi, a specialized disease agent of ant agriculture. Proceedings of the National Academy of Sciences of the United States of America 113: 3567–3572. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R16] Diego EW, Juan Adrián G VA, A PT, (2014). Correlation between virulence and genetic structure of Escovopsis strains from leaf-cutting ant colonies in Costa Rica. Microbiology (Reading) 160: 1727–1736. [DOI] [PubMed] [Google Scholar]

[R17] Druzhinina I, Kubicek CP, (2005). Species concepts and biodiversity in Trichoderma and Hypocrea: From aggregate species to species clusters. Journal of Zhejiang University. Science B 6: 100–112. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R18] Druzhinina IS, Seidl-Seiboth V, Herrera-Estrella A, et al. (2011). Trichoderma: The genomics of opportunistic success. Nature Reviews Microbiology 9: 749–759. [DOI] [PubMed] [Google Scholar]

[R19] Folgarait P, Gorosito N, Poulsen M, et al. (2011). Preliminary in vitro insights into the use of natural fungal pathogens of leaf-cutting ants as biocontrol agents. Current Microbiology 63: 250–258. [DOI] [PubMed] [Google Scholar]

[R20] Gerardo NM, Jacobs SR, Currie CR, et al. (2006a). Ancient host-pathogen associations maintained by specificity of chemotaxis and antibiosis. PLoS Biology 4: 1358–1363. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R21] Gerardo NM, Mueller UG, Currie CR, (2006b). Complex host-pathogen coevolution in the Apterostigma fungus-growing ant-microbe symbiosis. BMC Ecology and Evolution 6: 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R22] Gerardo NM, Mueller UG, Price SL, et al. (2004). Exploiting a mutualism: parasite specialization on cultivars within the fungus-growing ant symbiosis. Proceedings of the Royal Society B: Biological Sciences 271: 1791–1798. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R23] Gotting K, May DS, Sosa-Calvo J, et al. (2022). Genomic diversification of the specialized parasite of the fungus-growing ant symbiosis. Proceedings of the National Academy of Sciences of the United States of America 119: 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R24] Guzmán-Guzmán P, Porras-Troncoso MD, Olmedo-Monfil V, et al. (2019). Trichoderma species: Versatile plant symbionts. Phytopathology 109: 6–16. [DOI] [PubMed] [Google Scholar]

[R25] Heine D, Holmes NA, Worsley SF, et al. (2018). Chemical warfare between leafcutter ant symbionts and a co-evolved pathogen. Nature Communications 9: 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R26] Hutchinson MC, Gaiarsa MP, Stouffer DB, (2018). Contemporary ecological interactions improve models of past trait evolution. Systematic Biology 67: 861–872. [DOI] [PubMed] [Google Scholar]

[R27] Indunil CS, Achala RR, Diana SM, et al. (2020). Morphological approaches in studying fungi: collection, examination, isolation, sporulation and preservation. Mycosphere 11: 2678–2754. [Google Scholar]

[R28] Jaklitsch WM, (2009). European species of Hypocrea Part I. The green-spored species. Studies Mycology 63: 1–91. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R29] Jaklitsch WM, Samuels GJ, (2011). Reconsideration of Protocrea (Hypocreales, Hypocreaceae). Mycologia 100: 962–984. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R30] Jiménez-Gómez I, Barcoto MO, Montoya QV, et al. (2021). Host susceptibility modulates Escovopsis pathogenic potential in the fungiculture of Higher Attine Ants. Frontiers in Microbiology 12: 1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R31] Katoh K, Standley DM, (2013). MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R32] Kearse M, Moir R, Wilson A, et al. (2012). Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R33] Kessler A, Halitschke R, (2009). Testing the potential for conflicting selection on floral chemical traits by pollinators and herbivores: Predictions and case study. Functional Ecology 23: 901–912. [Google Scholar]

[R34] Koukol O, Delgado G, (2021). Why morphology matters: the negative consequences of hasty descriptions of putative novelties in asexual ascomycetes. IMA Fungus 12: 2–8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R35] Kubicek CP, Steindorff AS, Chenthamara K, et al. (2019). Evolution and comparative genomics of the most common Trichoderma species. BMC Genomics 20: 1–24. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R36] Lücking R, Aime MC, Robbertse B, et al. (2020). Unambiguous identification of fungi: Where do we stand and how accurate and precise is fungal DNA barcoding? IMA Fungus 11: 1–32. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R37] Lücking R, Aime MC, Robbertse B, et al. (2021). Fungal taxonomy and sequence-based nomenclature. Nature Microbiology 6: 540–548. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R38] Marfetán JA, Romero AI, Cafaro MJ, et al. (2018). Five new Escovopsis species from Argentina. Mycotaxon 133: 569–589. [Google Scholar]

[R39] Marfetán JA, Romero AI, Folgarait PJ, (2015). Pathogenic interaction between Escovopsis weberi and Leucoagaricus sp.: Mechanisms involved and virulence levels. Fungal Ecology 17: 52–61. [Google Scholar]

[R40] Masiulionis VE, Cabello MN, Seifert KA, et al. (2015). Escovopsis trichodermoides sp. nov., isolated from a nest of the lower attine ant Mycocepurus goeldii. Antonie van Leeuwenhoek 107: 731–740. [DOI] [PubMed] [Google Scholar]

[R41] Meirelles LA, Montoya QV, Solomon SE, et al. (2015a). New light on the systematics of fungi associated with attine ant gardens and the description of Escovopsis kreiselii sp. nov. PLoS ONE 10: 1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R42] Meirelles LA, Solomon SE, Bacci M, et al. (2015b). Shared Escovopsis parasites between leaf-cutting and non-leaf-cutting ants in the higher attine fungus-growing ant symbiosis. Royal Society Open Science 2: 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R43] Mendonça DMF, Caixeta MCS, Martins GL, et al. (2021). Low virulence of the fungi Escovopsis and Escovopsioides to a leaf-cutting ant-fungus symbiosis. Frontiers in Microbiology 12: 1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R44] Möller A, (1941). As hortas de fungos de algumas formigas sul-Americanas, 1st edn. SCP, Brazil. [Google Scholar]

[R45] Möller E, Bahnweg G, Sandermann H, et al. (1992). A simple and efficient protocol for isolation of high molecular weight DNA from filamentous fungi, fruit bodies, and infected plant tissues. Nucleic Acids Research 20: 6115–6116. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R46] Montoya QV, Martiarena MJS, Bizarria R, et al. (2021). Fungi inhabiting attine ant colonies: reassessment of the genus Escovopsis and description of Luteomyces and Sympodiorosea gens. nov. IMA Fungus 12: 1–18. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R47] Montoya QV, Martiarena MJS, Polezel DA, et al. (2019). More pieces to a huge puzzle: Two new Escovopsis species from fungus gardens of attine ants. MycoKeys 46: 97–118. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R48] Muchovej Della JJ, Lucia TC, (1990). Escovopsis, a new genus from leaf-cutting ants nests to replace Phailocladus nomem invalidum. Mycotaxon 37: 191–195. [Google Scholar]

[R49] Mueller UG, Gerardo N, (2002). Fungus-farming insects: multiple origins and diverse evolutionary histories. Proceedings of the National Academy of Sciences of the United States of America 99: 15247–15249. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R50] Mueller UG, Rehner SA, Schultz TR, (1998). The evolution of agriculture in ants. Science 281: 2034–2038 [DOI] [PubMed] [Google Scholar]

[R51] Mukherjee PK, Mendoza-Mendoza A, Zeilinger S, et al. (2022). Mycoparasitism as a mechanism of Trichoderma-mediated suppression of plant diseases. Fungal Biology Reviews 39: 15–33. [Google Scholar]

[R52] Nixon KC, (2002). WinClada ver. 1.0000. Published by the author, Ithaca, New York, USA. [Google Scholar]

[R53] Põldmaa K, (2011). Tropical species of Cladobotryum and Hypomyces producing red pigments. Studies in Mycology 68: 1–34. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R54] Põldmaa K, (2000). Generic delimitation of the fungicolous Hypocreaceae. Studies in Mycology 45: 83–94. [Google Scholar]

[R55] Põldmaa K, Larsson E, Kõljalg U, (1999). Phylogenetic relationships in Hypomyces and allied genera, with emphasis on species growing on wood-decaying homobasidiomycetes. Canadian Journal of Botany 77: 1756–1768 [Google Scholar]

[R56] Raja HA, Miller AN, Pearce CJ, et al. (2017). Fungal identification using molecular tools: A primer for the natural products research community. Journal of Natural Products 80: 756–770. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R57] Raja HA, Oberlies NH, Stadler M, (2021). Occasional comment: Fungal identification to species-level can be challenging. Phytochemistry 190: 1–3. [DOI] [PubMed] [Google Scholar]

[R58] Ridgway R, (1912). Color Standards and Color Nomenclature. Washington, DC, USA: published by the author. [Google Scholar]

[R59] Ronquist F, Teslenko M, van der Mark P, et al. (2012). MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematic Biology 61: 539–542. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R60] Samson RA, Visagie CM, Houbraken J, et al. (2014). Phylogeny, identification and nomenclature of the genus Aspergillus. Studies in Mycology 78: 141–173. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R61] Seifert KA, Samson RA, Chapela IH, (1995). Escovopsis aspergilloides, a rediscovered hyphomycete from leaf-cutting ant nests. Mycologia 87: 407–413. [Google Scholar]

[R62] Stamatakis A, (2014). RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30: 1312–1313. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R63] Taerum SJ, Cafaro MJ, Little AEF, et al. (2007). Low host-pathogen specificity in the leaf-cutting ant-microbe symbiosis. Proceedings of the Royal Society B: Biological Sciences 274: 1971–1978. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R64] Taylor JW, Jacobson DJ, Kroken S, et al. (2000). Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21–32. [DOI] [PubMed] [Google Scholar]

[R65] Therneau TM, Atkinson EJ, (2019). An Introduction to Recursive Partitioning Using the RPART Routines. Mayo Clinic Section Biostatistics Technical Report 61: 33. [Google Scholar]

[R66] Visagie CM, Houbraken J, Frisvad JC, et al. (2014). Identification and nomenclature of the genus Penicillium. Studies in Mycology 78: 343–371. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R67] Williams G, (2011). Decision Trees. Data Mining with Rattle and R: The Art of Excavating Data for Knowledge Discovery Use R. 2nd edn. Springer, Germany. [Google Scholar]

[R68] Yek SH, Boomsma JJ, Poulsen M, (2012). Towards a better understanding of the evolution of specialized parasites of fungus-growing ant crops. Psyche: A Journal of Entomology 2012: 239–392. [Google Scholar]

PERMALINK

Taxonomy and systematics of the fungus-growing ant associate Escovopsis (Hypocreaceae)

QV Montoya

MJS Martiarena

A Rodrigues

Abstract

INTRODUCTION

MATERIALS AND METHODS

Sampling and strains

Table 1 .

Adjusting the parameters to evaluate the morphology of Escovopsis

DNA extraction, PCR and sequencing

Phylogenetic analyses

Taxonomic key to Escovopsis species

RESULTS

Adjusting the parameters to evaluate the morphology of Escovopsis

Fig. 1 .

Fig. 2 .

Escovopsis phylogeny

Fig. 3 .

Morphological diversity Escovopsis

Taxonomy

Fig. 4 .

Fig. 7 .

Fig. 11 .

Fig. 13 .

Fig. 14 .

Fig. 22 .

Fig. 5 .

Fig. 6 .

Fig. 8 .

Fig. 9 .

Fig. 10 .

Fig. 12 .

Fig. 15 .

Fig. 16 .

Fig. 17 .

Fig. 18 .

Fig. 19 .

Fig. 20 .

Fig. 21 .

Dichotomous key to known Escovopsis species

DISCUSSION

Acknowledgments

DECLARATION ON CONFLICT OF INTEREST

AUTHORS’ CONTRIBUTIONS

Supplementary material

Table S1 .

Table S2 .

Table S3 .

Table S4 .

Table S5 .

Table S6 .

Table S7 .

REFERENCES

Associated Data

Supplementary Materials

Table S1 .

Table S2 .

Table S3 .

Table S4 .

Table S5 .

Table S6 .

Table S7 .

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases