TABLE 2.

Nucleotide sequence of oligonucleotide primers used for PCR-based cloning procedures in this study

Primer	Sequencea	Brief description
Pr 406	CAAAAGAAGACAAACAAGCAGC	Primer (sense) designed for sequencing and cloning of lgt1
Pr 407	CCCATTTAGTATCAGAAGATGACAC	Primer (antisense) designed for sequencing and cloning of lgt1
Pr 422	tataAGATCTTCAACTTCACTGTTACTGTGTTC	Inverse PCR primer (sense) with BamHI sites engineered for lgt1 mutagenesis
Pr 423	gcgGGATCCAACCAAAAGCAAAGCCTG	Inverse PCR primer (antisense) with BglII sites engineered for lgt1 mutagenesis
Pr 508	AAGAAGTGGGGCTTTTGTCAGAG	Primer (sense) designed for sequencing and cloning of lgt2
Pr 509	GAGAGTATGTCATTCGTGGCGAC	Primer (antisense) designed for sequencing and cloning of lgt2
Pr 512	gcgcCTCGAGGAATCGCTTTTCAGTAACCAAG	Inverse PCR primer (sense) with XhoI sites engineered for lgt2 mutagenesis
Pr 513	tataAGATCTCAAGTTTTCATCAATCATCTGTTGC	Inverse PCR primer (antisense) with BglII sites engineered for lgt2 mutagenesis
Pr 698	ATGAATACAGCCAAGCGG	Primer (sense) designed for sequencing and cloning of lgt3
Pr 699	AAGTCGTGATAGTTTGTCGG	Primer (antisense) designed for sequencing and cloning of lgt3
Pr 681	gcgcCTCGACCTTGTGCTTGATGCGGATGAAC	Inverse PCR primer (sense) with XhoI sites engineered for lgt3 mutagenesis
Pr 682	tataAGATCTTCAGCCCATAACGACCTTGTAAG	Inverse PCR primer (antisense) with BglII sites engineered for lgt3 mutagenesis
Pr 342	gcgGGATCCGTCGACTCTAGAGGATCCCCGGGTCATTA	Primer (antisense) designed to amplify the aphA-3 cassette with BamHI sites engineered for directional cloning and lgt1 mutagenesis
Pr 417	tataAGATCTGGGTGACTAACTAGGAGGAATAAATGGCTA	Primer (sense) designed to amplify the aphA-3 with BglII sites engineered for directional cloning and mutagenesis
Pr 491	tataCTCGAGGTCGACTCTAGAGGATCCCCGGGTCATTA	Primer (antisense) designed to amplify the aphA-3 cassette with XhoI sites engineered for directional cloning and lgt2 and lgt3 mutagenesis
Pr 836	tataCCGCGGTTGTTGAGAGTCATTCCCC	Primer (sense) designed to amplify the lgt3 gene to include 5′ flanking DNA with SacII sites engineered for cloning into pLS88
Pr 837	taccCTGCAGTGATGTTGATACAGCAGGTTC	Primer (antisense) designed to amplify the lgt3 gene to include 5′ flanking DNA with PstI sites engineered for cloning into pLS88
Pr 838	taccCTGCAGATGAATACAGCCAAGCGG	Primer (sense) designed to amplify an internal portion of the lgt3 gene with SacII sites engineered for cloning into pLS88
Pr 839	tataCCGCGGCCATTTTGCCCCATAACTTTCG	Primer (antisense) designed to amplify an internal portion of the lgt3 gene with PstI sites engineered for cloning into pLS88

^aAll primers are listed in the 5′ to 3′ direction. Any 5′ caps are shown in lowercase letters, and any restriction sites are shown in boldface type.