Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Feb 5.
Published in final edited form as: Acta Neuropathol. 2023 Nov 29;147(1):1. doi: 10.1007/s00401-023-02652-3

G2C4 targeting antisense oligonucleotides potently mitigate TDP-43 dysfunction in human C9orf72 ALS/FTD induced pluripotent stem cell derived neurons

Jeffrey D Rothstein 1,2, Victoria Baskerville 1,2, Sampath Rapuri 1,2, Emma Mehlhop 1,2, Paymaan Jafar-Nejad 3, Frank Rigo 3, Frank Bennett 3, Sarah Mizielinska 4,5, Adrian Isaacs 6,7,8, Alyssa N Coyne 1,2
PMCID: PMC10840905  NIHMSID: NIHMS1961216  PMID: 38019311

Abstract

The G4C2 repeat expansion in the C9orf72 gene is the most common genetic cause of Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Many studies suggest that dipeptide repeat proteins produced from this repeat are toxic, yet, the contribution of repeat RNA toxicity is under investigated and even less is known regarding the pathogenicity of antisense repeat RNA. Recently, two clinical trials targeting G4C2 (sense) repeat RNA via antisense oligonucleotide failed despite a robust decrease in sense-encoded dipeptide repeat proteins demonstrating target engagement. Here, in this brief report, we show that G2C4 antisense, but not G4C2 sense, repeat RNA is sufficient to induce TDP-43 dysfunction in induced pluripotent stem cell (iPSC) derived neurons (iPSNs). Unexpectedly, only G2C4, but not G4C2 sense strand targeting, ASOs mitigate deficits in TDP-43 function in authentic C9orf72 ALS/FTD patient iPSNs. Collectively, our data suggest that the G2C4 antisense repeat RNA may be an important therapeutic target and provide insights into a possible explanation for the recent G4C2 ASO clinical trial failure.

Keywords: C9orf72, Repeat RNA, TDP-43, Antisense oligonucleotides, Induced pluripotent stem cell derived neurons, ALS

Introduction

An intronic GGGGCC (G4C2) hexanucleotide repeat expansion (HRE) in the C9orf72 gene is the most common cause of familial ALS and FTD, collectively referred to as C9orf72 ALS/FTD, and also causes ~ 8% of apparently sporadic ALS or FTD [12, 39]. The HRE is bidirectionally transcribed to form G4C2 (sense) and G2C4 (antisense) RNA species both of which have been documented to pathologically accumulate into RNA foci in human autopsy tissue and induced pluripotent stem cell (iPSC) lines, as well as in mouse and fly models of C9orf72 ALS/FTD. In addition, repeat-associated non-ATG (RAN) translation of G4C2 and G2C4 RNA produces five distinct dipeptide repeat (DPR) proteins: sense encoded Poly(GA), Poly(GP), Poly(GR) and antisense encoded Poly(PR), Poly(PA), Poly(GP). Together, these RNA species and DPR proteins are thought to contribute to disease through gain of toxicity mechanisms [18]. While much research has concluded that specific DPRs, including Poly(PR) and Poly(GR), translated from the G2C4 and G4C2 repeat RNA strands respectively, are toxic when highly overexpressed in multiple model systems [15, 20, 27, 46, 49], little is known regarding the pathogenicity of repeat RNAs themselves especially in endogenous expression models where it has been technically challenging to dissociate repeat RNA and DPR mediated toxicity.

It is thought that expression of C9orf72 repeat RNA species can sequester RNA binding proteins (RBPs) into pathologic RNA foci and impede their function [6, 48] and disrupt nuclear pore complexes and nucleocytoplasmic transport [9, 48]. Importantly, 97% of ALS, ~ 50% of FTD, and all C9orf72 ALS/FTD cases exhibit a nuclear reduction and/or clearance along with associated loss of nuclear function and subsequent cytoplasmic mislocalization of the RNA binding protein TDP-43 [44, 45]. However, histology studies failed to evaluate the functional consequences of repeat RNA – RBP interactions as well as the role of soluble repeat RNA species in disease pathogenesis. In fact, the vast number of studies published in the last decade have focused solely on the DPR species. Notably, prior work from our labs and others have shown that the G4C2 sense repeat RNA can be itself toxic in human neurons [9].

Little is known regarding the pathobiology of the G2C4 antisense RNA species in human neurons. Although antisense pathology is detectable in CNS regions at autopsy, multiple reports suggest that the expression of G2C4 repeat RNA and the presence of G2C4 foci is low in human tissue, as compared to G4C2 RNA. However, the exact length and proportion of these different transcripts remains unclear. Furthermore, histological pathology, by itself, is not a measure of physiological toxicity. Nonetheless, the reliable presence of translated DPR products from the antisense strand (e.g. Poly(PR) and Poly(PA)) provides clear in vivo evidence of protein products from antisense RNA in human brain and spinal cord [7, 10–12, 16, 26, 31, 34, 39]. Interestingly, histological analyses in postmortem C9orf72 ALS/FTD patient tissues have suggested that nuclear depletion and the mislocalization of the RNA binding protein TDP-43 from the nucleus to the cytoplasm is more frequently observed in cells containing abundant G2C4 antisense repeat RNA foci [1, 7]. However, it is important to note that few neurons harbor TDP-43 aggregates at end-stage disease [25, 36] and nuclear depletion of TDP-43 has been observed prior to TDP-43 aggregation in C9orf72 disease [45]. Nonetheless, these studies highlight relationship between G2C4 antisense repeat RNA and TDP-43 pathology in C9orf72 disease which may be therapeutically relevant and worthy of functional studies.

Due to the vast literature largely focused on sense strand RNA abundance and sense strand DPR products, antisense oligonucleotide (ASO) therapies targeting the G4C2 sense strand repeat RNA were identified [14, 22, 41]. Unfortunately, a subsequent international clinical trial of the G4C2 (sense) targeting ASO BIIB078 (NCT04288856) in over 100 C9orf72 ALS patients was terminated (https://investors.biogen.com/news-releases/news-release-details/biogen-and-ionis-announce-topline-phase-1-study-results) due to neurotoxicity and a lack of clinical efficacy, despite a robust BIIB078 initiated reduction in G4C2 sense encoded DPRs PolyGA and PolyGP in patient CSF. Similarly, Wave Pharmaceuticals terminated their C9orf72 ASO trial, which also targeted the sense strand, due to lack of efficacy (https://www.thepharmaletter.com/article/wave-life-sciences-ends-wve-004-program). Importantly, these G4C2 sense strand targeting ASO therapies have no known effect on the G2C4 antisense RNA or its DPR products. While ASOs targeting G4C2 sense repeat RNA can partially reduce G4C2 linked DPR pathology [9, 14, 17, 24], the therapeutic potential of targeting the G2C4 antisense repeat RNA is completely unknown in human systems. As such, an understanding of the G2C4 repeat RNA elicited toxicity is critically needed.

In this brief report, we utilize iPSNs to demonstrate that G2C4 but not G4C2 repeat RNA expression is sufficient to induce a loss of nuclear TDP-43 function in human spinal neurons. Moreover, using antisense oligonucleotides that specifically target G4C2 or G2C4 repeat RNAs, we find that reduction of antisense but not sense repeat RNA restores TDP-43 function in authentic C9orf72 ALS/FTD patient iPSNs expressing endogenous levels of the C9orf72 repeat expansion. Together, our data suggest that therapeutic targeting of G2C4 antisense repeat RNA may be beneficial for restoring TDP-43 function in C9orf72 ALS/FTD.

Materials and methods

iPSC derived neuronal differentiation

C9orf72 and non-neurological control iPSC lines were obtained from the Answer ALS repository [3] at Cedars-Sinai (see Supplemental Table 1 for demographics) and maintained and differentiated into spinal neurons using a modified version of the direct induced motor neuron (diMNs) protocol recently described in detail [2]. All cells were maintained at 37 °C with 5% CO2. iPSCs and iPSNs routinely tested negative for mycoplasma.

ASO treatment of iPSNs

Scrambled ASO (676,630): CCTATAGGACTATCCAGGAA, G4C2 ASO (619,251): CAGGCTGCGGTTGTTTCCCT, and G2C4 ASO (813,214): TCTCATTTCTCTGACCGAAG were generously provided by Ionis Pharmaceuticals. On day 46 of differentiation, ASOs were added to iPSN culture media at a final concentration of 5 μM. On day 49, media was exchanged for fresh stage 3 iPSN culture media and media was subsequently exchanged every 2–3 additional days without ASO until experiments performed at indicated time points.

DNA constructs

pcDNA3.1( +) containing 108 sense G4C2 RNA only repeats was a kind gift from Adrian Isaacs [33]. To generate an antisense G2C4 RNA only repeat construct, 108 sense G4C2 RNA only repeats were digested out of the pcDNA3.1( +) 108 RNA only repeat construct with BamHI and XbaI and inserted in an antisense orientation into empty pcDNA3.1( +) that had been digested with NheI and BamHI. One repeat unit was lost during cloning, resulting in a 107 antisense G2C4 RNA only repeat construct. Repeat size was confirmed using sequencing with dGTP (Source Bioscience). Sequences are available on request.

Expression of repeat RNAs

On day 18 of differentiation, control iPSNs were dissociated with accutase and 5 × 106 iPSNs were transfected with 4 μg G4C2 and G2C4 repeat RNA only plasmids in suspension with the Lonza 4D nucleofection system as previously described [9]. qRT-PCR and immunostaining and confocal imaging were carried out on day 32 as detailed below.

qRT-PCR

iPSNs were harvested in 1 × DPBS with calcium and magnesium and pelleted using a microcentrifuge. 350 μL RLT Buffer was added to iPSN pellets and RNA was isolated using the RNeasy kit (QIAGEN). RNA concentrations were determined using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). For detection of G4C2 and G2C4 repeat containing transcripts, 1 μg RNA was used for cDNA synthesis using gene specific primers and the Superscript IV First-Strand cDNA Synthesis System (Thermo Fisher Scientific). For detection of TDP-43 mRNA targets, 1 μg RNA was used for cDNA synthesis using random hexamers and the Superscript IV First-Strand cDNA Synthesis System (Thermo Fisher Scientific). All qRT-qPCR reactions were carried out using SYBR Green Master Mix or TaqMan Gene Expression Master Mix (Thermo Fisher) and an Applied Biosystems QuantStudio 3 (Applied Biosystems). Previously described primer/probe sets (see Supplemental Table 2 for sequences) [24] were used to detect G4C2 and G2C4 repeat containing transcripts. Previously described primer sets (see Supplemental Table 2 for sequences) [30, 32, 40, 43] were used to detect truncated STMN2 and cryptic exon containing mRNA transcripts. TaqMan Gene Expression Assays (see Supplemental Table 2 for probe information) were used to detect mRNA targets. GAPDH was used for normalization of gene expression.

Immunostaining and confocal imaging

iPSNs were re-plated using accutase dissociation in Matrigel coated 24 well optical bottom dishes (Cellvis) 3 days prior to fixation. iPSNs were fixed in 4% PFA for 15 min, washed 3X 10 min with 1X PBS, permeabilized for 15 min with 1X PBST containing 0.1% Triton X-100, blocked for 30 min in 10% normal goat serum diluted in 1X PBS, and incubated in primary antibody solution (Rabbit Anti-TDP-43 (Proteintech 10,782–2-AP), Guinea Pig Anti-Map2 (Synaptic Systems 188,004) for 2 h at room temperature. iPSNs were then washed 3X 10 min with 1X PBS, incubated in secondary antibody (Thermo Fisher Scientific; Goat Anti-Rabbit Alexa 488; Goat Anti-Guinea Pig 647) for 1 h at room temperature, washed 2X 10 min in 1X PBS, incubated for 10 min with Hoescht diluted 1:1000 in 1X PBS, and washed 2X 10 min in 1X PBS. iPSNs were mounted using Prolong Gold Antifade Reagent. iPSNs were imaged using a Zeiss LSM 980 confocal microscope using identical imaging parameters for each well and image. Images presented are maximum intensity projections generated in Zeiss Zen Blue 2.3. Nuclear to cytoplasmic ratios of TDP-43 were calculated as previously described [2, 8, 9].

Immunoprecipitation

On day 32 of differentiation, iPSNs were rinsed in 1 × PBS and lysed in 1 mL IP buffer (IP lysis buffer (Thermo Fisher Scientific), 1 × protease inhibitor cocktail (Roche), 0.4 U/μL RNasin Plus (Promega)) by scraping with a cell scraper, transferring to an Eppendorf tube, and vortexing for 30–45 s. iPSN lysates were centrifuged for 10 min at 2500 rpm and 4 °C to remove debris. Following centrifugation, the supernatant was transferred to a clean Eppendorf tube. 25 μL of the supernatant was added to 25 μL 2X Laemmli buffer (BioRad) and set aside as protein input and an additional 25 μL supernatant was set aside on ice as RNA input. The remainder of the lysate was split equally between Eppendorf tubes containing 10 μg Rabbit IgG Isotype Control (Thermo Fisher) and Rabbit Anti-TDP-43 (ProteinTech) antibody. Lysates were incubated with antibody with end over end rotation for 2 h at 4 °C. After 2 h, Magnetic Dyna-beads Protein G were washed with IP lysis buffer and 50 μL resuspended bead solution was added to each tube of antibody/lysate solution. Lysate-antibody-bead solutions were incubated with end over end rotation for 2 h at 4 °C. 25 μL of the unbound supernatant was collected and added to 25 μL 2 × Laemmli buffer for western blot analysis. The remainder of the unbound supernatant was discarded and immunoprecipitated complexes were washed 3X 5 min in 200 μL IP buffer with end over end rotation at 4 °C. Bead—IP complexes were resuspended in 200 μL IP buffer. 100 μL of each bead – IP complex sample was set aside for RNA analysis. For the remaining 100 μL, the supernatant was discarded and 50 μL 1X Laemmli buffer was added to bead – IP complexes. All RNA samples (including input) were added to 500 μL RLT Buffer (QIAGEN) and RNA isolation, cDNA synthesis, and qRT-PCR were performed as described above.

Western blot

Following immunoprecipitation, samples were heated at 100 °C for 5 min, and equal volumes of each sample (12.5 μL) were loaded in 4–20% acrylamide gels (BioRad). Gels were run until the dye front reached the bottom. Protein was transferred onto a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (BioRad). Blots were blocked for 30 min with 5% nonfat milk in 1 × TBST (0.1% Tween-20) and incubated overnight at 4 °C with Mouse Anti-TDP-43 (ProteinTech) primary antibody diluted in block. The next day, blots were washed 3 × 10 min with 1 × TBST and probed with Horse Anti-Mouse IgG HRP (Cell Signaling) secondary antibody diluted in block for 1 h at room temperature. Blots were then washed 3 × 10 min with 1 × TBST and ECL substrate (Thermo Fisher Scientific) was applied for 30 s. Chemiluminescent images were acquired with the GE Healthcare ImageQuant LAS 4000 system.

Glutamate toxicity

Glutamate induced neuronal death assays were carried out as recently described [2]. Briefly, iPSN media was exchanged for artificial CSF (ASCF, Tocris) containing 0 or 10 μM glutamate. For Alamar Blue cell viability assays, Alamar Blue reagent was added at this time. For propidium iodide (PI) based cell death assays, 1 μM PI and one drop of NucBlue live ready probes was added to ACSF/glutamate for the final 30 min of the 4 h incubation. As previously described [2, 8, 9], after 4 h of incubation with ACSF/glutamate, PI assays were imaged on a Zeiss LSM 980 confocal microscope in an environmentally controlled chamber. 10 images per well were captured with a 20X objective and the number of PI and DAPI spots were counted in FIJI. For Alamar Blue assays, plates were evaluated according to manufacturer protocol.

Statistical analysis

All image analysis was either completely automated or blinded. Statistical analyses were performed using GraphPad Prism version 9 (GraphPad). For imaging-based experiments (e.g. TDP-43 immunostaining), the average values for all cells analyzed per iPSC line represent n = 1. The total number of cells evaluated per experiment is indicated in the figure legends. One-way or Two-way ANOVA with Tukey’s multiple comparison test was used as described in figure legends. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Violin plots are used to display the full spread and variability of data within imaging analysis of iPSNs. The center dotted line indicates the median value. Two additional dotted lines indicate the 25th and 75th percentiles. Bar graphs with individual data points representing each iPSC line are used to display data obtained from all other assays and as detailed in figure legends.

Results

Expression of G2C4 (antisense), but not G4C2 (sense) repeat RNA is sufficient to induce molecular hallmarks of TDP-43 loss of function in iPSNs

Nuclear clearance and cytoplasmic mislocalization and aggregation of the RNA binding protein TDP-43 are pathological hallmarks of ALS and related neurodegenerative diseases [44, 45]. It is thought that nuclear loss of TDP-43 function is an early and significant contributor to neurodegenerative disease pathogenesis [4, 21, 23, 28, 30, 32, 37, 43] perhaps even prior to overt detection of cytoplasmic mislocalization. Moreover, histology studies in postmortem human CNS tissues have suggested that nuclear loss of TDP-43 precedes cytoplasmic aggregation [45]. Consistent with the hypothesis that nuclear loss of TDP-43 function precedes cytoplasmic aggregation, studies in C9orf72 iPSNs have demonstrated the emergence of a molecular signature of TDP-43 dysfunction prior to overt nuclear clearance and cytoplasmic mislocalization [8, 9]. Interestingly, prior analyses have reported that TDP-43 pathology is more prevalent in CNS cells with G2C4 repeat RNA foci compared to those with G4C2 foci [1, 7]. Thus, we hypothesized that G2C4 repeat RNA itself may contribute to TDP-43 loss of function observed in C9orf72 ALS/FTD.

To address the contribution of G2C4 repeat RNA to TDP-43 dysfunction and mislocalization in human neurons, we first utilized repeat RNA-only constructs previously demonstrated to produce G4C2 and G2C4 repeat RNA but not DPRs [33, 35] and generated an additional long G2C4 repeat construct capable of expression in mammalian cells. Recent studies have identified a number of reliable gene expression and RNA processing changes that occur following artificial TDP-43 depletion in human neurons [4, 23, 43]. We have recently demonstrated that a panel of these RNA targets and associated splicing alterations can be employed as a robust measure of TDP-43 functionality in C9orf72 ALS/FTD and sALS iPSNs [2, 8]. Using qRT-PCR to evaluate the expression of multiple TDP-43 mRNA targets, we observe a significant molecular hallmark of TDP-43 dysfunction, including altered gene expression (Fig. 1) and the emergence of multiple cryptic exon containing mRNA species (Fig. 2), following the expression of G4C2 and G2C4 repeat RNA-only constructs in otherwise wildtype iPSNs. In addition, immunostaining and confocal imaging revealed a small but statistically significant number of G2C4, but not G4C2 expressing neurons that contained observable new cytoplasmic TDP-43 immunoreactivity (Supplemental Fig. 1). However, we note that this cytoplasmic signal was minimal suggesting that TDP-43 nuclear function may be impacted prior to overt histological mislocalization. Although only detectable in a small percentage of cells, this is consistent with prior studies where TDP-43 pathology (e.g. nuclear depletion and/or cytoplasmic aggregation) is only observed in a handful of cells in CNS autopsy tissues [25, 36]. Notably, we did not detect TDP-43 aggregation in G2C4 or G4C2 expressing iPSNs (Supplemental Fig. 1) consistent with prior reports from our group and others that cytoplasmic aggregation of TDP-43 does not occur in the majority of iPSN models of C9orf72 disease despite subtle cytoplasmic mislocalization [9, 14, 19, 47, 48]. Although expression of either G4C2 and G2C4 led to increased susceptibility to glutamate induced neuronal death (Supplemental Fig. 2), our data demonstrate that G2C4 repeat RNA expression is sufficient to induce TDP-43 dysfunction in human neurons and suggest that perhaps our prior observations of molecular hallmarks of TDP-43 loss of function in endogenous C9orf72 iPSNs [8] could be predominantly linked to endogenous antisense G2C4 and not G4C2 repeat RNA expression.

Fig. 1.

Fig. 1

Open in a new tab

G2C4 antisense repeat RNA expression triggers gene expression changes linked to TDP-43 dysfunction in iPSNs. a–h qRT-PCR for ELAVL3 (a), PFKP (b), RCAN1 (c), and SELPLG (d), STMN2 (e), UNC13A (f), ACTIN (g), and POM121 (h) mRNA in control iPSNs 2 weeks following expression of G4C2 or G2C4 repeat RNA only plasmids. GAPDH was used for normalization. ACTIN and POM121 were used as negative control mRNAs not known to be regulated by TDP-43. n = 3 control iPSC lines. One-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. *p < 0.05, **p < 0.01

Fig. 2.

Fig. 2

Open in a new tab

G2C4 antisense repeat RNA expression triggers splicing alterations linked to TDP-43 dysfunction in iPSNs. a–l qRT-PCR for ACTL6B cryptic exon containing (a), ARHGAP32 cryptic exon containing (b), CAMK2B cryptic exon containing (c), CDK7 cryptic exon containing (d), DNM1 cryptic exon containing (e), HDGFL2 cryptic exon containing (f), MYO18A cryptic exon containing (g), NUP188 cryptic exon containing (h), POLDIP3 cryptic exon containing (i), SYT7 cryptic exon containing (j), truncated STMN2 (k), and UNC13A cryptic exon containing mRNA in control iPSNs 2 weeks following expression of G4C2 or G2C4 repeat RNA only plasmids. GAPDH was used for normalization. n = 3 control iPSC lines. One-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. *p < 0.05, **p < 0.01, ***p < 0.001

Treatment with G2C4, but not G4C2, targeting ASOs reverses molecular hallmarks of TDP-43 loss of function in C9orf72 patient iPSNs

In C9orf72 neurodegeneration, ASOs have previously been employed to induce the highly selective degradation of C9orf72 mRNA or G4C2 repeat RNA [14, 22, 24]. To facilitate the study of sense vs antisense repeat RNA toxicity in iPSNs expressing endogenous levels of the C9orf72 HRE, ASOs were designed to selectively target G4C2 (S-ASO) or G2C4 (AS-ASO) repeat containing RNAs. To test the efficacy of these ASOs in the selective degradation of G4C2 or G2C4 repeat RNA, we performed qRT-PCR for G4C2 or G2C4 repeat RNA in C9orf72 iPSC derived spinal neurons following 5, 10, 15, and 20 days of treatment with ASOs. We observed a significant strand specific decrease in G4C2 and G2C4 repeat RNA expression as early as 5 days after treatment (Supplemental Fig. 3), an observation that is supported by prior reports that G4C2 repeat RNA knockdown happens significantly faster than DPR reduction [9, 14, 17]. Consistent with this notion, we recently established that 5 day treatment with ASOs targeting G4C2 sense repeat RNA has no impact on Poly(GP) levels [9]. Important for evaluation of biological specificity, the G4C2 targeting ASO had no impact on G2C4 expression and the ASO targeting G2C4 containing RNA had no impact on G4C2 expression (Supplemental Fig. 3).

Having observed specificity for G4C2 and G2C4 repeat RNA targeting ASOs, we next asked whether repeat RNA strand specific ASO treatment could alleviate disease pathophysiology, namely TDP-43 dysfunction, in human iPSNs derived from multiple C9orf72 patients. Although we have previously reported that G4C2 repeat RNA ASO treatment can prevent cytotoxicity in C9orf72 iPSNs [9, 14], importantly for this study we elected to initiate ASO treatment after the emergence of TDP-43 dysfunction, reminiscent of clinical treatment paradigms. To determine whether G4C2 and G2C4 targeting ASO treatment could restore TDP-43 function, we performed qRT-PCR for a panel of TDP-43 mRNA targets in C9orf72 iPSNs treated with strand specific ASOs for 5, 10, 15, and 20 days. In doing so, we found that 5 and 10 day treatment with either G4C2 or G2C4 repeat RNA targeting ASOs was not sufficient to repair TDP-43 function (Supplemental Figs. 4–7). In contrast, consistent with a time-dependent therapeutic efficacy, 15 and 20 day treatment with G2C4 antisense, but not G4C2 sense, repeat RNA targeting ASOs was sufficient to restore the expression and splicing of TDP-43 mRNA targets (Figs. 3–4, Supplemental Figs. 8–9) thereby alleviating TDP-43 dysfunction. We also observed a significant reduction in the percentage of C9orf72 iPSNs with observable cytoplasmic TDP-43 immunoreactivity following 20 days of treatment with G2C4 but not G4C2 repeat RNA targeting ASOs (Supplemental Fig. 10). Again, consistent with prior reports [9, 14, 19, 25, 36, 47, 48], the percentage of neurons with detectable cytoplasmic TDP-43 immunoreactivity was low and we did not observe cytoplasmic TDP-43 puncta of aggregates (Supplemental Fig. 10). Moreover, despite our data that only treatment with G2C4 repeat RNA targeting ASOs repairs TDP-43 function (Figs. 3–4, Supplemental Figs. 8–9), both G4C2 and G2C4 repeat RNA targeting ASOs alleviated C9orf72 neuronal death in response to glutamate stress (Supplemental Fig. 11). Interestingly, using immunoprecipitations for TDP-43 followed by qRT-PCR for repeat RNAs, we found that that G2C4 antisense, but not G4C2 sense, repeat RNA is enriched in TDP-43 complexes in C9orf72 patient iPSNs (Supplemental Fig. 12) further underscoring the relationship between G2C4 antisense repeat RNA and TDP-43 in C9orf72 ALS/FTD pathogenesis.

Fig. 3.

Fig. 3

Open in a new tab

Treatment with G2C4, but not G4C2, targeting ASO for 20 days reverses gene expression changes associated with TDP-43 dysfunction in C9orf72 patient iPSNs. a–h qRT-PCR for ELAVL3 (a), PFKP (b), RCAN1 (c), and SELPLG (d), STMN2 (e), UNC13A (f), ACTIN (g), and POM121 (h) mRNA in control and C9orf72 iPSNs 20 days following a single dose of scrambled or repeat targeting ASO. GAPDH was used for normalization. ACTIN and POM121 were used as negative control mRNAs not known to be regulated by TDP-43. n = 3 control and 3 C9orf72 iPSC lines. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Fig. 4.

Fig. 4

Open in a new tab

Treatment with G2C4, but not G4C2, targeting ASO for 20 days reverses splicing alterations associated with TDP-43 dysfunction in C9orf72 patient iPSNs. a–l qRT-PCR for ACTL6B cryptic exon containing (a), ARHGAP32 cryptic exon containing (b), CAMK2B cryptic exon containing (c), CDK7 cryptic exon containing (d), DNM1 cryptic exon containing (e), HDGFL2 cryptic exon containing (f), MYO18A cryptic exon containing (g), NUP188 cryptic exon containing (h), POLDIP3 cryptic exon containing (i), SYT7 cryptic exon containing (j), truncated STMN2 (k), and UNC13A cryptic exon containing mRNA in control and C9orf72 iPSNs 20 days following a single dose of scrambled or repeat targeting ASO. GAPDH was used for normalization. n = 3 control and 3 C9orf72 iPSC lines. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. ***p < 0.001, ****p < 0.0001

We next tested the hypothesis that combined treatment with G4C2 and G2C4 repeat RNA targeting ASOs might enhance the therapeutic benefit of G2C4 repeat RNA targeting ASO treatment alone, at least in regard to TDP-43 functionality. Importantly, the efficacy of repeat RNA knockdown was essentially unchanged following simultaneous treatment with both repeat RNA targeting ASOs (Supplemental Fig. 13). Using qRT-PCR, we did not observe an increased benefit of TDP-43 function restoration upon simultaneous treatment with G4C2 and G2C4 targeting ASOs compared to G2C4 targeting ASOs alone (Figs. 5–6). Additionally, simultaneous treatment with G4C2 and G2C4 targeting ASOs provided no additional protection against glutamate-induced neuronal death in C9orf72 patient iPSNs compared to either ASO alone (Supplemental Fig. 14). These data suggest that there is no added benefit of targeting both sense and antisense C9orf72 repeat RNAs to alleviate TDP-43 dysfunction in human neurons.

Fig. 5.

Fig. 5

Open in a new tab

Simultaneous treatment with G4C2 and G2C4 repeat RNA targeting ASOs does not provide additional reversal of gene expression changes associated with TDP-43 dysfunction. a–h qRT-PCR for ELAVL3 (a), PFKP (b), RCAN1 (c), and SELPLG (d), STMN2 (e), UNC13A (f), ACTIN (g), and POM121 (h) mRNA in in control and C9orf72 iPSNs 15 days following 5 μM dosing with a combination of scrambled, G4C2, and G2C4 repeat RNA targeting ASOs. GAPDH was used for normalization. ACTIN and POM121 were used as negative control mRNAs not known to be regulated by TDP-43. n = 4 control and 4 C9orf72 iPSC lines. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. *p < 0.05, **p < 0.01, ****p < 0.0001

Fig. 6.

Fig. 6

Open in a new tab

Simultaneous treatment with G4C2 and G2C4 repeat RNA targeting ASOs does not provide additional reversal of splicing alterations associated with TDP-43 dysfunction. a–l qRT-PCR for ACTL6B cryptic exon containing (a), ARHGAP32 cryptic exon containing (b), CAMK2B cryptic exon containing (c), CDK7 cryptic exon containing (d), DNM1 cryptic exon containing (e), HDGFL2 cryptic exon containing (f), MYO18A cryptic exon containing (g), NUP188 cryptic exon containing (h), POLDIP3 cryptic exon containing (i), SYT7 cryptic exon containing (j), truncated STMN2 (k), and UNC13A cryptic exon containing mRNA in control and C9orf72 iPSNs 15 days following 5 μM dosing with a combination of scrambled, G4C2, and G2C4 repeat RNA targeting ASOs. GAPDH was used for normalization. n = 4 control and 4 C9orf72 iPSC lines. Two-way ANOVA with Tukey’s multiple comparison test was used to calculate statistical significance. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Discussion

Reduced nuclear localization of TDP-43 and corresponding loss of nuclear TDP-43 function is widely regarded as a prominent pathophysiological event contributing to neuronal demise in ALS, FTD, and related neurodegenerative diseases [4, 23, 28, 32, 43]. Current therapeutic strategies in the clinic are aimed at restoring the expression of singular TDP-43 mRNA targets such as STMN2 [23, 32] as opposed to broadly alleviating TDP-43 dysfunction. Further, in the case of C9orf72 ALS/FTD, although G2C4 antisense repeat RNA foci correlate with TDP-43 pathology at end-stage disease [1, 7], little is known regarding the contribution of pathologic C9orf72 repeat RNA species to TDP-43 dysfunction in authentic human neurons. In this brief report, we have demonstrated that G2C4 antisense, but not G4C2 sense, repeat RNA compromises TDP-43 functionality in endogenous C9orf72 human neurons. Although the mechanism by which G2C4 antisense repeat RNA specifically elicits TDP-43 dysfunction remains unknown and will require further future studies, this pathophysiological consequence is consistent with postmortem histological analyses indicating a correlation between G2C4 repeat RNA foci and TDP-43 pathology [1, 7]. Our RNA immunoprecipitation experiments (Supplemental Fig. 12) suggest that TDP-43 may be at least partially sequestered away from it’s multiple RNA targets by G2C4 repeat RNA. Further, our data highlight the possibility that G2C4 repeat RNA induced TDP-43 dysfunction occurs in the absence of and perhaps prior to overt TDP-43 nuclear clearance and mislocalization to the cytoplasm (Figs. 1–2, Supplemental Fig. 1). In fact, complete nuclear clearance and cytoplasmic aggregation of TDP-43 is only observed in a small percentage of CNS cells in C9orf72 patients at autopsy [8, 25, 36], suggesting that more histologically subtle nuclear depletion may be sufficient to induce robust alterations in TDP-43 function as has been demonstrated for STMN2 in patient CNS tissues [32, 37]. We note that we and others have been unable to detect the most well-characterized mouse TDP-43 associated RNA misprocessing event, altered sortilin splicing [38], in C9orf72 BAC [29] or AAV9-(G4C2)149 transgenic mice ([5], unpublished data). These mouse models also do not show histological evidence of actual nuclear TDP-43 clearing typical of sporadic ALS or C9orf72 ALS/FTD ([5, 29], unpublished data). Thus, at the current time, this highlights authentic C9orf72 patient iPSNs as an essential model for evaluating the efficacy of therapeutic strategies in the repair of TDP-43 functionality in the absence of TDP-43 aggregation and accumulation in the cytoplasm in ALS/FTD.

ASOs are now a commonly used therapeutic modality to alter the expression of target genes in neurodegeneration [13, 42]. Prior pre-clinical research in iPSNs and mice has suggested that selective degradation of G4C2 (sense) repeat RNA via ASO may elicit neuroprotection [14, 17, 22, 24, 41]. This led to an international clinical trial. However, this trial, as well as a second using an independent ASO molecule, recently failed for reasons which remain unknown. Notably, in preclinical studies, exposure to ASOs is often short and treatment is often initiated prior to the onset of many disease associated cellular and molecular changes. Additionally, these efforts focused solely on degradation of the G4C2 repeat RNA species. Thus, the failure of these molecules in clinical trials raises the intriguing possibility that the antisense G2C4 repeat RNA species may be pathologically more important than previously appreciated. In this manuscript, we demonstrate that treatment with G2C4, but not G4C2, ASOs after the onset of TDP-43 loss of function associated molecular changes, is sufficient to restore molecular signatures of TDP-43 function (Figs. 3–4, Supplemental Figs. 8–9). Importantly, this is a time dependent phenomenon (Figs. 3–4, Supplemental Figs. 4–9) suggesting that a neuronal “recovery” period is needed following ASO initiated degradation of antisense repeat RNA species. Nonetheless, treatment with either G4C2 or G2C4 repeat RNA targeting ASOs was sufficient to alleviate neuronal death in response to exogenous glutamate stress (Supplemental Fig. 11) suggesting that both repeat RNA species can disrupt neuronal survival perhaps via distinct mechanisms. Therefore, while our molecular studies show that simultaneous treatment with both G4C2 and G2C4 repeat RNA targeting ASOs does not provide additional benefits for TDP-43 function (Figs. 5–6), it may still be important to consider a muti-pronged therapeutic approach in humans.

Importantly, our data illuminate new insights into repeat RNA pathophysiology in C9orf72 ALS/FTD and provide human relevant data suggesting that G2C4 repeat RNA and downstream cellular interactions could be a significant contributor to disease pathogenesis. Collectively, these data suggest that targeting G2C4 antisense repeat RNA may be a viable therapeutic strategy for the restoration of TDP-43 function in ALS/FTD. Further, our data may provide insights into one reason that G4C2 sense stand targeting C9orf72 therapy failed to have clinical efficacy. However, at least for these studies in authentic human C9orf72 ALS/FTD iPSNs, do not support the possibility of a combined sense and antisense repeat RNA targeting ASO therapy at least for the alleviation of TDP-43 dysfunction.

Supplementary Material

Supplement

Acknowledgements

We thank the ALS patients and their families for essential contributions to this research. iPSC lines acquired through the Answer ALS program made this research possible. These and other ALS iPSC lines can be obtained from: https://csbiomfg.com/cellcollection. This work was supported by The Robert Packard Center for ALS Research (ANC), NIH NINDS/NIA R00 NS123242 (ANC), Target ALS IL-2023-C6-L4 (ANC, JDR, and PJN), along with funding from NIH-NINDS, NIH-NIA, Department of Defense, ALS Association, Muscular Dystrophy Association, F Prime, and the Chan Zuckerberg Initiative.

Footnotes

Conflict of interests The authors declare no competing financial interests.

Supplementary Information The online version contains supplementary material available at https://doi.org/10.1007/s00401-023-02652-3.

Data availability

All data and materials are detailed within the main text or the supplementary materials. Requests for materials should be addressed to Alyssa N. Coyne, PhD email: acoyne3@jhmi.edu. ASOs used in this study can be obtained from Ionis Pharmaceuticals (Frank Bennett, PhD email: fbennett@ionisph.com) under a standard research MTA.

References

  • 1.Aladesuyi Arogundade O, Stauffer JE, Saberi S, Diaz-Garcia S, Malik S, Basilim H et al. (2019) Antisense RNA foci are associated with nucleoli and TDP-43 mislocalization in C9orf72-ALS/ FTD: a quantitative study. Acta Neuropathol 137:527–530. 10.1007/s00401-018-01955-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Baskerville V, Rapuri S, Mehlhop E, Coyne AN (2023) SUN1 facilitates CHMP7 nuclear influx and injury cascades in sporadic amyotrophic lateral sclerosis. Brain. 10.1093/brain/awad291 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Baxi EG, Thompson T, Li J, Kaye JA, Lim RG, Wu J et al. (2022) Answer ALS, a large-scale resource for sporadic and familial ALS combining clinical and multi-omics data from induced pluripotent cell lines. Nat Neurosci 25:226–237. 10.1038/s41593-021-01006-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Brown AL, Wilkins OG, Keuss MJ, Hill SE, Zanovello M, Lee WC et al. (2022) TDP-43 loss and ALS-risk SNPs drive mis-splicing and depletion of UNC13A. Nature 603:131–137. 10.1038/s41586-022-04436-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chew J, Cook C, Gendron TF, Jansen-West K, Del Rosso G, Daughrity LM et al. (2019) Aberrant deposition of stress granule-resident proteins linked to C9orf72-associated TDP-43 proteinopathy. Mol Neurodegener 14:9. 10.1186/s13024-019-0310-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Conlon EG, Lu L, Sharma A, Yamazaki T, Tang T, Shneider NA et al. (2016) The C9ORF72 GGG GCC expansion forms RNA G-quadruplex inclusions and sequesters hnRNP H to disrupt splicing in ALS brains. Elife. 10.7554/eLife.17820 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cooper-Knock J, Higginbottom A, Stopford MJ, Highley JR, Ince PG, Wharton SB et al. (2015) Antisense RNA foci in the motor neurons of C9ORF72-ALS patients are associated with TDP-43 proteinopathy. Acta Neuropathol 130:63–75. 10.1007/s00401-015-1429-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Coyne AN, Baskerville V, Zaepfel BL, Dickson DW, Rigo F, Bennett F et al. (2021) Nuclear accumulation of CHMP7 initiates nuclear pore complex injury and subsequent TDP-43 dysfunction in sporadic and familial ALS. Sci Transl Med. 10.1126/scitranslmed.abe1923 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Coyne AN, Zaepfel BL, Hayes L, Fitchman B, Salzberg Y, Luo EC et al. (2020) G(4)C(2) Repeat RNA Initiates a POM121-Mediated Reduction in Specific Nucleoporins in C9orf72 ALS/FTD. Neuron. 10.1016/j.neuron.2020.06.027 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Davidson YS, Barker H, Robinson AC, Thompson JC, Harris J, Troakes C et al. (2014) Brain distribution of dipeptide repeat proteins in frontotemporal lobar degeneration and motor neurone disease associated with expansions in C9ORF72. Acta Neuropathol Commun 2:70. 10.1186/2051-5960-2-70 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.DeJesus-Hernandez M, Finch NA, Wang X, Gendron TF, Bieniek KF, Heckman MG et al. (2017) In-depth clinico-pathological examination of RNA foci in a large cohort of C9ORF72 expansion carriers. Acta Neuropathol 134:255–269. 10.1007/s00401-017-1725-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.DeJesus-Hernandez M, Mackenzie IR, Boeve BF, Boxer AL, Baker M, Rutherford NJ et al. (2011) Expanded GGG GCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS. Neuron 72:245–256. 10.1016/j.neuron.2011.09.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.DeVos SL, Miller TM (2013) Antisense oligonucleotides: treating neurodegeneration at the level of RNA. Neurotherapeutics 10:486–497. 10.1007/s13311-013-0194-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Donnelly CJ, Zhang PW, Pham JT, Haeusler AR, Mistry NA, Vidensky S et al. (2013) RNA toxicity from the ALS/FTD C9ORF72 expansion is mitigated by antisense intervention. Neuron 80:415–428. 10.1016/j.neuron.2013.10.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Freibaum BD, Taylor JP (2017) The Role of Dipeptide Repeats in C9ORF72-Related ALS-FTD. Front Mol Neurosci 10:35. 10.3389/fnmol.2017.00035 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gendron TF, Bieniek KF, Zhang YJ, Jansen-West K, Ash PE, Caulfield T et al. (2013) Antisense transcripts of the expanded C9ORF72 hexanucleotide repeat form nuclear RNA foci and undergo repeat-associated non-ATG translation in c9FTD/ALS. Acta Neuropathol 126:829–844. 10.1007/s00401-013-1192-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Gendron TF, Chew J, Stankowski JN, Hayes LR, Zhang YJ, Prudencio M et al. (2017) Poly(GP) proteins are a useful pharmacodynamic marker for C9ORF72-associated amyotrophic lateral sclerosis. Sci Transl Med. 10.1126/scitranslmed.aai7866 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gitler AD, Tsuiji H (2016) There has been an awakening: Emerging mechanisms of C9orf72 mutations in FTD/ALS. Brain Res 1647:19–29. 10.1016/j.brainres.2016.04.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gleixner AM, Verdone BM, Otte CG, Anderson EN, Ramesh N, Shapiro OR et al. (2022) NUP62 localizes to ALS/FTLD pathological assemblies and contributes to TDP-43 insolubility. Nat Commun 13:3380. 10.1038/s41467-022-31098-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Gupta R, Lan M, Mojsilovic-Petrovic J, Choi WH, Safren N, Barmada S et al. (2017) The Proline/Arginine Dipeptide from Hexanucleotide Repeat Expanded C9ORF72 Inhibits the Proteasome. eNeuro. 10.1523/eneuro.0249-16.2017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Irwin KE, Jasin P, Braunstein KE, Sinha I, Bowden KD, Moghekar A et al. (2023) A fluid biomarker reveals loss of TDP-43 splicing repression in pre-symptomatic ALS. bioRxiv. 10.1101/2023.01.23.525202 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Jiang J, Zhu Q, Gendron TF, Saberi S, McAlonis-Downes M, Seelman A et al. (2016) Gain of Toxicity from ALS/FTD-Linked Repeat Expansions in C9ORF72 Is Alleviated by Antisense Oligonucleotides Targeting GGG GCC -Containing RNAs. Neuron 90:535–550. 10.1016/j.neuron.2016.04.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Klim JR, Williams LA, Limone F, Guerra San Juan I, Davis-Dusenbery BN, Mordes DA et al. (2019) ALS-implicated protein TDP-43 sustains levels of STMN2, a mediator of motor neuron growth and repair. Nat Neurosci 22:167–179. 10.1038/s41593-018-0300-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lagier-Tourenne C, Baughn M, Rigo F, Sun S, Liu P, Li HR et al. (2013) Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration. Proc Natl Acad Sci U S A 110:E4530–4539. 10.1073/pnas.1318835110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lee SM, Asress S, Hales CM, Gearing M, Vizcarra JC, Fournier CN et al. (2019) TDP-43 cytoplasmic inclusion formation is disrupted in C9orf72-associated amyotrophic lateral sclerosis/frontotemporal lobar degeneration. Brain Commun. 10.1093/braincomms/fcz014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lee YB, Chen HJ, Peres JN, Gomez-Deza J, Attig J, Stalekar M et al. (2013) Hexanucleotide repeats in ALS/FTD form length-dependent RNA foci, sequester RNA binding proteins, and are neurotoxic. Cell Rep 5:1178–1186. 10.1016/j.celrep.2013.10.049 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lin Y, Mori E, Kato M, Xiang S, Wu L, Kwon I et al. (2016) Toxic PR Poly-Dipeptides Encoded by the C9orf72 Repeat Expansion Target LC Domain Polymers. Cell 167:789–802.e712. 10.1016/j.cell.2016.10.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ling JP, Pletnikova O, Troncoso JC, Wong PC (2015) TDP-43 repression of nonconserved cryptic exons is compromised in ALS-FTD. Science 349:650–655. 10.1126/science.aab0983 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Liu Y, Pattamatta A, Zu T, Reid T, Bardhi O, Borchelt DR et al. (2016) C9orf72 BAC Mouse Model with Motor Deficits and Neurodegenerative Features of ALS/FTD. Neuron 90:521–534. 10.1016/j.neuron.2016.04.005 [DOI] [PubMed] [Google Scholar]
  • 30.Ma XR, Prudencio M, Koike Y, Vatsavayai SC, Kim G, Harbinski F et al. (2022) TDP-43 represses cryptic exon inclusion in the FTD-ALS gene UNC13A. Nature 603:124–130. 10.1038/s41586-022-04424-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Mackenzie IR, Frick P, Neumann M (2014) The neuropathology associated with repeat expansions in the C9ORF72 gene. Acta Neuropathol 127:347–357. 10.1007/s00401-013-1232-4 [DOI] [PubMed] [Google Scholar]
  • 32.Melamed Z, López-Erauskin J, Baughn MW, Zhang O, Drenner K, Sun Y et al. (2019) Premature polyadenylation-mediated loss of stathmin-2 is a hallmark of TDP-43-dependent neurodegeneration. Nat Neurosci 22:180–190. 10.1038/s41593-018-0293-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Mizielinska S, Gronke S, Niccoli T, Ridler CE, Clayton EL, Devoy A et al. (2014) C9orf72 repeat expansions cause neurodegeneration in Drosophila through arginine-rich proteins. Science 345:1192–1194. 10.1126/science.1256800 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Mizielinska S, Lashley T, Norona FE, Clayton EL, Ridler CE, Fratta P et al. (2013) C9orf72 frontotemporal lobar degeneration is characterised by frequent neuronal sense and antisense RNA foci. Acta Neuropathol 126:845–857. 10.1007/s00401-013-1200-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Moens TG, Mizielinska S, Niccoli T, Mitchell JS, Thoeng A, Ridler CE et al. (2018) Sense and antisense RNA are not toxic in Drosophila models of C9orf72-associated ALS/FTD. Acta Neuropathol 135:445–457. 10.1007/s00401-017-1798-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Nana AL, Sidhu M, Gaus SE, Hwang JL, Li L, Park Y et al. (2019) Neurons selectively targeted in frontotemporal dementia reveal early stage TDP-43 pathobiology. Acta Neuropathol 137:27–46. 10.1007/s00401-018-1942-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Prudencio M, Humphrey J, Pickles S, Brown AL, Hill SE, Kachergus J et al. (2020) Truncated stathmin-2 is a marker of TDP-43 pathology in frontotemporal dementia. J Clin Invest. 10.1172/jci139741 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Prudencio M, Jansen-West KR, Lee WC, Gendron TF, Zhang YJ, Xu YF et al. (2012) Misregulation of human sortilin splicing leads to the generation of a nonfunctional progranulin receptor. Proc Natl Acad Sci U S A 109:21510–21515. 10.1073/pnas.1211577110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Renton AE, Majounie E, Waite A, Simon-Sanchez J, Rollinson S, Gibbs JR et al. (2011) A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron 72:257–268. 10.1016/j.neuron.2011.09.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Roczniak-Ferguson A, Ferguson SM (2019) Pleiotropic requirements for human TDP-43 in the regulation of cell and organelle homeostasis. Life Sci Allian 10.26508/lsa.201900358 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Sareen D, O’Rourke JG, Meera P, Muhammad AK, Grant S, Simpkinson M et al. (2013) Targeting RNA foci in iPSC-derived motor neurons from ALS patients with a C9ORF72 repeat expansion. Sci Transl Med. 10.1126/scitranslmed.3007529 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Schoch KM, Miller TM (2017) Antisense Oligonucleotides: Translation from Mouse Models to Human Neurodegenerative Diseases. Neuron 94:1056–1070. 10.1016/j.neuron.2017.04.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Seddighi S, Qi YA, Brown A-L, Wilkins OG, Bereda C, Belair C et al. (2023) Mis-spliced transcripts generate de novo proteins in TDP-43-related ALS/FTD. bioRxiv. 10.1101/2023.01.23.525149 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Vatsavayai SC, Nana AL, Yokoyama JS, Seeley WW (2019) C9orf72-FTD/ALS pathogenesis: evidence from human neuropathological studies. Acta Neuropathol 137:1–26. 10.1007/s00401-018-1921-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Vatsavayai SC, Yoon SJ, Gardner RC, Gendron TF, Vargas JN, Trujillo A et al. (2016) Timing and significance of pathological features in C9orf72 expansion-associated frontotemporal dementia. Brain 139:3202–3216. 10.1093/brain/aww250 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wen X, Tan W, Westergard T, Krishnamurthy K, Markandaiah SS, Shi Y et al. (2014) Antisense proline-arginine RAN dipeptides linked to C9ORF72-ALS/FTD form toxic nuclear aggregates that initiate in vitro and in vivo neuronal death. Neuron 84:1213–1225. 10.1016/j.neuron.2014.12.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Yuva-Aydemir Y, Almeida S, Krishnan G, Gendron TF, Gao FB (2019) Transcription elongation factor AFF2/FMR2 regulates expression of expanded GGG GCC repeat-containing C9ORF72 allele in ALS/FTD. Nat Commun 10:5466. 10.1038/s41467-019-13477-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Zhang K, Donnelly CJ, Haeusler AR, Grima JC, Machamer JB, Steinwald P et al. (2015) The C9orf72 repeat expansion disrupts nucleocytoplasmic transport. Nature 525:56–61. 10.1038/nature14973 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Zhang YJ, Guo L, Gonzales PK, Gendron TF, Wu Y, Jansen-West K et al. (2019) Heterochromatin anomalies and double-stranded RNA accumulation underlie C9orf72 poly(PR) toxicity. Science. 10.1126/science.aav2606 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplement
NIHMS1961216-supplement-Supplement.pdf (5.9MB, pdf)

Data Availability Statement

All data and materials are detailed within the main text or the supplementary materials. Requests for materials should be addressed to Alyssa N. Coyne, PhD email: acoyne3@jhmi.edu. ASOs used in this study can be obtained from Ionis Pharmaceuticals (Frank Bennett, PhD email: fbennett@ionisph.com) under a standard research MTA.

RESOURCES