The precursor strategy: terminus methoxyoxalamido modifiers for single and multiple functionalization of oligodeoxyribonucleotides

Abstract

Synthesis of new terminus modifiers, bearing, along with a phosphoramidite moiety, one, two or four methoxyoxalamido (MOX) precursor groups, is described. These modifiers are introduced onto the 5′-end of a synthetic oligodeoxyribonucleotide as the last step of an automated synthesis to form the MOX precursor oligonucleotide. The MOX groups are then post-synthetically derivatized with an appropriate primary amine to construct a 5′-modified oligonucleotide. The efficiency and simplicity of the novel modifying strategy were demonstrated in the synthesis of a number of 5′-functionalized oligonucleotides.

INTRODUCTION

Synthetic oligonucleotides bearing various 5′-terminal functionalities are extensively used in molecular biology and diagnostics. Generally, 5′-functionalization of an oligonucleotide can be implemented in two ways. Conventionally, a protected and activated functionality is directly introduced onto the 5′-terminus at the end of solid phase synthesis (1–3). Alternatively, a precursor molecule is first formed by reacting the 5′-hydroxyl group of the assembled oligonucleotide with a heterobifunctional reagent (first modifier) bearing, along with a phosphoramidite moiety, an orthogonal reactive group. The reactive group of the precursor oligonucleotide is then post-synthetically derivatized with an appropriate functional additive (second modifier). The precursor strategy has one obvious advantage: the same parent compound can be used to construct a vast number of differently modified products. This makes the approach especially favorable in scenarios where an optimization process and, thus, a pool of functionalized oligonucleotides is needed. For example, if the performance of a certain functional group depends on the length of a linker connecting this group to the 5′-end of an oligonucleotide, a pool of oligonucleotides varying in the length of the linker will have to be synthesized to select the best performer. The precursor approach will work successfully only if two main demands are fulfilled: (i) the precursor is transformed into the final product with a quantitative, or close to quantitative, yield; (ii) the transformation conditions are non-destructive to the oligonucleotide. It is also desirable that the transformation occur in a relatively short period of time. From the small number of heterobifunctional 5′-modifiers reported in the literature (4–6) the best performer seems to be one with a benzyl thioester reactive group (5). Oligonucleotides bearing a thioester group react rapidly and in high yield with different primary amines to form corresponding conjugates.

Recently we described a new precursor chemistry based on the remarkable reactivity of the methoxyoxalamido (MOX) group towards primary amines, ammonia and the hydroxyl anion (7). Further elaborating this concept and considering the significant interest in 5′-functionalized oligonucleotides, we here report synthesis of a family of 5′-MOX modifiers suitable for single and multiple functionalization of oligodeoxyribonucleotides.

MATERIALS AND METHODS

Dimethyl oxalate, ethanolamine, 3-amino-1-propanol, 6-amino-1-hexanol, trans-4-aminocyclohexanol hydrochloride, tris(2-aminoethyl)amine, 1-(3-aminopropyl)-imidazole, 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU), histamine, 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite and all solvents were purchased from Aldrich (Milwaukee, WI) and were used without further purification. 5′-Amino-5′-deoxythymidine 7 was synthesized according to Bannwarth (8). Dansyl cadaverine was purchased from Molecular Probes (Eugene, OR). Protected nucleoside cyanoethyl phosphoramidites, tetrazole (0.45 M in acetonitrile), 5-ethylthio-1H-tetrazole (0.25 M in acetonitrile), synthesis columns (1 µmol) and all ancillary DNA synthesis reagents were purchased from Glen Research (Sterling, VA).

Thin layer chromatography (TLC) was performed on Kieselgel 60 F₂₅₄ plates (EM Science, Gibbstown, NJ). TLC plates were visualized under shortwave UV light or by heating. Flash column chromatography was performed with 200–400 mesh, 60 Å silica gel (Aldrich). Electrophoretic gels were 1 mm thick 15–20% acrylamide–7 M urea and were run at 400–600 V using TBE buffer. Crude oligonucleotides were loaded as 7 M aqueous urea solutions (1 A₂₆₀/10 µl) at 1–2 A₂₆₀ units/well (12 mm long). The gels were visualized by UV shadowing over a fluorescent TLC plate or by staining with Stains-all dye (Aldrich). Purified oligonucleotides were prepared by cutting out the corresponding bands, extracting them with 0.25 M triethylaminobicarbonate (TEAB) for 3–5 h at room temperature and desalting the oligonucleotide solutions on Sephadex G-25 (NAP-10 columns; Pharmacia, Uppsala, Sweden).

NMR chemical shifts are reported in p.p.m. (δ units) downfield from TMS for ¹H-NMR and from H₃PO₄ for ³¹P-NMR spectra. Spectra were recorded on a Varian XL-300 spectrometer at 300 and 121 MHz, respectively. Electrospray ionization mass spectra (ESI MS) were recorded on a Mariner spectrometry system (PerSeptive Biosystems, Framingham, MA). Samples were dissolved in MeOH/H₂O (1:1). Oligonucleotide samples were first ethanol precipitated from 5 M aqueous ammonium acetate. MALDI mass spectra were recorded on a Voyager-DE mass spectrometer (PerSeptive Biosystems) as described in Smirnov et al. (9). Capillary gel electophoresis was run on a Beckman 5000 P/ACE instrument operated at an applied voltage of 14.1 kV. The column temperature was maintained at 30°C and detection performed at 254 nm. Polyacrylamide gel columns U100P with an effective column length of 40 cm and running buffer TRIS–borate/urea were purchased from Beckman Instruments (Fullerton, CA). The concentration of oligonucleotides was ∼0.3 A₂₆₀ units/ml. Electrokinetic injections were made at an injection voltage of 7 kV for 20 s. Oligodeoxyribonucleotides terminated with MOX modifiers were synthesized on an Applied Biosystems 394 DNA/RNA Synthesizer using the manufacturer’s suggested 1 µmol protocol except that the coupling time was adjusted accordingly for modifier introduction.

2-Methoxyoxalamido-1-ethanol (2a)

To a stirring solution of dimethyl oxalate (47.5 g, 0.4 mol) in methanol (200 ml) a solution of ethanolamine (16.3 ml, 0.37 mol) in methanol (70 ml) was added dropwise over 2 h. The reaction mixture was concentrated to ∼100 ml and ether (300 ml) was added with stirring. The crystals were filtered out and dissolved in a CHCl₃/MeOH mixture (9:1, 200 ml). The solution was filtered through a silica gel layer (3 cm high, 7 cm diameter) and concentrated to dryness. The residue was recrystallized from CH₃CN to yield 40.76 g (75%) of 2a as white crystals. R_f = 0.37 (chloroform:methanol, 8:2); ¹H-NMR (DMSO-d₆) δ 8.73–8.92 (br. t, 1H, NH), 4.70–4.83 (t, 1H, OH), 3.76–3.83 (s, 3H, OCH₃), 3.40–3.53 (q, 2H, CH₂), 3.14–3.28 (q, 2H, CH₂); ESI MS m/z 149.1 (M + H⁺), 295.9 (2M + H⁺), 317.8 (2M + Na⁺); calculated for C₅H₉O₄N, 147.13.

3-Methoxyoxalamido-1-propanol (2b)

2b was prepared from 1b exactly as 2a except that it was purified by flash chromatography (0–10% MeOH in CHCl₃). The yield of 2b (colorless oil) was 88%. R_f = 0.39 (chloroform:methanol, 8:2); ¹H-NMR (DMSO-d₆) δ 8.80–9.05 (br. t, 1H, NH), 4.46–4.58 (t, 1H, OH), 3.75–3.86 (s, 3H, OCH₃), 3.36–3.50 (q, 2H, CH₂), 3.12–3.28 (q, 2H, CH₂), 1.52–1.71 (p, 2H, CH₂); ESI MS m/z 184.9 (M + Na⁺), 200.9 (M + K⁺); calculated for C₆H₁₁O₄N, 161.16.

6-Methoxyoxalamido-1-hexanol (2c)

2c was prepared from 1c exactly as 2a except that it was purified by flash chromatography (0–10% MeOH in CHCl₃). The yield of 2c (white solid) was 82%. R_f = 0.41 (chloroform: methanol, 8:2); ¹H-NMR (DMSO-d₆) δ 8.83–9.04 (br. t, 1H, NH), 4.30–4.40 (t, 1H, OH), 3.75–3.83 (s, 3H, OCH₃), 3.32–3.46 (q, 2H, CH₂), 3.05–3.21 (q, 2H, CH₂), 1.16–1.58 (m, 8H, 4CH₂); ESI MS m/z 227.0 (M + Na⁺), 429.7 (2M + Na⁺); calculated for C₉H₁₇O₄N, 203.24.

2-Methoxyoxalamidoethyl-2-cyanoethyl-N,N-diisopropylphosphoramidite (3a)

The alcohol 2a was phosphitylated using 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite as previously described (10) and purified by flash chromatography (2% Et₃N in ethylacetate:hexane, 2:1) to give 3a as a colorless oil (20%). ³¹P-NMR (CDCl₃) δ 144.2; ESI MS m/z 449.8 (M + Et₃NH⁺), 348.6 (M + H⁺), 370.6 (M + Na⁺); calculated for C₁₄H₂₇O₅N₃P, 347.35.

3-Methoxyoxalamidopropyl-2-cyanoethyl-N,N-diisopropylphosphoramidite (3b)

The alcohol 2b was phosphitylated using 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite as previously described (10) and purified by flash chromatography (2% Et₃N in ethylacetate:hexane, 2:1) to give 3b as a colorless oil (24%). ³¹P-NMR (CDCl₃) δ 144.0; ESI MS m/z 463.9 (M + Et₃NH⁺), 362.7 (M + H⁺), 384.7 (M + Na⁺); calculated for C₁₅H₂₉O₅N₃P, 361.38.

6-Methoxyoxalamidohexyl-2-cyanoethyl-N,N-diisopropylphosphoramidite (3c)

The alcohol 2c was phosphitylated using 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite as previously described (10) and purified by flash chromatography (2% Et₃N in ethylacetate:hexane, 2:1) to give 3c as a colorless oil (32%). ³¹P-NMR (CDCl₃) δ 143.8; ESI MS m/z 505.7 (M + Et₃NH⁺), 404.5 (M + H⁺), 426.5 (M + Na⁺); calculated for C₁₈H₃₅O₅N₃P, 403.46.

trans-4-methoxyoxalamido-1-cyclohexanol (5)

To a stirring solution of dimethyl oxalate (4.72 g, 40 mmol) in methanol (20 ml) a solution of trans-4-aminocyclohexanol hydrochloride (3.03 g, 20 mmol) and Et₃N (5.6 ml, 40 mmol) in methanol (40 ml) was added dropwise over 2 h. The reaction mixture was concentrated to ∼10 ml and ether (100 ml) was added with stirring. The precipitate was filtered out, dissolved in CHCl₃ and purified by flash chromatography (0–10% MeOH in CHCl₃) to yield 3.27 g (81%) of 5 as a white solid. R_f = 0.3 (chloroform:methanol, 9:1); ¹H-NMR (DMSO-d₆) δ 8.67–8.82 (d, 1H, NH), 4.55–4.62 (d, 1H, OH), 3.73–3.80 (s, 3H, OCH₃), 3.44–3.66 (m, 1H, H-4), 3.25–3.44 (m, 1H, H-1), 1.62–1.91 (m, 4H, 2CH₂), 1.08–1.50 (m, 4H, 2CH₂); ESI MS m/z 201.8 (M + H⁺), 223.7 (M + Na⁺), 239.8 (M + K⁺), 424.9 (2M + Na⁺); calculated for C₅H₉O₄N, 201.22.

trans-4-methoxyoxalamidocyclohexyl-2-cyanoethyl-N,N-diisopropylphosphoramidite (6)

The alcohol 5 was phosphitylated using 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite as previously described (10) and purified by flash chromatography (2% Et₃N in CHCl₃) to give 6 as a white solid (82%). ³¹P-NMR (CDCl₃) δ 143.3; ESI MS m/z 503.3 (M + Et₃NH⁺), 402.3 (M + H⁺); calculated for C₁₄H₂₇O₅N₃P, 401.43.

5′-Methoxyoxalamido-5′-deoxythymidine (8)

8 was prepared from 5′-amino-5′-deoxythymidine exactly as 5 except that only 1 equivalent of Et₃N was used. The yield of 8 (white solid) was 94%. R_f = 0.32 (chloroform:methanol, 8:2); ¹H-NMR (DMSO-d₆) δ 11.27–11.37 (s, 1H, HN-3), 9.03–9.19 (t, 1H, COCONH), 7.49–7.54 (s, 1H, H-6), 6.09–6.21 (t, 1H, H-1′), 5.30–5.38 (d, 1H, OH-3′), 4.12–4.26 (m, 1H, H-3′), 3.74–3.93 (m, 4H, H-4′ + OCH₃), 3.28–3.50 (m, 2H, CH₂-5′), 1.95–2.23 (m, 2H, H-2′,2′′), 1.73–1.90 (s, 3H, CH₃-5); ESI MS m/z 349.9 (M + Na⁺); calculated for C₁₃H₁₇O₇N₃, 327.29.

5′-Methoxyoxalamido-5′-deoxythymidine-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (9)

5′-Methoxyoxalamido-5′-deoxythymidine was phosphitylated using 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite as previously described (10) and purified by flash chromatography (2% Et₃N, 20% hexane in ethylacetate) to give 9 as a white solid (89%). ³¹P-NMR (CDCl₃) δ 144.6, 144.3; ESI MS m/z 528.4 (M + H⁺), 550.4 (M + Na⁺); calculated for C₂₂H₃₄O₈N₅P, 527.51.

trans-4-[N,N-di-(2-aminoethyl)-aminoethyl]-amidooxalamido-1-cyclohexanol (10)

To a stirring solution of tris(2-aminoethyl)amine (2.34 ml, 15.6 mmol) in methanol (20 ml) a solution of 5 (1.05 g, 5.2 mmol) in methanol (10 ml) was dropwise added over 1 h. The reaction mixture was concentrated to ∼10 ml and precipitated into ether (200 ml). The precipitate was filtered out, washed with ether (2 × 20 ml) and dried to yield 1.18 g (72%) of 10 as a white solid. R_f = 0.1 (chloroform:methanol, 9:1); ¹H-NMR (DMSO-d₆) δ 8.42–8.55 (d, 1H, NH-4), 3.43–3.65 (m, 1H, H-4), 3.26–3.43 (m, 1H, H-1), 3.12–3.26 (t, 2H, CH₂), 2.30–2.68 (m, 10H, 5CH₂), 1.58–1.92 (m, 4H, 2CH₂), 1.06–1.56 (m, 4H, 2CH₂); ESI MS m/z 316.0 (M + H⁺), 338.0 (M + Na⁺); calculated for C₁₄H₂₉O₃N₅, 315.41.

trans-4-[N,N-di-(2-methoxyoxalamidoethyl)-aminoethyl]-amidooxalamido-1-cyclohexanol (11)

To a stirring solution of dimethyl oxalate (1.5 g, 12.7 mmol) in methanol (10 ml) a solution of 10 (1.0 g, 3.17 mmol) and Et₃N (1.76 ml, 12.7 mmol) in methanol (10 ml) was added dropwise over 1 h. The reaction mixture was concentrated, dissolved in CHCl₃ and purified by flash chromatography (0–6% MeOH in CHCl₃) to yield 1.08 g (70%) of 11 as a white solid. R_f = 0.3 (chloroform:methanol, 9:1); ¹H-NMR (DMSO-d₆) δ 8.66–8.82 (t, 2H, 2OCOCONH), 8.50–8.65 (t, 1H, NHCOCO), 8.38–8.50 (d, 1H, NH-4), 4.53–4.62 (d, 1H, OH-1), 3.72–3.85 (s, 6H, 2OCH₃), 3.40–3.64 (m, 1H, H-4), 3.25–3.45 (m, 1H, H-1), 3.08–3.30 (m, 6H, 3CH₂), 2.50–2.70 (m, 6H, 3CH₂), 1.58–1.93 (m, 4H, 2CH₂), 1.05–1.56 (m, 4H, 2CH₂); ESI MS m/z 488.0 (M + H⁺), 510.0 (M + Na⁺) 526.0 (M + K⁺); calculated for C₂₀H₃₃O₉N₅, 487.50.

trans-4-[N,N-di-(2-methoxyoxalamidoethyl)-aminoethyl]-amidooxalamido-1-cyclohexyl-2-cyanoethyl-N,N-diisopropylphosphoramidite (12)

The alcohol 11 was phosphitylated using 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite as previously described (10) and purified by flash chromatography (4% Et₃N in ethylacetate) to give 12 as a colorless oil (70%). ³¹P-NMR (CDCl₃) δ 143.3; ESI MS m/z 789.5 (M + Et₃NH⁺); calculated for C₂₉H₅₀O₁₀N₇P, 687.72.

5′-[N,N-di-(2-methoxyoxalamidoethyl)-aminoethyl]-amidooxalamido-5′-deoxythymidine (13)

To a stirring solution of tris(2-aminoethyl)amine (6.0 ml, 40 mmol) in methanol (100 ml) a solution of 8 (2.62 g, 8.0 mmol) in methanol (20 ml) was added dropwise over 1 h. The reaction mixture was concentrated to ∼20 ml and precipitated into an ether/hexane mixture (1:1, 400 ml). The precipitate was filtered out, washed with hexane (2 × 20 ml) and dried. The solid was taken into a triethylamine/methanol mixture (1:3, 60 ml) and dropwise added to a stirring solution of dimethyl oxalate (5.67 g, 48 mmol) in methanol (20 ml) over 1 h. The reaction mixture was concentrated to ∼20 ml and precipitated into an ether/hexane mixture (1:1, 400 ml). The crude product was purified by flash chromatography (0–15% MeOH in CHCl₃) to yield 3.97 g (81%) of 13 as a white solid. R_f = 0.65 (chloroform:methanol, 8:2); ¹H-NMR (DMSO-d₆) δ 11.27–11.37 (s, 1H, HN-3), 8.81–8.93 (t, 1H, NH), 8.79–8.81 (t, 2H, OCOCONH), 8.57–8.79 (t, 1H, NH), 7.45–7.52 (s, 1H, H-6), 6.08–6.22 (t, 1H, H-1′), 5.32–5.38 (d, 1H, OH-3′), 4.13–4.26 (m, 1H, H-3′), 3.74–3.93 (m, 7H, H-4′+2OCH₃), 3.28–3.43 (m, 2H, CH₂-5′), 3.12–3.28 (q, 6H, 3CH₂), 2.53–2.72 (t, 6H, 3CH₂), 1.95–2.20 (m, 2H, H-2′,2′′), 1.76–1.88 (s, 3H, CH₃-5); ESI MS m/z 614.1 (M + H⁺), 636.0 (M + Na⁺), 652.0 (M + K⁺); calculated for C₂₄H₃₅O₁₂N₇, 613.58.

5′-[N,N-di-(2-methoxyoxalamidoethyl)-aminoethyl]-amidooxalamido-5′-deoxythymidine, 3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (14)

To 13 (900 mg, 1.47 mmol) and tetrazole (103 mg, 1.47 mmol) CH₂Cl₂ (40 ml) and 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite (700 µl, 2.20 mmol) were added. The reaction mixture was stirred overnight, concentrated to ∼10 ml and precipitated into an ether/hexane mixture (1:1, 400 ml). The crude product was purified by flash chromatography (10–20% pyridine in ethylacetate) to give 14 as a white solid (717 mg, 0.88 mmol, 60%). ³¹P-NMR (CDCl₃) δ 145.0, 144.6; ESI MS m/z 814.4 (M + H⁺), 836.4 (M + Na⁺), 915.5 (M + Et₃NH⁺); calculated for C₃₃H₅₂O₁₃N₉P, 813.79.

5′-[N,N-bis-((N,N-di-(2-methoxyoxalamidoethyl)-aminoethyl)-amidooxalamidoethyl)-aminoethylamidooxalamido]-5′-deoxythymidine (15)

To a stirring solution of tris(2-aminoethyl)amine (4.89 ml, 32.6 mmol) in methanol (100 ml) 13 (2.00 g, 3.26 mmol) was portion wise added over 30 min. The reaction mixture was stirred for another 15 min, concentrated to ∼20 ml and precipitated into ether (200 ml). After centrifugation the supernatant was removed and the precipitate was washed with ether (20 ml) and dried. The oily residue was taken into a triethylamine/methanol mixture (1:5, 60 ml) and added dropwise to a stirring solution of dimethyl oxalate (4.62 g, 39 mmol) in methanol (50 ml) over 1 h. The reaction mixture was concentrated to ∼50 ml and precipitated into an ether/hexane mixture (2:1, 300 ml). The crude product was purified by flash chromatography (0–18% MeOH in CHCl₃) to yield 1.73 g (45%) of 15 as a white solid. R_f = 0.5 (chloroform:methanol, 8:2); ¹H-NMR (DMSO-d₆) δ 11.20–11.30 (br. s, 1H, HN-3), 8.82–8.95 (t, 1H, NH), 8.46–8.82 (m, 9H, 9NH), 7.45–7.52 (s, 1H, H-6), 6.08–6.20 (t, 1H, H-1′), 5.30–5.35 (d, 1H, OH-3′), 4.13–4.25 (m, 1H, H-3′), 3.80–3.93 (m, 1H, H-4′), 3.70–3.80 (s, 12H, 4OCH₃), 3.30–3.45 (m, 2H, CH₂-5′), 3.05–3.30 (m, 18H, 9CH₂), 2.53–2.74 (t, 18H, 9CH₂), 1.95–2.20 (m, 2H, H-2′,2′′), 1.76–1.85 (s, 3H, CH₃-5); ESI MS m/z 1186.6 (M + H⁺), 593.7 [(M + 2H⁺)/2], 604.7 [(M + H⁺ + Na⁺)/2]; calculated for C₄₆H₇₁O₂₂N₁₅, 1186.15.

5′-[N,N-bis-((N,N-di-(2-methoxyoxalamidoethyl)-aminoethyl)-amidooxalamidoethyl)-aminoethylamidooxalamido]-5′-deoxythymidine, 3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (16)

To 15 (1.15 g, 0.97 mmol) and tetrazole (120 mg, 1.71 mmol) CH₂Cl₂ (40 ml) and 2-cyanoethyl N,N,N′,N′-tetraisopropylphosphoramidite (1.22 ml, 3.85 mmol) were added. The reaction mixture was stirred for 4 h, diluted with CH₂Cl₂ (60 ml) and extracted with 10% aqueous NaHCO₃. The organic phase was dried (Na₂SO₄), concentrated to ∼10 ml and precipitated into ether (200 ml). The crude product was purified by flash chromatography (pyridine:ethylacetate, 1:2) to give 16 as a white solid (860 mg, 0.62 mmol, 64%). ³¹P-NMR (CDCl₃) δ 149.8, 149.3; ESI MS m/z 1386.6 (M + H⁺), 1408.6 (M + Na⁺), 1424.5 (M + K⁺); calculated for C₅₅H₈₈O₂₃N₁₇P, 1386.38.

Post-synthetic derivatization and deprotection of 5′-MOX precursor oligonucleotides

To a CPG-bound 5′-MOX precursor oligonucleotide (10–20 mg) the corresponding primary amine was added (neat or as a 1–2 M solution in DMF, 30–60 µl). The reaction mixture was vortexed and left at room temperature for 30–60 min. Ethanol amine (30 µl) was added and the reaction mixture was kept at 70°C for 15 min. The reaction mixture was diluted with water (up to 1 ml) and desalted on a Sephadex G-25 NAP-10 column. If needed, the crude oligonucleotide was purified by PAGE.

RESULTS AND DISCUSSION

The efficiency and simplicity of the methoxyoxalamido precursor approach has been demonstrated in the synthesis of 2′-modified oligonucleotides (7,11). It seemed logical, therefore, to bring the advantages of this strategy to 5′-oligonucleotide functionalization. It was also our objective to make terminus MOX modifiers that would be convenient in practical usage.

Synthesis of MOX modifiers

5′-MOX modifiers can be easily prepared in two steps from virtually any molecule containing two functional groups: an aliphatic primary amino group and a hydroxyl group. First, the amino group is transferred into methoxyoxalamido group by treatment with an excess of dimethyl oxalate. During the second step the hydroxyl group is phosphitylated in a standard way. Both steps are robust and proceed in high yield. Furthermore, it should be stressed that the universality of the synthesis allows practical issues such as availability, stability, solubility and ease of handling to be addressed by choosing an appropriate carbon skeleton.

n-Aminoalkyl alcohols [NH₂(CH₂)_nOH] represent the simplest and the most available starting compounds. Hence, it seemed logical to initially prepare linear modifiers 3a–3c having 2, 3 and 6 atoms in the carbon chain (Scheme 1). However, these phosphoramidites were not very stable, although a slight improvement in stability was seen with an increase in the length of the carbon chain. Even at low temperature phosphoramidites 3a–3c undergo Arbuzov rearrangement with formation of phosphonoamidates as judged by ³¹P-NMR and MS analysis. Thus, phosphoramidite 3c, the most stable in the series, was degraded by 50% after storage for 4 months at –20°C. Rather poor stability of 3a–3c during purification by column chromatography allowed only moderate (20–30%) yields. Also, phosphoramidites 3a–3c are oils that makes their handling inconvenient. Due to these unfavorable facts, we considered modifiers 3a–3c unsatisfactory from a practical point of view.

Scheme 1. Synthesis of the linear single MOX modifiers 3a–3c: (i) treatment with dimethyl oxalate; (ii) crystallization; (iii) column chromatography; (iv) phosphitylation.

The cause of the instability of phosphoramidites 3a–3c lies, we think, in the nature of the carbon scaffold. A non-branched carbon chain is probably not rigid or bulky enough to suppress Arbuzov rearrangement. More stable MOX modifiers, we reasoned, could be synthesized from amino alcohols with a rigid cyclic carbon scaffold, more like the ribose ring of standard nucleoside phosphoramidites. trans-4-aminocyclohexanol was considered a good candidate as it is cheap and commercially available as the hydrochloride salt. It was treated with dimethyl oxalate in the presence of triethylamine to give methoxyoxalamido derivative 5 in 81% yield (Scheme 2A). Phosphitylation of 5 afforded modifier 6 in 82% yield. Phosphoramidite 6 indeed turned out to be a stable compound: no degradation was seen after storing at –20°C for >6 months. Importantly, due to rigidity of the cyclohexyl skeleton, amidite 6 appears as a solid at room temperature that simplifies its handling.

Scheme 2. Synthesis of the single MOX modifiers 6 (A) and 9 (B): (i) treatment with dimethyl oxalate; (ii) column chromatography; (iii) phosphitylation.

5′-Amino-5′-deoxythymidine 7 (Scheme 2B) seemed to be another attractive choice as it can be prepared in high yield from readily available and inexpensive thymidine (8). The corresponding phosphoramidite 9 was expected to be as stable as its direct structural analog, 5′-dimethoxytrityl thymidine phosphoramidite. Modifier 9 was synthesized from 7 in 85% overall yield and, indeed, turned out to be a stable solid.

For a number of applications multiply functionalized oligonucleotides are desirable. A simple way to achieve multiplicity from a 5′-MOX oligonucleotide precursor is to employ a second polyfunctional modifier. Thus, treatment with tris(2-aminoethyl)amine would result in the introduction of two amino groups (functional sites) onto the 5′-end. To further increase the degree of multiplicity, however, one would like to have a modifier bearing several reactive groups. With this in mind we have prepared terminus modifiers containing two and four MOX groups.

Alcohols 11 and 13 bearing two methoxyoxalamido groups were prepared from 5 and 8 by splitting the MOX moiety with tris(2-aminoethyl)amine followed by capping the two amino groups formed with dimethyl oxalate (Scheme 3A and B). Conventional phosphitylation of 11 and 13 gave double MOX modifiers 12 and 14 in 70 and 60% yields, respectively. In a same manner quadruple MOX modifier 16 was synthesized from alcohol 13 in 29% overall yield (Scheme 4). Amidites 12, 14 and 16 are all stable compounds and can be stored at –20°C for at least as long as 6 months without noticeable degradation. Phosphoramidite 12 is an oil, while phosphoramidites 14 and 16 are solids.

Scheme 3. Synthesis of the double MOX modifiers 12 (A) and 14 (B): (i) treatment with tris(2-aminoethyl)amine; (ii) precipitation; (iii) treatment with dimethyl oxalate; (iv) column chromatography; (v) phosphitylation.

Scheme 4. Synthesis of the quadruple MOX modifier 16: (i) treatment with tris(2-aminoethyl)amine; (ii) precipitation; (iii) treatment with dimethyl oxalate; (iv)column chromatography; (v) phosphitylation.

Oligonucleotide derivatization

First, the conditions ensuring efficient incorporation of new phosphoramidites onto the 5′-end of an oligonucleotide had to be established. All prepared phosphoramidites are soluble in acetonitrile, a common phosphoramidite solvent in automated oligonucleotide synthesis. The phosphoramidites were used as 0.1 M solutions except for modifier 16, which was used as a 0.2 M solution. To establish an adequate coupling time each MOX modifier was coupled to a CPG-bound 9mer oligothymidine for a fixed period of time. The support was then treated for 5 min with 0.2 M NaOH, which hydrolyzes MOX groups to hydroxyoxalamido groups and cleaves the oligonucleotide from the support. The reaction mixtures were desalted and analyzed by capillary gel electrophoresis (CGE). The results showed that phosphoramidites 3a–3c, 6 and 9 containing one MOX group coupled with an efficiency similar to that of conventional phosphoramidites and, thus, no modifications to a standard coupling cycle are needed. Bulkier double MOX modifiers 12 and 14 showed slightly poorer coupling efficiencies and, to ensure a high yield, a 3 min coupling time should be used. Not surprisingly, the bulkiest quadruple MOX modifier 16 (mol. wt 1386) needed a considerably longer coupling time. Thus, 15 min were needed to reach completion of condensation using tetrazole as the catalyst. The coupling time might be reduced to 10 min if a more powerful catalyst, 5-ethylthio-1H-tetrazole, was utilized. It should be noted that all these data were obtained on an ABI 394 DNA synthesizer at the 1 µmol scale. The optimal coupling times clearly might be different for other DNA synthesizers and scales. The tendency, however, remains the same.

Having established the coupling conditions, we then evaluated the MOX precursor strategy itself. The model 9mer and 10mer oligothymidines were terminated with each of the newly prepared MOX modifiers and the MOX precursor oligonucleotides were further modified with a number of different aliphatic amines. Derivatization with amines typically lasted for 30 min. The reaction mixtures were then diluted with water and left for another 15 min to ensure full cleavage of the succinic anchor. Modified oligothymidines were desalted and analyzed by CGE and ESI MS. The data obtained are summarized in Table 1. The results clearly demonstrate the efficiency of the new modifying strategy. Indeed, in the case of the single MOX modifiers 3a–3c, 6 and 9 the yields of derivatized oligonucleotides were generally decreased by no more than 5% compared to the yields of corresponding unmodified oligonucleotides. This implies that both coupling of the MOX modifier and derivatization of the MOX precursor proceeds with >97% yield. More than 5% drops in yield in some cases (Table 1, entries 5, 16 and 19) were most probably attributable to partial hydrolysis of the MOX precursor due to the relatively high water content of the corresponding amines (no attempts to dry commercial reagents were undertaken). In the case of the double modifiers 12 and 14 the yields were a few percent lower than those observed for the single modifiers. This reflects the increased number of transformations (Table 1, entries 23–27). The quadruple modifier 16 performed extremely well, however, considering that functionalization in this case is, essentially, a five-step process (Table 1, entries 28 and 29).

Table 1. Yields and MS data of the model 5′-modified oligothymidines synthesized through the use of the novel 5′-MOX modifiers.

Entry	Starting oligonucleotide	MOX modifier	Second modifier	Yield (%) (by CGE)	Mol. wt (experimental)	Mol. wt (calculated)
1	(Tp)8T	None	None	91.1	2675.1	2675.7
2	(Tp)9T	None	None	82.4	2978.4	2979.9
3	(Tp)9T	3a	NH2(CH2)2OH	82.2	3217.3	3218.1
4	(Tp)9T	3a	NH2(CH2)2NH2	80.2	3216.8	3217.1
5	(Tp)9T	3a	N(CH2CH2NH2)3	72.1	3302.5	3303.2
6	(Tp)9T	3b	NH2(CH2)2NH2	78.1	3230.7	3231.1
7	(Tp)9T	3b	N(CH2CH2NH2)3	78.2	3316.9	3317.2
8	(Tp)9T	3c	NH2(CH2)2NH2	80.4	3272.9	3273.2
9	(Tp)9T	3c	N(CH2CH2NH2)3	80.2	3356.7	3359.3
10	(Tp)9T	3c	O[(CH2)2O(CH2)3NH2]2	80.9	3430.6	3433.4
11	(Tp)9T	6	NH2(CH2)2OH	81.8	3272.2	3272.2
12	(Tp)9T	6	NH2(CH2)2NH2	81.5	3270.4	3271.2
13	(Tp)9T	6	N(CH2CH2NH2)3	82.5	3357.7	3357.3
14	(Tp)9T	6	O[(CH2)2O(CH2)3NH2]2	77.8	3431.5	3431.4
15	(Tp)9T	6	NH2(CH2)2N(CH3)2	84.5	3299.4	3299.3
16	(Tp)8T	6	NH2(CH2)3Im	81.2	3031.6	3032.1
17	(Tp)8T	9	NH2(CH2)2OH	91.1	3092.1	3094
18	(Tp)8T	9	NH2(CH2)2NH2	90.6	3091.2	3093.1
19	(Tp)8T	9	N(CH2CH2NH2)3	87	3176.8	3179.1
20	(Tp)8T	9	O[(CH2)2O(CH2)3NH2]2	91.4	3250.8	3253.3
21	(Tp)9T	9	NH2(CH2)2NH2	78.8	3397.3	3397.3
22	(Tp)9T	9	N(CH2CH2NH2)3	71.2	3483.7	3483.3
23	(Tp)9T	12	NH2(CH2)2NH2	70.3	3584.9	3586.5
24	(Tp)9T	12	N(CH2CH2NH2)3	63.8	3758.8	3758.7
25	(Tp)9T	12	NH2(CH2)2N(CH3)2	60.1	3641.9	3642.6
26	(Tp)9T	14	NH2(CH2)2NH2	69.7	3711.5	3711.6
27	(Tp)9T	14	N(CH2CH2NH2)3	59.3	3883.8	3883.8
28	(Tp)9T	17	NH2(CH2)2OH	83.1	4040.7	4040
29	(Tp)9T	17	NH2(CH2)3NH2	74.6	4092.8	4092.2

Kinetics of derivatization

Transformation of a methoxyoxalamido group with primary aliphatic amines proceeds very rapidly on the monomer level (7,11). We thought, however, it would be of value to investigate the rate of transformation in a ‘real’ situation, i.e. when a MOX group was attached to an oligonucleotide, particularly to the 5′-terminus. As a secondary modifier we chose to use 1-(3-aminopropyl)-imidazole, which represents, we believe, a moderately reactive amine.

The oligothymidine 9mer was modified with MOX modifier 6 and then treated with a 1 M solution of 1-(3-aminopropyl)-imidazole in DMF for a fixed period of time. Transformation was quenched with aqueous NaOH. The reaction mixtures were desalted and analyzed by CGE. The results showed that derivatization of a MOX group at the oligonucleotide level remains a rapid process: it took only 10 min to bring the transformation to completion with t_1/2 = 1.5–2.0 min.

Practical examples

Having established the conditions for incorporation of novel MOX modifiers and for derivatization of MOX precursor oligonucleotides, synthesis of some more representative 5′-functionalized oligonucleotides, i.e. ones comprising all four natural deoxyribonucleosides, was attempted. Core deoxyribooligonucleotides were synthesized by means of standard solid phase phosphoramidite chemistry, except that dC^Ac-phosphoramidite was substituted for dC^Bz-phosphoramidite. This substitution is necessary to prevent N⁴ side-product formation during functionalization with an amine (12,13).

A T7 primer, d(GTA ATA CGA CTC ACT ATA GGG), was synthesized and then terminated with phosphoramidites 6 and 14 to fabricate MOX precursors. Both precursors were hydrolyzed with aqueous DBU as well as derivatized with 1,3-diaminopropane and spermine. After further treatment with ethanolamine (12), to ensure complete deprotection, modified oligonucleotides were desalted and analyzed by PAGE. As expected, in all cases only one major band was observed, indicating efficient derivatization (Fig. 1, lanes 1–6). The structures of the 5′-modified T7 primers were confirmed by MALDI MS analysis (Table 2, entries 1–6).

Figure 1.

PAGE analysis of the 5′-modified T7 primers. The core oligonucleotide was terminated with phosphoramidites 6 and 14 and then hydrolyzed with aqueous DBU (lanes 1 and 4) and derivatized with 1,3-diaminopropane (lanes 2 and 5) and spermine (lanes 3 and 6).

Table 2. Yields and MS data of the mixed base 5′-modified oligodeoxynucleotides synthesized through the use of 5′-MOX modifiers 6, 14 and 16.

Entry	Core oligonucleotide	MOX modifier	Second modifier	Yield (%) (by PAGE)	Mol. wt (experimental)	Mol. wt (calculated)
1	GTAATACGACTCACTATAGGG	6	OH–	72	6702.8	6703.3
2	GTAATACGACTCACTATAGGG	14	OH–	67	7100.4	7101.6
3	GTAATACGACTCACTATAGGG	6	NH2(CH2)3NH2	65	6758.7	6759.4
4	GTAATACGACTCACTATAGGG	14	NH2(CH2)3NH2	70	7211.6	7213.9
5	GTAATACGACTCACTATAGGG	6	spermine	68	6886.4	6887.6
6	GTAATACGACTCACTATAGGG	14	spermine	67	7467	7470.3
7	ATCGAACACAGGACCT	16	histamine	70	6425	6423.6
8	GTAATACGACTCACTATAGGG	6	dansyl cadaverine	63	7019.2	7020.7

Another example represents the synthesis of an oligonucleotide bearing four imidazole residues on the 5′-terminus. Such an oligonucleotide, we reasoned, would appear to be an effective artificial ribonuclease. The core deoxyoligonucleotide d(ATC GAA CAC AGG ACC T), which is complementary to the loop region of tRNA^Phe, was built up with quadruple modifier 16. The prepared MOX precursor was then functionalized with histamine (2 M solution in DMF, 1 h, room temperature) and then deprotected in the usual way. According to CGE analysis the yield of the functionalized oligonucleotide was 70% (Fig. 2). Its structure was confirmed by ESI MS analysis (Table 2, entry 7). The prepared ribonuclease mimic showed high efficiency and specificity in cleaving target tRNA^Phe. The detailed results of RNA cleavage by this and other histamine-functionalized synthetic oligonucleotides will be reported separately in due time. Thus, the MOX modifying strategy appears to work successfully, at least when relatively small and reactive second modifiers are used.

Figure 2.

CGE analysis of the ribonuclease mimic. The core oligonucleotide was terminated with phosphoramidite 16 and then derivatized with histamine.

Direct modification with a bulkier molecule, for instance a dye molecule, obviously represent a bigger challenge. Amines of relatively high molecular weight should be considerably less reactive. Besides, their solubility in DMF is usually quite limited. To probe this situation the T7 primer terminated with phosphoramidite 6 was treated with a DMF solution of dansyl cadaverine (DC) (mol. wt = 335.5), a dansyl derivative bearing an aliphatic amino group attached through a five member carbon chain. The functionalization was performed at 70°C with 0.3 and 0.1 M DC solutions. To follow the kinetics, aliquots of the reaction mixtures were treated with ethanolamine (to quench derivatization and execute deprotection), desalted and analyzed by PAGE. Incorporation of the dansyl cadaverine residue was evident from fluorescence of the product band in 365 nm UV light. The structure was further confirmed by MALDI MS analysis (Table 2, entry 8). A photograph of the gel and the kinetic curve obtained for 0.3 M DC are shown in Figure 3. Complete functionalization was in this case reached in ∼40 min with t_1/2 = 8–9 min. As expected, derivatization with 0.1 M DC proceeded more slowly (4–5 h to completion; data not shown) but was still clean and in high yield. Thus, the above example demonstrates the potency of the MOX strategy for direct incorporation of a bulky functionality onto synthetic oligonucleotides.

Figure 3.

Direct functionalization with 0.3 M dansyl cadaverine. The core T7 primer was terminated with phosphoramidite 6 and then treated with DC for 5 (lane 3), 10 (lane 4), 20 (lane 5), 30 (lane 6), 60 (lane 7) and 135 (lane 8) min, followed by ethanolamine treatment. Lane 1, hydrolyzed 5′-MOX–T7; lane 2, ethanolamine-treated 5′-MOX–T7. In the middle the kinetic profile of functionalization is shown. On the bottom the structure of the dansyl cadaverine-derivatized T7 primer is shown.

CONCLUSIONS

A number of terminus modifiers suitable for single and multiple functionalization of synthetic oligonucleotides have been synthesized. The approach to synthesis of the modifiers is general and, thus, the practical issues, such as stability, solubility in CH₃CN, ease of handling and availability of a starting material, can be easily addressed. The novel modifiers are heterobifunctional reagents, bearing, along with a phosphoramidite moiety, one or several methoxyoxalamido groups. These groups serve as precursor groups being post-synthetically derivatized with an appropriate primary amine. The synthesized modifiers were successively used in the preparation of different 5′-modified oligonucleotides. Importantly, the novel derivatization strategy allows manufacture of a vast number of functionalized oligonucleotides from the same precursor oligonucleotide. Also, it was demonstrated that direct functionalization of a 5′-MOX precursor oligonucleotide with a bulky second modifier is feasible. The simplicity, flexibility and efficiency of the developed 5′-modifying strategy lead us to believe that it will be a valuable addition to existing techniques.