KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
MCUb (rabbit polyclonal against	custom-made and affinity purified	N/A
mouse MCUb)	from YenZym Antibodies
MCU	Cell Signaling Technology	RRID:AB_2721812
CBARA1/MICU1 (D4P8Q)	Cell Signaling Technology	RRID:AB_2797943
MICU2	Bethyl laboratories	Catalog# A300-BL19212
PDK4	Novus Biologicals	RRID:AB_1625832
phospho-PDHE1α Ser293	Novus Biologicals	Catalog#NB110-93479; RRID:AB_1237282
PDHE1α	Abcam	Catalog#Ab110330; RRID:AB_10858459
phospho-Acetyl-CoA Carboxylase Ser79	Cell Signaling Technology	Catalog#3661S; RRID:AB_330337
Acetyl-CoA Carboxylase	Cell Signaling Technology	Catalog#3662S; RRID:AB_2219400
OXPHOS cocktail	Abcam	Catalog#: ab110413; RRID:AB_2629281
VDAC	Abcam	Catalog#: ab14734; RRID:AB_443084
GAPDH	Fitzgerald	Catalog#: 10R-G109A; RRID:AB_1285808
Myh-7	Developmental Studies Hybridoma Bank	RRID:AB_10572253
Myh-2	Developmental Studies Hybridoma Bank	RRID:AB_2147165
Myh-4	Developmental Studies Hybridoma Bank	RRID:AB_2266724
Laminin	Sigma-Aldrich	Catalog#: L9393; RRID:AB_477163
IRDye® 800CW Goat anti-Rabbit IgG Secondary Antibody	LI-COR Biosciences	Catalog#: 926-32211; RRID:AB_621843
IRDye® 680RD Goat anti-Mouse IgG Secondary Antibody	LI-COR Biosciences	Catalog#: 925-68070; RRID:AB_2651128
Goat anti Mouse IgG2b Secondary Antibody, Alexa Fluor 568	Thermo Fisher Scientific	Catalog#: A21144; RRID:AB_2535780
Goat anti Mouse IgG2b Secondary Antibody, Alexa Fluor 488	Thermo Fisher Scientific	Catalog#: A-21141; RRID:AB_2535778
Goat anti Mouse IgG1 Secondary Antibody, Alexa Fluor 647	Thermo Fisher Scientific	Catalog#: A21240; RRID:AB_2535809
Goat anti-Mouse IgG Secondary Antibody, Alexa Fluor 405	Thermo Fisher Scientific	Catalog#: A-31553; RRID:AB_221604
Bacterial and virus strains
MyoAAV-PDK4	This paper	N/A
MyoAAV-luciferase	This paper	N/A
Chemicals, peptides, and recombinant proteins
RIPA buffer	Sigma-Aldrich	Catalog#: R0278
cOmplete™, Mini Protease Inhibitor Cocktail	Millipore Sigma	Catalog#: 4693124001
PhosSTOP Phosphatase Inhibitor Cocktail Tablets, EASYpack	Roche	Catalog#: 04906837001
TRIzol™ Reagent	Thermo Fisher Scientific	Catalog#: 15596018
SuperScript® III First-Strand Synthesis SuperMix	Thermo Fisher Scientific	Catalog#: 18080400
SsoAdvanced™ Universal SYBR® Green Supermix	Bio-Rad Laboratories	Catalog#: 172-5274
D-Mannitol, ≥98%	Sigma-Aldrich	Catalog#: M4125-100G
Sucrose	Sigma-Aldrich	Catalog#: S9378
HEPES	Sigma-Aldrich	Catalog#: H-3375
EGTA	Millipore Sigma	Catalog#: 324626
Trypsin	Worthington Biochemical Corporation	Catalog#: LS003703
Bovine Serum Albumin	Sigma-Aldrich	Catalog#: A6003-25G
Potassium Chloride	Sigma-Aldrich	Catalog#: P5405-250G
Magnesium Chloride	Fluka	Catalog#: 63065
Potassium Phosphate monobasic	Thermo Fisher Scientific	Catalog#: BP362-500
Seahorse XF DMEM medium	Agilent Technologies	Catalog#: 103575-100
Sodium Pyruvate solution	Cytiva	Catalog#: SH30239.01
L-Malic Acid	Sigma-Aldrich	Catalog#: M-1125
Seahorse XF Palmitate-BSA FAO Substrate	Agilent Technologies	Catalog#: 102720-100
Seahorse XF Glucose Solution	Agilent Technologies	Catalog#: 103577-100
Calcium Green™−5N	Thermo Fisher Scientific	Catalog#: C-3737
Calcium Chloride	Thermo Fisher Scientific	Catalog#: C79-500
Adenosine 5′-diphosphate sodium salt	Sigma-Aldrich	Catalog#: A2754-500MG
Corning Laminin, Mouse	Thermo Fisher Scientific	Catalog#: CB-40232
Sodium Chloride	Thermo Fisher Scientific	Catalog#: BP358-10
10% Buffered Formalin Phosphate	Thermo Fisher Scientific	Catalog#: SF100-4
Igepal CA-630 (NP-40)	Sigma-Aldrich	Catalog#: I8896-100mL
Paraformaldehyde (32%)	Electron Microscopy Sciences	Catalog#: 15714
Critical commercial assays
Calcium Detection Kit	Abcam	Catalog#: ab102505
Seahorse XF Cell Mito Stress Test Kit	Agilent Technologies	Catalog#: 103015-100
Seahorse XF Mito Fuel Flex Test Kit	Agilent Technologies	Catalog#: 103260-100
Pyruvate dehydrogenase (PDH) Enzyme Activity Microplate Assay Kit	Abcam	Catalog#: ab109902
Malonyl coenzyme A ELISA Kit	MyBioSource	Catalog#: MBS705127
Glycogen Assay Kit	Millipore Sigma	Catalog#: MAK016
Triglyceride Assay Kit - Quantification	Abcam	Catalog#: ab65336
Deposited data
Expression Omnibus database	In house (Affymetrix,	GEO: GSE205193
(GSE205193). Wt TA muscle versus Mcufl/fl-Myod-Cre and Mcubfl/fl-Myod-Cre	Clariom S Mouse)
Experimental models: Organisms/strains
Mouse: Myod-Cre, C57BL/6	Previously generated	https://doi.org/10.1016/j.ydbio.2009.05.554
Mouse: Mcubfl/fl, C57BL/6	Previously generated	https://doi.org/10.1161/CIRCRESAHA.119.316369
Mouse: Mcufl/fl—Myod-Cre, C57BL/6	Previously generated	https://doi.org/10.1172/jci.insight.121689
Mouse: Col1a1MCUb, C57BL/6	This paper	N/A
Oligonucleotides
MCU forward: GTGCCCTCTGATGACGTGACGG	Thermo Fisher Scientific	N/A
MCU reverse: ATGACAAGCTTAAAGTCATG	Thermo Fisher Scientific	N/A
MCUb forward: GAAGAGCCAAGTGGAGAGCA	Thermo Fisher Scientific	N/A
MCUb reverse: TTCCGACCGGGCTTCTATTG	Thermo Fisher Scientific	N/A
MICU1 forward: ACACCCTCAAGTCTGGCTTAT	Thermo Fisher Scientific	N/A
MICU1 reverse: TTCCCATCTTTGAAGTGCTTCTT	Thermo Fisher Scientific	N/A
MICU2 forward: TCGGCGCAGAAAAATTATTTGG	Thermo Fisher Scientific	N/A
MICU2 reverse: GTGTCATGTAATACTCTCCGTCG	Thermo Fisher Scientific	N/A
EMRE forward: TCTACACCGTACCGGGCAG	Thermo Fisher Scientific	N/A
EMRE reverse: AGTGTCCCGACATAGAGAAAGG	Thermo Fisher Scientific	N/A
PDK4 forward: AGGGAGGTCGAGCTGTTCTC	Thermo Fisher Scientific	N/A
PDK4 reverse: GGAGTGTTCACTAAGCGGTCA	Thermo Fisher Scientific	N/A
RPL7 forward: GAAGCTCATCTATGAGAAGGC	Thermo Fisher Scientific	N/A
RPL7 reverse: AAGACGAAGGAGCTGCAGAAC	Thermo Fisher Scientific	N/A
PDK4 forward (cloning): ATGAAGGCAGCCCGC	Thermo Fisher Scientific	N/A
PDK4 reverse (cloning): TCACACTGCCAGCTTCT	Thermo Fisher Scientific	N/A
PDK4 forward (infusion): TGGGATTCGAACATCGATATGAAGGCAGCCCGC	Thermo Fisher Scientific	N/A
PDK4 reverse (infusion): ACCCGTAGATCTCTCGAGTCACACTGCCAGCTTCT	Thermo Fisher Scientific	N/A
Software and algorithms
Odyssey CLx Imaging System	LI-COR Biosciences	https://www.licor.com/bio/odyssey-dlx/
GraphPad Prism 9	GraphPad	https://www.graphpad.com/scientific-software/prism/
ImageJ	N/A	https://ImageJ.nih.gov/ij/
NIS Elements	Nikon Instruments Inc.	RRID:SCR_014329
PTI FelixGX	Horiba Scientific	https://www.horiba.com/usa/scientific/products/detail/action/show/Product/pti-felixgx-1652/
Transcriptome Analysis Console	Applied Biosystems, Thermofisher	Software version 4.0.2
iPathwayGuide	Advaita Bioinformatics	Software Version. 1.4.0
Other
Omni Tissue Master 125 Handheld Homogenizer	Omni International, Inc	https://pr.vwr.com/store/product/12377007/omni-tissue-master-125-handheld-homogenizer-omni-international-inc
Seahorse XF Pro Analyzer	Agilent Technologies, Inc.	https://www.agilent.com/en/product/cell-analysis/real-time-cell-metabolic-analysis/xf-analyzers/seahorse-xf-pro-analyzer-1980223
Seahorse XFe24 Analyzer	Agilent Technologies, Inc.	https://www.agilent.com/en/product/cell-analysis/real-time-cell-metabolic-analysis/xf-analyzers/seahorse-xfe24-analyzer-740878
PTI QuantaMaster™ 800	Horiba Scientific	https://www.horiba.com/fileadmin/uploads/Scientific/Fluorescence/Downloads/QM-800.pdf
Nikon A1 confocal Laser Microscope	Nikon Instruments Inc.	RRID:SCR_020318
Olympus BX60 Fluorescent microscope	Olympus Life Science	https://www.olympus-lifescience.com/en/technology/museum/micro/1993_02/
Bio-Rad CFX96 Real-Time PCR Detection System	Bio-Rad	RRID:SCR_018064
Direct Detect® Spectrometer	Millipore Sigma	Catalog#: C134681
Direct Detect® assay-free cards	Millipore Sigma	Catalog#: DDAC00010-8P
Contour Next EZ Blood Glucose Meter	Ascensia Diabetes Care	https://www.ascensiadiabetes.com/products/contour-next-ez/?utm_source=google&utm_medium=cpc&utm_campaign=brand
Bioruptor™ Standard	Diagenode Inc.	Catalog#: UCD-200 TM (1.5 mL)