The first Chinese intellectual developmental disorder, autosomal recessive 57 patient with two novel MBOAT7 variants

Abstract

Background

Intellectual disability (ID) is a con neurodevelopmental disorder in children. The genetic etiology of ID is complex, but more subtypes are defined due to the broad application of next‐generation sequencing.

Methods

Whole‐exome sequencing (WES) and Sanger sequencing was applied in a family with ID.

Results

We report a Chinese 7.5‐year‐old boy, born to non‐consanguineous parents. He showed severe intellectual disability, seizures and autistic features. Two previously unreported variants in MBOAT7, c.669C>G (p.(Tyr223*)) and c.1095C>G (p.(Ser365Arg)) were identified by trio‐WES. His mother is a heterozygous carrier of the c.1095C>G variant. The c.669C>G variant is a de novo variant which was undetected in his parents. By construction of the full‐length cDNA of the patient's MBOAT7, we verified that these two variants were trans‐compound heterozygous variants, which support the genetic etiology of this patient.

Conclusion

This patient is the first Chinese case of intellectual developmental disorder (IDD), autosomal recessive 57 (OMIM:617188) with two unreported MBOAT7 variants.

We here report a Chinese patient with Intellectual Developmental Disorder (IDD), autosomal recessive 57. Two previously unreported mutations in MBOAT7, c.669C>G (p.(Y223*)) and c.1095C>G (p.(S365R)) were identified by trio whole‐exome sequencing. The patient we reported here is the first Han Chinese IDD patient known to be related to MBOAT7 mutation. In addition, this patient is the first case that carried compound heterozygous variants in the MBOAT7 gene, which expands the complexity of this disorder.

1. INTRODUCTION

Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1 in 100 children (Vissers et al., 2016), many individuals with ID also present with other neurological conditions, such as epilepsy, which is 10 times higher in individuals with ID than in the general population (McGrother et al., 2006). De novo, recessive, and dominant variants can contribute to the genetic etiology of ID. With the wide application of whole‐exome sequencing (WES), more subtypes of genetic disorders with ID are being uncovered.

Intellectual developmental disorder (IDD), autosomal recessive 57 (OMIM: 617188), was first reported by Johansen et al (Johansen et al., 2016) in a total of 16 individuals from 6 different consanguineous families with different homozygous variants in the MBOAT7 gene (OMIM: 606048). So far, most of the MBOAT7‐related IDD patients were from the Middle East descent consanguineous families. The patient we reported here is the first Han Chinese ID patient known to be related to MBOAT7 variant. In addition, this patient is the first case that carried compound heterozygous variants in the MBOAT7 gene, which expands the complexity of this disorder.

2. MATERIALS AND METHODS

2.1. Ethical compliance

This study was approved by the ethics committee of Shunyi Maternal and Children's Hospital of Beijing Children's Hospital, Capital Medical University. Written informed consent was obtained in accordance with the declaration of Helsinki.

2.2. Study subjects

The proband was a 7.5‐year‐old boy who presented with hypotonia, development delay, intellectual disability and autistic features. The parents claimed no consanguineous marriage. This boy was their first pregnancy and first birth. Trio‐WES data revealed that the father was the biological father.

2.3. Genetic analysis by WES

Trio‐WES was routinely performed in our laboratory. The Agilent SureSelect Human All ExonV6 Kit (Agilent Technologies, Santa Clara, CA, USA) was used to target the exonic regions of the genome. The Illumina NovaSeq 6000 platform (Illumina Inc., San Diego, CA, USA) was used for genomic DNA sequencing by Novogene Bioinformatics Technology Co., Ltd (Beijing, China) to generate 150 bp paired end reads with a minimum coverage of 20× for ∼95% of the genome (mean coverage of ∼100×). The DNA sequences were analyzed by in‐house quality control software to remove low quality reads and were then aligned to the reference human genome (hs37d5) using the Burrows‐Wheeler Aligner (BWA; Li & Durbin, 2009), and duplicate reads were marked using Sambamba tools (Tarasov et al., 2015). Single nucleotide variants (SNVs) and indels were called by GATK to generate a gVCF file. Trio‐WES revealed two variants in the MBOAT7 gene, c.669C>G (p.(Tyr223*)) and c.1095C>G (p.(Ser365Arg)). The pathogenicity of these two variants was evaluated according to ACMG guidelines (Richards et al., 2015).

2.4. DNA isolation and Sanger sequencing

Blood samples were collected from the patient and his parents, the father's urine and semen were also collected. Leukocytes were separated from the peripheral blood of the patient and his parents by using the red blood cell lysis buffer (Solarbio, China) according to the manufacturer's instruction. Urine was centrifuged at 2000g for 10 min at 4°C, and the precipitate was used for DNA extraction. In order to isolate high‐quality semen genomic DNA, dithiothreitol (DTT) was added into the cell lysis solution at a final concentration of 50 mmol/L. Then DNA was extracted with a DNA extraction kit (TIANGEN, Beijing, China) according to the manufacturer's instruction. PCR amplification of c.669C>G on exon 6 was performed with (forward): 5′‐GCCCGTTCTTCCGCTACCGC‐3′, and (reverse): 5′‐CTGCTGGGGGGTGGGCATTG‐3′, which gave rise to a product of 361 bp. PCR amplification of c.1095C>G on exon 8 was performed with (forward): 5′‐AGCGCCTGGACCATGCTGCT‐3′, and (reverse): 5′‐ GGCTGCCCCCACCTAAAGCC‐3′, which gave rise to a product of 322 bp. In consideration of GC‐rich regions, TaKaRa LA Taq (TaKaRa, Beijing, China) was used for DNA amplification. The amplicons were subject to Sanger sequencing, which is performed by capillary electrophoresis based on the principle of double‐deoxy chain‐termination method in BGI Tech Solutions (Beijing, China).

2.5. RNA extract and plasmid construction

Total RNA from the patient's white blood cells was extracted using a RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instruction. A total of 2 μg RNA was used to synthesize cDNA using the Bio‐Rad transcript cDNA synthesis kit (Bio‐Rad, Hercules, CA, USA). The cDNA was used as the template to amplify MBOAT7 gene (RefSeq NM_024298.5) by nested PCR, the outer primers were (forward) 5′‐AGCTCAGACCATGTCGCCTGAA‐3′ and (reverse) 5′‐TTCAGTTGCAGGCAGGGTATTT‐3′, the inner primers were (forward) 5′‐AAAGGGAAGCTTATGTCGCCTGAAGAA‐3′ and (reverse) 5′‐AAAAAACTCGAGTTACTCCTCCCGGAG‐3′. The inner primers contain protective bases and restriction enzyme cutting sites of Hind3 and Xhol. Then the PCR products were digested and subcloned into the pCMV‐tag3B vector. The vector was transformed into Escherichia coli, 10 monoclones were selected for Sanger sequencing in BGI Tech Solutions (Beijing, China).

2.6. Homology analysis

The human (Homo sapiens) MBOAT7 protein (NP_077274.3) sequence was aligned for analysis of the conservation of the mutated residue (p.(Ser365Arg)) with the sequences of the following homologous proteins: Mus musculus (mouse NP_084210.2), Rattus norvegicus (rat NP_001128450.2), Macaca mulatta (monkey XP_028695116.1), Xenopus tropicalis (frog XP_012822891.2), Canis lupus familiaris (dog XP_003432754.1), and Mirounga leonina (seal XP_034842211.1). Conservation analysis and alignment visualization were performed by NCBI Orthologs (https://www.ncbi.nlm.nih.gov/gene/79143/ortholog/) and Jalview software (Waterhouse et al., 2009). The domains were referred to the annotation of human MBOAT7 protein (Caddeo et al., 2019).

3. RESULTS

3.1. Clinical manifestations

The patient was a 7.5‐year‐old‐ boy. He presented first episode of epilepsy at 6 months after birth, which manifested as binocular gaze, purple lips, but no obvious twitching of limbs, lasting for about several minutes for each episode. Electroencephalogram (EEG) examinations showed epileptoid discharge in rolandic region, bilateral central leads and top leads showed focal and generalized seizures at waking stages (Figure 1a). He was free from seizures from 1 year old to 5.5 years old with anti‐epileptic drug (AED). At 6 years old, after self‐withdrawal of AED for 2 months, his head was knocked on the door accidentally, then had seizures again, which was controlled soon by medications. The most recent brain magnetic resonance imaging (MRI) was performed at 6.5 years of age and revealed T1 and T2 hyper‐intensity in bilateral symmetric globus pallidus and dentate nuclei, which appeared stable compared with the first study at age 6 months (Figure 1b).

FIGURE 1.

Clinical presentations of the proband. (a) Recording the seizures by video EEG. Red frames indicate representative abnormal discharges at waking stages. (b) Serial brain MRI at 6 months old and 6.5 years old revealed T1 and T2 hyper‐intensity in bilateral symmetric globus pallidus and dentate nuclei. (c) Frontal and lateral facial pictures of the proband at 7.5 years of age showed different size of ears between left (L) and right (R).

He was premature birth at 35 weeks with the birth weight 2.3 kg by caesarian section due to oligohydramnios. There was neither newborn asphyxia nor pathologic jaundice. His head was controlled at 7 months of age. He was able to sit independently at 16 months and was walking at 18 months. He could say “mama” and “papa” at 1 year old. But he still could not hop and no meaningful speech at his last examination at the age of 7.5 years old and his fine motor activity was poor. At the time of admission, he presented with global developmental delay, intellectual disability (ID), speech and language delay and cognitive problems. He went to a special school. At the age of 7.5 years old, both his height (122 cm) and weight (20.5 kg) were within normal ranges. He showed only minor unspecific dysmorphic features of being hypertrichosis in the upper arm and dysmorphic ears, which showed differences between left and right (Figure 1c). Routine laboratory tests and metabolic workup, including complete blood count, plasma biochemical tests, plasma amino acids, urinary organic acids and carnitine‐acylcarnitine profiles were normal.

3.2. Identification of two previously unreported MBOAT7 variants

We have identified two variants of MBOAT7 (RefSeq NM_024298.5), c.669C>G (p.(Tyr223*)) and c.1095C>G (p.(Ser365Arg)) in the proband by trio‐WES analysis. The mother was heterozygous with c.1095C>G, while neither c.669C>G nor c.1095C>G variant was detected in the father (Figure 2a). We have verified these variants by Sanger sequencing (Figure 2b). Both variants are previously unreported in the HGMD database (https://www.hgmd.cf.ac.uk/ac/gene.php?gene=MBOAT7, accessed on 10 June 2023). Neither of these two variants have been previously described and reported in the allele frequency databases (ExAc, GnomAD, 1000Genome).

FIGURE 2.

The c.669C>G (p.(Tyr223*)) and c.1095C>G (p.(Ser365Arg)) variants of the MBOAT7 gene (RefSeq NM_024298.5) in a patient with intellectual developmental disorder, autosomal recessive 57. (a) A pedigree of the patient family. The black arrow indicates the proband. (b) Sanger sequencing analysis shows the heterozygous c.669C>G variant in the proband, his parents did not carry this variant. Red arrows show the mutational sites. Sanger sequencing analysis shows the heterozygous c.1095C>G variant in the proband which is inherited from his mother. Red arrows show the mutational sites. (c) Sanger sequencing analysis shows the c.669C>G variant in one clone. (d) Sanger sequencing analysis shows the c.1095C>G variant in one representative clone. (e) Sanger sequencing analysis shows that the father's urine and semen did not have the c.669C>G variant.

3.3. The two MBOAT7 variants are trans alleles

We constructed the pCMV‐tag3B plasmid of the full‐length cDNA of the patient's MBOAT7. In the 10 monoclones, only one clone had the c.669C>G variant (Figure 2d), while all the other 9 clones had the c.1095C>G variant (Figure 2c). There was no any clone that contained both variants. Thus, we determined that these two variants were trans‐compound heterozygous alleles.

3.4. The c.669C>G variant is likely a bona fide novel variant

Clonal sperm mosaicism is an important contributor to “de novo” variant, which are not found in blood samples (Yang et al., 2021). We collected the father's urine and semen to confirm the origin of de novo variant of c.669C>G. We did not detect this variant in these two specimens (Figure 2e). Thus, we speculated that the c.669C>G is likely a de novo variant, although it is possible that the frequency of c.669C>G variant was too low in semen to be detected by Sanger sequencing. According to the ACMG guidelines (Richards et al., 2015), PM2, PVS and PS2 were matched and the variant was scored as “pathogenic”.

3.5. The Ser365 residue is conserved in multiple species

In order to evaluate the pathogenicity of these two variants, we compared the location of these variants in this study and other reported variants of MBOAT7 (Figure 3a, Table 1). Up to now, there are also two other reported missense variants, p.(Glu376Lys) (Yalnizoglu et al., 2019) and p.(Ala353His) (Farne et al., 2020). For the p.(Ala353His), p.(Ser365Arg), p.(Glu376Lys) missense variants, we performed the alignment of MBOAT7 protein sequences from different species (Figure 3b). All these three variants are located in or around the predicted catalytic domain (from Asn321 to His356) of the protein (Caddeo et al., 2019). Homology analysis indicated that the Serine in position 365 is highly conserved through vertebrates and the missense change from Serine to Arginine is predicted as deleterious or damaging by multiple predictors (Polyphen2 = 1.00/1.00; SIFT = 0.0006; Mutation Taster: disease causing; CADD: 27.0). According to the ACMG guidelines (Richards et al., 2015), PM2, PP3 and PP4 were assigned. Considering that this variant locates at certain protein domains which is critical to protein function and there are two other missense variants that have been reported in these domains, PM1 was assigned. Therefore, the p.(Ser365Arg) variant was scored as “likely pathogenic”.

FIGURE 3.

Location of variants and domains in the MBOAT7 gene. (a) Schematic representation of human MBOAT7 gene structure. The two variants reported in this study and other reported variants are depicted by red and black lines, respectively. (b) Multiple sequence alignment of MBOAT7 protein in different species. The red arrow indicates the missense variant in this study, other two reported missense variants are indicated by black arrows. Conservation is visualized on the alignment as a histogram giving the score for each column. Conserved columns are indicated by ‘*’, and columns with variants where all properties are conserved are marked with a ‘+’ (score of 10, indicating all properties are conserved).

TABLE 1.

Twelve previously reported variants of the MBOAT7 gene in 39 patients from 16 families with intellectual developmental disorder, autosomal recessive 57. Our patient is included in the end.

Number of patients	cDNA position	Protein position	Consanguineous or not	Country
11 patients from 4 families	c.758_778del (Johansen et al., 2016; Khan et al., 2019)	p.(Glu253_Ala259del)	YES	Pakistan
1 patient a	c.855‐2A>G (Jacher et al., 2019)	—	NO	Lebanon
4 patients from 1 family	c.251delT (Santos‐Cortez et al., 2018)	p.(Leu84Argfs*225)	YES	Pakistan
3 patients from 1 family	c.1278G>A (Yalnizoglu et al., 2019)	p.(Trp426*)	YES	Turkey
2 patients from 1 family	c.259C>T (Yalnizoglu et al., 2019)	p.(Arg87*)	YES	Turkey
1 patient	c.1126G>A (Yalnizoglu et al., 2019)	p.(Glu376Lys)	YES	Turkey
2 patients from 2 family	c.680_690del (Yalnizoglu et al., 2019)	p.(Leu227Profs*65)	YES	Turkey
3 patients from 1 family	c.126_145del (Johansen et al., 2016)	p.(Leu43Hisfs*69)	YES	Egypt
3 patients from 1 family	c.423delG (Johansen et al., 2016)	p.(Leu142Cysfs*8)	YES	Pakistan
4 patients from 1 family	c.854+1G>C (Johansen et al., 2016)	—	YES	Jordan
4 patients from 1 family	c.820_826del (Johansen et al., 2016)	p.(Gly274Profs*47)	YES	Iraq
1 patient	c.1057_1058delGCinsCA (Farne et al., 2020)	p.(Ala353His)	YES	Italy
1 patient b	c.669C>G	p.(Tyr223*)	NO	China
	c.1095C>G	p.(Ser365Arg)

^a Although there was no reported consanguinity, the parents are from the same village in Lebanon.

^b Patient from this study.

4. DISCUSSION

Intellectual developmental disorder, autosomal recessive 57 (OMIM: 617188), is caused by homozygous variant or compound heterozygous variants in the MBOAT7 gene in an autosomal recessive inheritance. This type of ID is rare and there are 12 variants in the MBOAT7 gene from 39 patients (16 families) that have been reported so far. All of these patients were homozygous variants in the MBOAT7 gene, while most of them were born to consanguineous parents from Pakistan, Turkey, Iraq, and Egypt (Table 1). The patient we reported here is the first Han Chinese patient known to be related to MBOAT7 variant, but his parents are non‐consanguineous marriage. Compare with other patients with homozygous variants, our patient is so far the first case that carried compound heterozygous variants in the MBOAT7 gene with previously unreported c.669C>G (p.(Tyr223*)) and c.1095C>G (p.(Ser365Arg)) variants.

It has previously been reported that rare de novo variants play a major role in severe ID (Hamdan et al., 2014). In our study, we did not detect the c.669C>G (p.(Tyr223*)) variant in the parent's peripheral blood samples, as well as in the father's urine and semen, we speculated that this truncation variation is a de novo variant. By molecular cloning, we found only one clone that had the p.(Tyr223*) variant, while all the other 9 clones carried the p.(Ser365Arg) variant. We speculated that there is nonsense‐mediated mRNA degradation triggered by the p.(Tyr223*) variant, further supporting that this variant is “pathogenic”.

To date, over 1100 genes have been either confirmed or suggestive in ID etiology, yet about half of ID cases remain undiagnosed (Gilissen et al., 2014). In our trio‐WES, due to the existence of a de novo variant (p.(Tyr223*)), it is unknown whether the two alleles are in trans or cis in the proband. Our patient manifested common clinical characteristics of global developmental delay, intellectual disability, speech and language delay, seizures, and hypertrichosis in the upper arm and dysmorphic ears, which are very similar to the reported two patients from one family who carry a homozygous variant of c.854+1G>C in MBOAT7 gene (Johansen et al., 2016). By molecular cloning, we confirmed that these two variants are trans‐compound heterozygous as none of the clones contained both alleles, which supports the diagnosis of intellectual developmental disorder, autosomal recessive 57 in this patient.

The MBOAT7 gene encodes lysophosphatidylinositol acyltransferase 1 (LPIAT1), which is the only enzyme that specifically transfer arachidonic acid from arachidonoyl‐CoA to lysophosphatidylinositol (LPI) and is involved in the re‐acylation of phospholipids in the LANDs cycle. It is anchored to endomembranes by six transmembrane domains (Caddeo et al., 2019). MBOAT7 variant may affect LPIAT1 function, which lead to the accumulation of substrate LPIs and then promote pro‐inflammatory and pro‐fibrotic signaling (Varadharajan et al., 2022). In vitro assays have shown that missense variants in the putative catalytic residues (Asn321Ala, His356Ala) result in the loss of O‐acyltransferase activity (Caddeo et al., 2021). We will explore whether the p.(Ser365Arg) variant results in a loss of LPIAT1 activity, and how the loss of LPIAT1 activity results in the occurrence of phenotypes.

AUTHOR CONTRIBUTIONS

HL and WL designed this study and wrote the manuscript. HL performed the assays and acquired the data. ZQ, LX, and CH analyzed and interpreted the data.

CONFLICT OF INTEREST STATEMENT

There is no interest conflict in this study.

Li, H. , Qi, Z. , Xie, L. , Hao, C. , & Li, W. (2024). The first Chinese intellectual developmental disorder, autosomal recessive 57 patient with two novel MBOAT7 variants. Molecular Genetics & Genomic Medicine, 12, e2391. 10.1002/mgg3.2391

DATA AVAILABILITY STATEMENT

Due to the privacy of the individuals, the original trio‐WES sequencing data are available upon request.