REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Mouse APC anti-human CD43 | BioLegend | cat#343205; RRID: AB_2194072 |
Mouse anti-human Iba1 | Thermo Fisher Scientific | GT10312; cat#MA5-27726; RRID: AB_2735228 |
Alexa Fluor 488 goat anti-mouse | Thermo Fisher Scientific | cat#A-11001; RRID: AB_2534069 |
Rabbit anti-human TMEM119 | Thermo Fisher Scientific | cat#PA5-119902; RRID: AB_2913474 |
Alexa Fluor 594 goat anti-rabbit | Thermo Fisher Scientific | cat#A-11012; RRID: AB_2534079 |
Chemicals, peptides, and recombinant proteins | ||
insulin-transferrin-selenium (100X) | Thermo Fisher Scientific | cat#41400045 |
B27 | Thermo Fisher Scientific | cat#17504044 |
N2 | Thermo Fisher Scientific | cat#17502048 |
glutamax | Thermo Fisher Scientific | cat#35050061 |
non-essential amino acids | Thermo Fisher Scientific | cat#11140050 |
monothioglycerol | Sigma | cat#A8960-5G |
human insulin | Sigma | cat#I2643-50MG |
IL-34 | Peprotech | cat#200-34 |
TGFβ1 | Peprotech | cat#100-21 |
M-CSF | Peprotech | cat#300-25 |
CD200 | Novoprotein | cat#C311 |
CX3CL1 | Peprotech | cat#300-31 |
Poly(ethyleneimine) solution (PEI) | Milipore Sigma | cat#181978-100g |
4% paraformaldehyde | Electron Microscopy Sciences | cat#157-8-100 |
DPBS | Gibco | cat#14190-144 |
Goat serum | Abcam | cat#ab7481 |
Triton-x | Fisher Scientific | cat#AAA16046AE |
NucBlue fixed stain ready probes | Thermo Fisher Scientific | cat#R37606 |
Poly-D-Lysine | Gibco | cat#A38904-10 |
Tris-HCl pH 7.5 | Thermo Fisher Scientific | cat#15567-027 |
NaCl | Fisher | cat#S271-500 |
MgCl2 | Fisher | cat#bp214-500 |
nuclease free H2O | Invitrogen | cat#AM9938 |
NP-40 | Thermo Fisher Scientific | cat#85124 |
Tween-20 | Fisher | cat#bp337-500 |
Digitonin | Promega | cat#G9441 |
Critical commercial assays | ||
hematopoietic kit | STEMdiff | cat#05310 |
Nextera DNA library prep kit | Illumina | cat#FC-121-1030 |
Zymo clean and concentrator kit | Zymo | cat# D4014 |
QuantiFluor® dsDNA System | Promega | cat#E2671 |
NextSeq 500/550 150 bp sequencing kit (v2) | Illumina | cat# 20024907 |
Lonza Human Stem Cell Nucleofector Kit 1 | Lonza | cat#VPH-5012 |
QIAshredder | Qiagen | cat#79654 |
RNeasy isolation kit | Qiagen | cat#74104 |
Takara SMARTer Stranded Total RNA-Seq Kit v3 Pico Input Mammalian | Takara Bio | cat#634485 |
QIAprep Spin Miniprep Kit (250) | Qiagen | cat#27106 |
QIAquick Gel extraction kit | Qiagen | cat# 28704/28706 |
Deposited data | ||
raw and analyzed data | this paper | GEO: GSE245524 |
reanalyzed microglia ATAC-seq and ChIP-seq data | Gosselin et al.11 | dbGAP, accession number: phs001373.v1.p1 |
reanalyzed PLAC-seq data | Nott et al.20 | dbGAP, accession number: phs001373.v2.p1 |
Experimental models: Cell lines | ||
Human iPSCs | ATCC-DYS0100 | cat#ACS-1019; RRID:CVCL_X499 |
Human iPSCs | Synthego | PGP1-SV1 |
Oligonucleotides | ||
Illumina primer 1 AATGATACGGCGACCACCGA |
IDT | N/A |
Illumina primer 2 CAAGCAGAAGACGGCATACGA |
IDT | N/A |
SNCA_guide_1_F caccgGTGAAGGTATCCGTATAATG | this paper | N/A |
SNCA_guide_1_R aaacCATTATACGGATACCTTCACc | this paper | N/A |
SNCA_guide_2_F caccgCAATGACTTTCGGTATACTG | this paper | N/A |
SNCA_guide_2_R aaacCAGTATAccGAAAGTCATTGc | this paper | N/A |
Recombinant DNA | ||
pSpCas9(BB)-2A-GFP (PX458) | Addgene Ran et al.72 |
cat#48138; RRID:Addgene_48138 |
Software and algorithms | ||
Illumina NextSeq Control Software (NCS) v2.0 | Illumina | https://support.illumina.com/sequencing/sequencing_instruments/nextseq-500/downloads.html |
Illumina Bcl2fastq v1.9.0 | Illumina | https://support.illumina.com/sequencing/sequencing_software/bcl2fastq-conversion-software/downloads.html |
Trimgalore | Felix Krueger, Babraham Institute | https://github.com/FelixKrueger/TrimGalore |
BWA v0.7.17 | Li et al.60 | https://anaconda.org/bioconda/bwa; RRID:SCR_010910 |
Multiqc v1.0 | Ewels et al.61 | https://anaconda.org/bioconda/multiqc; RRID:SCR_014982 |
Samblaster v0.1.24 | Faust et al.62 | https://anaconda.org/bioconda/samblaster; RRID:SCR_000468 |
Samtools v1.9 | Danecek et al.73 | https://anaconda.org/bioconda/samtools, RRID:SCR_002105 |
MACS2 v2.1.1 | Zhang et al.64 | https://anaconda.org/bioconda/macs2; RRID:SCR_013291 |
GenomicRanges v3.11 | Lawrence et al.65 | https://bioconductor.org/packages/release/bioc/html/GenomicRanges.html; RRID:SCR_000025 |
Bedtools v2.29.0 | Quinlan et al.66 | https://anaconda.org/bioconda/bedtools; RRID:SCR_006646 |
Benchling | N/A | https://www.benchling.com/RRID:SCR_013955 |
IGV v2.16.2 | Robinson et al.74 | https://igv.org/doc/desktop/#DownloadPage/; RRID:SCR_011793 |
ChIPseeker v3.11 | Wang et al.75 Yu et al.67 |
https://bioconductor.org/packages/release/bioc/html/ChIPseeker.html; RRID:SCR_021322 |
STAR v2.5.4b | Dobin et al.70 | https://anaconda.org/bioconda/star; |
edgeR v3.18 | Robinson et al.76 | https://bioconductor.org/packages/release/bioc/html/edgeR.html; RRID:SCR_012802 |
Graphpad Prism v10.0.3 | N/A | https://www.graphpad.com; RRID:SCR_002798 |
UCSC Genome Browser PLAC-seq, H3K27ac ChIP-seq, and ATAC-seq session | Nott et al.20 | https://genome.ucsc.edu/s/nottalexi/glassLab_BrainCellTypes_hg19 |
UCSC Genome Browser | Nassar et al.77 |
https://genome.ucsc.edu; RRID:SCR_005780 |
Other | ||
StemFlex medium | ThermoFisher | cat#A3349401 |
Geltrex LDEV-free reduced growth factor basement membrane | ThermoFisher | cat#A1413201 |
iMatrix | Matrixome | cat#892012 |
ReLeSR | STEMCELL Technologies | cat#05872 |
Cell Staining Buffer | BioLegend | cat#420201 |
TruStain FcX (Fc Receptor Blocking Solution) | BioLegend | cat#422301 |
12x75mm round bottom tubes | Fisherbrand | cat#14-965-3C |
DMEM/F12, HEPES, no phenol red | ThermoFisher | cat#11039021 |
8-well chamber slides | Ibidi | cat#80841 |
EverBright Hardset Mounting Medium | Biotium | cat#23003 |
TD Buffer (part of kit) | Illumina | cat#FC-121-1030 |
ATM (part of kit) | Illumina | cat#FC-121-1030 |
NT buffer (part of kit) | Illumina | cat#FC-121-1030 |
Illumina Nextera DNA unique Dual Indexes | Illumina | cat#20027214 |
NEBNext High-Fidelity 2X PCR Master Mix | NEB | cat#M0541L |
KAPA Pure beads | Roche | cat#KK8001 |
Agilent DNA High Sensitivity chip | Agilent Technologies | cat#5067-4626 |
T4 Kinase (PNK) | Thermo Fisher Scientific | cat#EK3001 |
BbsI | NEB | cat#R0539S/R0539L |
Cut Smart Buffer | NEB | cat#B7204 |
T4 ligase buffer | Thermo Fisher Scientific | cat#B69 |
T4 DNA ligase | Thermo Fisher Scientific | cat# EL0011 |
PlasmidSafe ATP-dependent DNase | Lucigen | cat#E3101K |
PlasmidSafe buffer | Lucigen | not available |
25 mM ATP solution | Lucigen | not available |
One Shot Top10 E. Coli | Thermo Fisher Scientific | cat#C404003 |
S.O.C. | Thermo Fisher Scientific | cat#15544034 |
Revitacell | Thermo Fisher Scientific | cat#A2644501 |