TABLE 3.

Positions of ORFs in contig C and features of the predicted gene products

ORF	Putative RBS and start sitea	Potential coding region		Predicted gene productb
		Location in nucleo- tide sequence	% G+C	Length (amino acids)	MW (103)	pI	GRAVY
orfde1	TTTAGGAGAGATAGTATGATT	778–1314	40.6	178	19.8	5.10	−1.292
orfde2	AATAAGGAGAGTGTGTGATGAAG	1558–2466	35.9	302	34.0	9.82	6.762
orfde3	ACCAGGAGAGCGACGAATCAATACCAAAAATATGCCT	2718–3710	36.3	330	36.3	9.85	9.497
orfde4	AGTAAGGAGAAATGAGCATGCAA	3831–4670	34.2	279	32.3	5.65	−2.620
orfde5	AATGGGGAAATTTTTTAACAAATGGGG	4597–5445	37.2	282	32.7	5.63	−1.770
orfde5_6	AGTGAAGAAGATGAACTAATTATTTCAGATGATGGTT CTACTGATCTACCTTGGAA	5577–6161	39.0	194	22.2	9.78	−1.789
orfde6	TTTAAGGAGATTGTTCATGAAA	6283–7149	38.5	288	32.1	4.82	−1.719
orfde7	AATAGGAGCGAGGAAACGTGAAA	7162–7734	38.2	190	21.3	5.30	−2.679
orfde8	AGTAGGAGAGTTTCAATTATGAAA	7759–8787	38.3	342	38.4	4.99	−5.047
orfde9	TGTGAGATAACAGTCGAAAGGCGATGGCA	8823–9722	38.3	299	33.8	4.68	−3.632
orfde10	AGTGGAAAGGTGTTTCTCTTTATGAAG	9781–10506	37.7	211	26.9	6.23	0.357
orfde11	TACGGAAGGAATAAGTATATGTTT	11518–12312	32.6	264	30.7	9.48	6.549
orfde12	TATAAGGAGAGAACGACATGTCA	12325–13005	37.7	226	25.4	5.18	−1.195
orfde13	TATGGAGATACGATGGAC	13019–13543	36.0	174	20.2	4.89	−3.937
orfde14	AATGGAAGGATACGACAAAAGATGAAG	13533–14714	36.5	393	45.1	4.56	−3.176
orfde15	TTTGGAAGGCGATCAGGTTTATGGTT	14936–16543	39.1	536	61.0	5.39	−4.153
orfde16	TATAAGGAGAATGCACATGAAT	16700–18817 (3′ partial)

^aPutative RBSs are underlined, and start codons are in boldface. 

^bMolecular weight (MW), isoelectric point (pI), and grand average hydropathicity (GRAVY) were calculated by using ProtParam at ExPASy. GRAVY is based on the Kyte-Doolittle formulation (24); the more negative the value is, the more hydrophilic the protein is.