Abstract
Severe insulin resistance syndromes result from primary insulin signaling defects, adipose tissue abnormalities or other complex syndromes. Mutations in TBC1D4 lead to partial insulin signaling defects, characterized mainly by postprandial insulin resistance. We describe an individual with severe insulin-resistant diabetes unresponsive to multiple therapies, in whom exome and genome analyses identified a complex rearrangement in TBC1D4. The rearrangement was of the pattern DUP-TRP/INV-DUP, with mutational signatures suggestive of replicative repair and Alu-Alu recombination as the underlying mechanisms. TBC1D4 encodes the TBC1D4/AS160 RabGTPase activating protein (RabGAP) involved in the translocation of glucose transporter 4 (GLUT4) from the cytosol to the cell membrane. Although the precise functional mechanism underlying insulin resistance in the proband is yet to be determined, this case provides further support for the link between TBC1D4 and hereditary insulin-resistant diabetes.
Subject terms: Endocrine system and metabolic diseases, Endocrine system and metabolic diseases
Introduction
Monogenic forms of diabetes account for ~0.5–5% [1] of all cases of diabetes, and are important to identify as they have distinct therapeutic implications as compared to the more common type 1 and type 2 diabetes. This heterogeneous group of disorders includes maturity-onset diabetes of the young (MODY), neonatal diabetes, and various diabetes-associated syndromes such as Wolfram syndrome [MIM 222300] [1, 2].
Severe insulin resistance syndromes have been recognized as hereditary forms of early-onset diabetes as well, and may stem from primary insulin receptor defects, signaling defects, adipose tissue abnormalities or other complex syndromes [3, 4]. The monogenic insulin resistance syndromes may include moderate to severe acanthosis nigricans and markedly increased insulin levels. With the emergence of full-blown diabetes, indicative of beta cell insufficiency, increased insulin requirements in the absence of corresponding obesity are often noted [3, 5]. Hyperglycemia and diabetes tend to occur later in the genetic forms of insulin resistance compared to other forms of monogenic diabetes and usually manifest after puberty [3]. Mutations in AKT2 [6] or TBC1D4 lead to partial insulin signaling defects, the latter characterized mainly by postprandial insulin resistance [7].
Here we describe an individual with a personal and family history highly indicative of a severe insulin resistance syndrome. Next-generation sequencing identified a complex rearrangement in TBC1D4, previously implicated in susceptibility to type 2 diabetes [MIM: 612465]. TBC1D4 encodes Tre-2, BUB2, CDC16, 1 domain family member 4 (TBC1D4), also known as AS160, which is a critical regulator of the translocation of glucose transporter 4 (GLUT4) from the cytosol to the cell membrane, allowing glucose uptake in response to insulin [8].
Material and methods
Exome sequencing and analysis
Following informed consent, exonic sequences from DNA of the proband (Individual III-6) were enriched with the xGen Exome Research Panel IDT-V2 combined with xGen Human mtDNA Research Panel v1.0. Sequences were generated on a NovaSeq 6000 sequencing system (Illumina, San Diego, California, USA) as 150-bp paired-end runs, to a final depth of 82.4× coverage (with 95% covered >20×). The FASTQs were uploaded onto the lysis platformX. Alignment and variant calling of single nucleotide variations (SNVs), and copy number variants (CNVs) were called using Illumina DRAGEN Bio-IT. The resulting VCF files were comprehensively annotated on the Geneyx Analysis annotation engine, and presented for analysis, filtering and interpretation, with the human genome assembly hg19 (GRCh37) as reference.
Short-read whole-genome sequencing (WGS)
Genomic DNA was extracted from peripheral blood and NGS libraries were prepared with an Illumina PCR-free TruSeq DNA Library Prep Kit. Sequences were generated on an Illumina NovaSeq 6000 sequencing platform as 150 bp paired-end reads, to a final depth of 44× coverage. The FASTQs were uploaded to the Geneyx Analysis platform [9]. Alignment and variant calling of SNVs, CNVs, structural variants (SVs), and tandem repeats were called using Illumina DRAGEN Bio-IT. The resulting VCF files were comprehensively annotated on the Geneyx Analysis annotation engine, and presented for analysis, filtering and interpretation, with the human genome assembly hg19 (GRCh37) as reference.
Long-read WGS
Blood DNA was purified using the Blood and Cell Culture DNA Kit (Qiagen). This was followed by shearing on the Megaruptor3 system (B06010003, Diagenode). Library construction was done with SMRTbell prep kit 3.0 (PacBio) on the Sciclone G3 NGSx Workstation (CLS145321, PerkinElmer) with standard settings. The library was size selected on the PippinHT (Sage Science) with 5 and 10 kb cut and gel cassette 0.75% agarose 6–10 kb high-pass 75E. Libraries were bound to the Sequel II polymerase 2.2 with the Sequel II binding kit 2.2 (101-894-200, PacBio). Bound DNA-polymerase complexes were loaded on the SMRT Cell 8M and sequenced on the Sequel IIe system (PacBio). HiFi reads were generated on-board of the Sequel IIe system with CCS (version 6.2.0). FASTQs were subjected to PacBio Human WGS Workflow. Alignment to reference genome and variant calling were executed with default settings [10]. The resulting VCF files were comprehensively annotated on the Geneyx Analysis annotation engine, and presented for analysis, filtering and interpretation.
Breakpoint junction analysis
DNA was amplified for the three regions encompassing the breakpoint junctions as determined by WGS, using PCRBIO HS Taq Mix Red (PCR BIOSYSTEMS). Primers used were as follows: Inversion 1F: 5′- CCTTGTTTCTCCATGCCAAA- ‘3 and Inversion 1R: 5′- CCAAAGTTCCAACCATGAGG -3′ (product size 600 bp); Inversion 2F: 5′- GGCTGATGGAGGAGAAATGGA -3′ and Inversion 2R: 5′- TTGCTGTGTCCTAACCTGGT -3′ (product size 966 bp); and Deletion F: 5’- CCAGAACACCCACGTAGCTT -3′ and Deletion R: 5′- CTGCTTGGGAAGAGGTGAAG -3′ (product size 892 bp). The resultant fragments were separated by 1.5% agarose gel electrophoresis and their sequences were determined by Sanger sequencing.
RNA extraction and analysis
RNA was isolated from fresh lymphocytes of the proband by TRIzol reagent extraction. cDNA was prepared from 1 μg RNA using the qScript cDNA Synthesis Kit (Quantabio). Expression of TBC1D4 was quantified by real-time qPCR using PerfeCTa SYBR Green FastMix ROX (Quantabio) in the StepOnePlus Real-Time PCR system (Thermo Fisher), with the following primers: TBC1D4_Exon5_F: 5′- GAAACAGGCCTTCAGTACGG -3′ and TBC1D4_Exon6_R: 5′- CTTGGCTCTTGGTGGGTAGA -3’. ACTB and GAPDH served as loading controls, and were amplified with the following primers: ACT_B_F: 5′- GATCAAGATCATTGCTCCTC -3′ and ACT_B_R: 5′- TTGTCAAGAAAGGGTGTAAC -3′ and GAPDH_F: 5′- ACAGTTGCCATGTAGACC -3′ and GAPDH_R: 5′- TTGAGCACAGGGTACTTTA -3′.
Results
Clinical report
The patient (Fig. 1, individual III-6) presented to our clinic at the age of 27 years, due to complaints of polyuria and polydipsia. He reported a history of diabetes since age 12; however, he had been generally reluctant to undergo follow-up or treatment. Antibodies to glutamic acid decarboxylase were negative at the time of diagnosis, and also recently when repeated in our clinic. He was treated with metformin following the initial diagnosis, yet discontinued treatment due to abdominal discomfort. Occasional fasting blood glucose measurements throughout the years were in the range of 200–300 mg/dL.
Fig. 1. Pedigree of affected individual.
Multiple members affected by diabetes can be appreciated. The proband and his father had an earlier onset and a more severe disease course as compared to the others.
His family history was notable for multiple individuals with diabetes on his father’s side. His father had developed diabetes at a young age and passed away at the age of 56 following multiple diabetes-related complications including end-stage renal failure, retinopathy, above-knee amputation, peripheral vascular disease and ischemic heart disease. His father had four siblings. Two brothers had diabetes, and had passed away. The proband is not in touch with his father’s sister who is also diabetic or with his cousins. He is the youngest of six siblings, one of whom had recently developed diabetes at the age of 40 and was well controlled with sitagliptin and metformin. His mother had been diagnosed with diabetes at the age of 40, she had been reasonably well controlled over the years and had died of leukemia.
Acanthosis nigricans was not noted on the physical exam. BMI was 29.4 kg/m2 (weight 93 kg, 178 cm). Laboratory tests revealed a fasting plasma glucose of 311 mg/dL, HbA1c of 14.2% and urinary albumin creatinine ratio of 280 mg/g. Lipid profile included LDL 157 mg/dL, HDL 38 mg/dL and triglycerides 190 mg/dL. Ophthalmological exam was significant for bilateral background diabetic retinopathy.
Treatment with insulin at a basal-bolus regimen was initiated and intensified to include liraglutide and pioglitazone. A low-carb diet was recommended. Pioglitazone was stopped due to lack of efficacy (HbA1c 9.7–9.8% before and 3 months after treatment initiation). Insulin doses were gradually increased to 160–200 units/day and empagliflozin was initiated, yet HbA1c levels remained at around 9% (Fig. 2). Statins were initiated and discontinued due to muscle cramps.
Fig. 2. Clinical course of the patient.
HbA1c (blue) and weight (red) over time. Medical treatment marked in green. Patched fill indicates partial adherence to treatment.
While treated with the intensive insulin regimen, he gained 12 kg to a BMI of 33.9 kg/m2. He underwent a mini gastric bypass at 28 years of age, as part of an experimental protocol comparing surgical vs. medical treatment of poorly controlled diabetes. BMI dropped to 26.8 kg/m2 following surgery, HbA1c dropped to 7.9%, yet subsequently increased to the range of 8.2–10.3%. Fasting C-peptide levels were 583 pmol/L, and glucose was 204 mg/dL. Post-surgery, he was maintained on empagliflozin alone, though with progressive hyperglycemia, metformin was introduced as a combination therapy – dapagliflozin/metformin XR and was well tolerated (metformin XR alone is unavailable in our country).
During his most recent follow-up at 34 years of age, the patient’s BMI was steady at 23.8 kg/m2, treatment regimen included 20–25 units of degludec insulin, low dose (0.25 mg/week) semaglutide and metformin XR/dapagliflozin and HbA1c was 9.8%. He was not taking statins and LDL was 101 mg/dL, triglycerides 96 mg/dL and HDL 41 mg/dL. Urine protein/creatinine ratio was 3.4 g/g. He had proliferative diabetic retinopathy and had undergone laser treatment and bevacizumab injections in recent years. The patient did not consistently take insulin as he noted that his glycemic control did not markedly differ during weeks “on” or “off” basal insulin and felt his body was unresponsive to insulin.
Genetic analysis identified a complex rearrangement in TBC1D4
The proband was referred to exome sequencing (ES) due to the personal and family history suggestive of monogenic diabetes. Analysis focused on known genes associated with diabetes (Supplementary Table S1). No pathogenic or likely pathogenic single nucleotide variants (SNVs) of potential interest were identified, leading to a wider unbiased analysis of the exome. However, copy number variant (CNV) analysis from exome read depth disclosed a triplication encompassing exons 2–21 of the TBC1D4 gene. As TBC1D4 is a suspected cause of Type 2 Diabetes (MIM number: 616087), WGS was pursued to further characterize the triplication boundaries. A complex rearrangement composed of an inverted triplication interspersed with a duplication was identified (Fig. 3A). Long-read sequencing was used to map the final breakpoint junction, which was mediated by Alu-Alu recombination, and to ensure that all rearrangement events were on the same chromosome (in cis).
Fig. 3. Complex rearrangement identified in TBC1D4.
A Whole-genome sequencing results indicating intragenic triplication and duplication. B Resolved complex rearrangement showing DUP-TRP/INV-DUP structure. This involved a proximal and distal breakpoint, as well as a small deletion, and was mediated by AluSx elements in inverted orientation. C Schematic diagram of wild-type and rearranged chromosome.
DNA of the proband’s father was extracted from a formalin-embedded pathology sample obtained during colonoscopy. Minimal DNA was available and allowed for the amplification of only one of the breakpoints. The deletion breakpoint could be amplified from this DNA, suggesting that the entire complex rearrangement event had been inherited from the proband’s father. The proband’s siblings refused to be tested, so further segregation was not possible.
Breakpoint junction analyses reveal potential mechanism underlying genomic rearrangement
The rearrangement event consisted of the following copy numbers on chromosome 13q22.2 (centromere to telomere)—normal-duplication-triplication-duplication-triplication-duplication-normal, and spanned ~102.6 kbp (chr13:75,835,017-75,937,640 [hg19]), from the intergenic region beyond the last exon (NM_014832.5, exon 21) to the first intron of TBC1D4 (Fig. 3A, B). TBC1D4 is encoded from the minus strand. In addition, the triplication was inverted (Fig. 3B, C), so that the basic rearrangement is most similar to the “duplication–inverted triplication–duplication” (DUP-TRP/INV-DUP) structure mediated by inverted repeats in the genome. Consistent with this, the proximal inversion breakpoint junction (INV_2) was embedded within AluSx elements in an inverted orientation (Figs. 3B and 4) located ~1000 bp apart and with 84% identity between them. The distal inversion breakpoint junction (INV_1) showed microhomology of 4 base pairs (bps) (Figs. 3B and 4A). Adding to the complexity of the rearrangement was a deletion encompassing exon 8 (TBC1D4 transcript: NM_014832.5), with microhomology of 2 bps at the breakpoint (Figs. 3B and 4B).
Fig. 4. Breakpoint junctions.
A Junction 1 (INV_1 in Fig. 2B), the distal breakpoint, showing microhomology. B The deletion breakpoint, encompassing exon 8. C Junction 2 (INV_2 in Fig. 2B) showing high homology between the Alu elements with a mutational signature suggestive of replicative repair.
At the RNA level, the complex rearrangement would be expected to leave one copy of the transcript intact on the rearranged chromosome (exons 1–21) and a second copy in tandem, including only exons 2–21 if indeed transcribed. The third copy, in between these, would be expected to include exons 2–21 in inverted orientation to the promoter of the gene and therefore would not be expected to be transcribed according to the canonical exons (Fig. 3C).
cDNA analysis showed expression levels comparable to controls
Analysis of cDNA from the proband as compared to controls revealed comparable expression levels (Supplementary Fig. S1), suggesting that the mechanism is not loss-of-function.
Discussion
We characterized a complex genomic rearrangement involving TBC1D4, in an individual with presumed hereditary insulin-resistant diabetes. Repetitive elements in the human genome, such as low copy repeats (LCRs) and short interspersed nuclear elements (SINEs, including Alu elements), render the genome prone to instability and large-scale genomic alterations. Replication-based mechanisms such as Fork Stalling and Template Switching (FoSTeS)/microhomology-mediated break-induced replication (MMBIR) have been proposed to underlie the formation of complex genomic rearrangements through a series of iterative template switches during replicative repair of single-ended, double-stranded DNA breaks (seDSB) [11]. The mutational signatures at the breakpoint junctions of the proband described in this report suggest replicative repair and Alu-Alu recombination as the mechanisms underlying the complex rearrangement. This pattern of DUP-TRP/INV-DUP was first described at the MECP2 and PLP1 loci [12], and subsequently reinforced at these and other loci [13–15]. The mechanism requires two breakpoint junctions - one of which maps within inverted repeats, and the second which does not have extensive homology although some microhomologies may be found at the junction [12].
TBC1D4/AS160 is a RabGTPase activating protein (RabGAP) which is phosphorylated and inhibited by AKT in response to insulin stimulation. Inhibition of TBC1D4 leads to elevation of the GTP-bound form of selected Rabs and GLUT4 translocation to the membrane, with subsequent glucose uptake [16, 17]. Accordingly, knockout of Tbc1d4 in rodents results in decreased basal plasma glucose levels and impaired insulin-stimulated glucose uptake in muscle and adipose tissue [18, 19].
A population-specific variant in the Greenlandic Inuit population (TBC1D4: NM_014832.5: c.2050C>T; p.Arg684Ter; rs61736969) is associated with decreased GLUT4 protein levels and decreased insulin-stimulated glucose uptake in muscle, with consequent postprandial hyperglycemia, impaired glucose tolerance and diabetes in homozygous individuals. The variant is highly prevalent in the population, with an allele frequency of 17%. At a recessive odds ratio of ten for type 2 diabetes, the p.Arg684Ter variant accounts for over 10% of all diabetes in Greenland. Heterozygous carriers have a moderately higher plasma glucose concentration after an oral glucose load. Notably, the c.2050C>T; p.Arg684Ter variant affects an exon that is only expressed in the long isoform of TBC1D4, which is expressed in skeletal muscle, yet does not affect the short isoform, which is more widely expressed [7].
In addition, a heterozygous stopgain variant in TBC1D4 (NM_014832.5:c.1087C>T; p.Arg363Ter; rs587777260) co-segregated with acanthosis nigricans and/or postprandial hyperglycemia in five members of a single family. The variant affects both the long and short isoforms and leads to a prematurely truncated protein, which lacks the RabGTPase domain and AKT phosphorylation sites, slightly increasing basal GLUT4 cell membrane levels and significantly reducing insulin-stimulated GLUT4 cell membrane translocation. When co-expressed with wild-type TBC1D4, the truncated protein dimerized with the full-length TBC1D4, leading the authors to hypothesize that the truncated variant may interfere with the wild-type allele in a dominant negative fashion. Alternatively, TBC1D4 may have an unknown role in other tissues which contributes to the human phenotype [20]. Other TBC1D4 variants have also been identified in individuals with severe insulin resistance [21].
Our patient presented with severe insulin-resistant diabetes, which was unresponsive to multiple therapies. High-dose insulin (>2U/kg) did not improve his glycemic control, yet some improvement was observed with bariatric surgery, which markedly reduced caloric intake. Pioglitazone, which has shown some benefit in the treatment of lipodystrophies due to increased expression of genes involved in adipogenesis, did not benefit our patient. TBC1D4 is predominantly involved in skeletal muscle glucose uptake, impacting postprandial rather than fasting hyperglycemia; thus, bariatric surgery limiting food intake had a somewhat positive effect. The patient presented to our clinic following prolonged exposure to excessively high glucose, which may have led to marked deterioration in beta cell function. Thus, while high C-peptide levels are expected in the insulin-resistant syndromes, inappropriately normal levels were observed in our patient. Moreover, a role of TBC1D4 in insulin secretion has been surmised and may have contributed to the observed relative insulin deficiency [22].
This case report provides further support for the link between TBC1D4 and hereditary insulin-resistant diabetes, although the molecular mechanism has not yet been elucidated. Our findings suggest that the mechanism is not loss-of-function. Rather, we hypothesize that the phenotype may be caused by a gain of function due to a yet undetected aberrant transcript involving the inverted sequence. Functional assays in patient-derived cells in the future may lead to an understanding of the precise functional mechanism underlying insulin resistance in the proband.
Supplementary information
Acknowledgements
The authors would like to thank the patient for his participation in this study.
Author contributions
AC, HM-S and TH conceptualized the study and wrote the manuscript with input from all authors. AC and RP collected and analyzed clinical information. HM-S, BT, GS and ES analyzed genomic information. HR-F, SY-D and TH analyzed genomic data, and designed and performed molecular experiments.
Funding
No specific funding sources to declare.
Data availability
Data generated in this study are found in the published article. Additional data are available from the corresponding author on reasonable request.
Competing interests
BT is an employee of Pacific Bioscience, GS and ES are employees of Ocean Genomics, and HM-S is an employee of Geneyx Genomix. The other authors declare no conflict of interest.
Ethics approval and consent for publication
The study was conducted in accordance with IRB-approved protocol 0306-10-HMO. Consent for publication was confirmed.
Footnotes
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
These authors contributed equally: Avivit Cahn, Hagar Mor-Shaked.
Supplementary information
The online version contains supplementary material available at 10.1038/s41431-023-01512-8.
References
- 1.Bonnefond A, Unnikrishnan R, Doria A, Vaxillaire M, Kulkarni RN, Mohan V, et al. Monogenic diabetes. Nat Rev Dis Prim. 2023;9:12. doi: 10.1038/s41572-023-00421-w. [DOI] [PubMed] [Google Scholar]
- 2.Samadli S, Zhou Q, Zheng B, Gu W, Zhang A. From glucose sensing to exocytosis: takes from maturity onset diabetes of the young. Front Endocrinol (Lausanne) 2023;14:1188301. doi: 10.3389/fendo.2023.1188301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Greeley SAW, Polak M, Njølstad PR, Barbetti F, Williams R, Castano L, et al. ISPAD Clinical Practice Consensus Guidelines 2022: the diagnosis and management of monogenic diabetes in children and adolescents. Pediatr Diabetes. 2022;23:1188–211. doi: 10.1111/pedi.13426. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Angelidi AM, Filippaios A, Mantzoros CS. Severe insulin resistance syndromes. J Clin Invest. 2021;131:e142245. doi: 10.1172/JCI142245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Iqbal J, Jiang HL, Wu HX, Li L, Zhou YH, Hu N, et al. Hereditary severe insulin resistance syndrome: pathogenesis, pathophysiology, and clinical management. Genes Dis. 2023;10:1846–56. doi: 10.1016/j.gendis.2022.03.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.George S, Rochford JJ, Wolfrum C, Gray SL, Schinner S, Wilson JC, et al. A family with severe insulin resistance and diabetes due to a mutation in AKT2. Science. 2004;304:1325–8. doi: 10.1126/science.1096706. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Moltke I, Grarup N, Jørgensen ME, Bjerregaard P, Treebak JT, Fumagalli M, et al. A common Greenlandic TBC1D4 variant confers muscle insulin resistance and type 2 diabetes. Nature. 2014;512:190–3. doi: 10.1038/nature13425. [DOI] [PubMed] [Google Scholar]
- 8.Leto D, Saltiel AR. Regulation of glucose transport by insulin: traffic control of GLUT4. Nat Rev Mol Cell Biol. 2012;13:383–96. doi: 10.1038/nrm3351. [DOI] [PubMed] [Google Scholar]
- 9.Dahary D, Golan Y, Mazor Y, Zelig O, Barshir R, Twik M, et al. Genome analysis and knowledge-driven variant interpretation with Tgex. BMC Med Genomics. 2019;12:200. [DOI] [PMC free article] [PubMed]
- 10.Mölder F, Jablonski KP, Letcher B, Hall MB, Tomkins-Tinch CH, Sochat V, et al. Sustainable data analysis with Snakemake. F1000Res. 2021;10:33. doi: 10.12688/f1000research.29032.2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Hastings PJ, Ira G, Lupski JR. A microhomology-mediated break-induced replication model for the origin of human copy number variation. PLoS Genet. 2009;5:e1000327. doi: 10.1371/journal.pgen.1000327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Carvalho CM, Ramocki MB, Pehlivan D, Franco LM, Gonzaga-Jauregui C, Fang P, et al. Inverted genomic segments and complex triplication rearrangements are mediated by inverted repeats in the human genome. Nat Genet. 2011;43:1074–81. doi: 10.1038/ng.944. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Beck CR, Carvalho CM, Banser L, Gambin T, Stubbolo D, Yuan B, et al. Complex genomic rearrangements at the PLP1 locus include triplication and quadruplication. PLoS Genet. 2015;11:e1005050. doi: 10.1371/journal.pgen.1005050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Bahrambeigi V, Song X, Sperle K, Beck CR, Hijazi H, Grochowski CM, et al. Distinct patterns of complex rearrangements and a mutational signature of microhomeology are frequently observed in PLP1 copy number gain structural variants. Genome Med. 2019;11:80. doi: 10.1186/s13073-019-0676-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Ishmukhametova A, Chen JM, Bernard R, de Massy B, Baudat F, Boyer A, et al. Dissecting the structure and mechanism of a complex duplication-triplication rearrangement in the DMD gene. Hum Mutat. 2013;34:1080–4. doi: 10.1002/humu.22353. [DOI] [PubMed] [Google Scholar]
- 16.Kane S, Sano H, Liu SC, Asara JM, Lane WS, Garner CC, et al. A method to identify serine kinase substrates. Akt phosphorylates a novel adipocyte protein with a Rab GTPase-activating protein (GAP) domain. J Biol Chem. 2002;277:22115–8. doi: 10.1074/jbc.C200198200. [DOI] [PubMed] [Google Scholar]
- 17.Ng Y, Ramm G, Lopez JA, James DE. Rapid activation of Akt2 is sufficient to stimulate GLUT4 translocation in 3T3-L1 adipocytes. Cell Metab. 2008;7:348–56. doi: 10.1016/j.cmet.2008.02.008. [DOI] [PubMed] [Google Scholar]
- 18.Wang HY, Ducommun S, Quan C, Xie B, Li M, Wasserman DH, et al. AS160 deficiency causes whole-body insulin resistance via composite effects in multiple tissues. Biochem J. 2013;449:479–89. doi: 10.1042/BJ20120702. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Arias EB, Zheng X, Agrawal S, Cartee GD. Whole body glucoregulation and tissue-specific glucose uptake in a novel Akt substrate of 160 kDa knockout rat model. PLoS One. 2019;14:e0216236. doi: 10.1371/journal.pone.0216236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Dash S, Sano H, Rochford JJ, Semple RK, Yeo G, Hyden CS, et al. A truncation mutation in TBC1D4 in a family with acanthosis nigricans and postprandial hyperinsulinemia. Proc Natl Acad Sci USA. 2009;106:9350–5. doi: 10.1073/pnas.0900909106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Dash S, Langenberg C, Fawcett KA, Semple RK, Romeo S, Sharp S, et al. Analysis of TBC1D4 in patients with severe insulin resistance. Diabetologia. 2010;53:1239–42. doi: 10.1007/s00125-010-1724-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Bouzakri K, Ribaux P, Tomas A, Parnaud G, Rickenbach K, Halban PA. Rab GTPase-activating protein AS160 is a major downstream effector of protein kinase B/Akt signaling in pancreatic beta-cells. Diabetes. 2008;57:1195–204. doi: 10.2337/db07-1469. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data generated in this study are found in the published article. Additional data are available from the corresponding author on reasonable request.