Skip to main content
Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease logoLink to Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease
. 2023 Dec 29;13(1):e029511. doi: 10.1161/JAHA.123.029511

Obese Male Mice Exposed to Early Life Stress Display Sympathetic Activation and Hypertension Independent of Circulating Angiotensin II

Carolina Dalmasso 1, Nermin S Ahmed 1, Sundus Ghuneim 1, Cole Cincinelli 1, Jaqueline R Leachman 1, Jorge F Giani 2, Lisa Cassis 1, Analia S Loria 1,
PMCID: PMC10863837  PMID: 38156515

Abstract

Background

We have previously reported that male mice exposed to maternal separation and early weaning (MSEW), a model of early life stress, show sympathetic activation and increased blood pressure in response to a chronic high‐fat diet. The goal of this study was to investigate the contribution of the renin–angiotensin–aldosterone system to the mechanism by which MSEW increases blood pressure and vasomotor sympathetic tone in obese male mice.

Methods and Results

Mice were exposed to MSEW during postnatal life. Undisturbed litters served as controls. At weaning, both control and MSEW offspring were placed on a low‐fat diet or a high‐fat diet for 20 weeks. Angiotensin peptides in serum were similar in control and MSEW mice regardless of the diet. However, a high‐fat diet induced a similar increase in angiotensinogen levels in serum, renal cortex, liver, and fat in both control and MSEW mice. No evidence of renin–angiotensin system activation was found in adipose tissue and renal cortex. After chronic treatment with enalapril (2.5 mg/kg per day, drinking water, 7 days), an angiotensin‐converting enzyme inhibitor that does not cross the blood–brain barrier, induced a similar reduction in blood pressure in both groups, while the vasomotor sympathetic tone remained increased in obese MSEW mice. In addition, acute boluses of angiotensin II (1, 10, 50 μg/kg s.c.) exerted a similar pressor response in MSEW and control mice before and after enalapril treatment.

Conclusions

Overall, elevated blood pressure and vasomotor sympathetic tone remained exacerbated in MSEW mice compared with controls after the peripheral inhibition of angiotensin‐converting enzyme, suggesting a mechanism independent of angiotensin II.

Keywords: adipose tissue, hypertension, maternal separation, obesity, renin–angiotensin system

Subject Categories: ACE/Angiotension Receptors/Renin Angiotensin System, Basic Science Research, Physiology, Obesity, Hypertension


Nonstandard Abbreviations and Acronyms

AT1R

angiotensin type 1 receptor

eWAT

epididymal white adipose tissue

HFD

high‐fat diet

LFD

low‐fat diet

MSEW

maternal separation and early weaning

RAAS

renin–angiotensin–aldosterone system

Clinical Perspective.

What Is New?

  • Early life stress associated with adverse childhood experiences is an independent risk factor for cardiovascular disease, showing a positive correlation with increased systolic blood pressure later in life.

  • This study provides important new understanding about the role of endocrine pressor systems in the underlying mechanisms linking early life stress with increased obesity‐associated hypertension.

  • Male mice offspring exposed to early life stress display exacerbated sympathetic activation and blood pressure during obesity, unlike in their female littermates; however, this mechanism seems to be independent of angiotensin II.

What Are the Clinical Implications?

  • This study suggests that reducing obesity‐associated hypertension risk may require the target of central mechanisms controlling blood pressure in a sex‐specific manner.

  • These findings could contribute to the development of personalized antihypertensive therapies in individuals exposed to adversity and stress during childhood and adolescence.

Nearly half of adults in the United States (45.4%) have hypertension, a major risk factor for cardiovascular disease. 1 Studies have shown that hypertension is influenced by interactions with the environment, whereas healthy diets and exercise have been largely used as targets for intervention and treatment of hypertension and cardiovascular disease. 2 , 3 , 4 , 5 Early life stress, associated with adverse childhood experiences, is a less studied independent risk factor that has been established as a predictor for the development of cardiovascular disease. 6 , 7 , 8 , 9 Specifically, in a prospective analysis using a young cohort, Su et al 10 showed that the cumulative number of adverse childhood experiences display a positive correlation with elevated systolic blood pressure.

There is large body of literature linking the programming of hypertension during perinatal life with the activation of the renin–angiotensin–aldosterone system (RAAS) in the offspring, 11 prompted by a wide range of insults such as maternal stress, maternal obesity, prenatal dexamethasone, low‐protein‐diet pregnancies, intrauterine growth restriction, and behavioral stress during early postnatal life. 12 , 13 , 14 Previously, we have shown that maternal separation and early weaning (MSEW), a mouse model of neglect in mice neonates, exacerbates obesity‐induced hypertension in both male and female adult offspring fed a high‐fat diet (HFD) chronically. 15 We have demonstrated that male MSEW mice display increased sympathetic tone compared with control mice, and sympathoexcitatory afferent signals from epididymal white adipose tissue (eWAT) contribute to exacerbate the fat–brain–blood pressure axis. 16 Yet obese MSEW male mice have similar body adiposity and circulating leptin levels compared with obese male controls. 16 Conversely, female MSEW mice show increased fat mass and circulating levels of leptin and Ang II (angiotensin II), most likely synthetized and released by adipose tissue. Further, obese female MSEW mice showed similar sympathetic activation compared with controls. 17 , 18 , 19 Moreover, the chronic blockade of ACE (angiotensin‐converting enzyme) abolished the differences in blood pressure between obese MSEW and control female mice, demonstrating that obese MSEW female mice display Ang II–dependent hypertension. 17

Due to the well‐known stimulatory effects of Ang II to facilitate sympathetic neurotransmission by regulating norepinephrine synthesis, release, and uptake, 20 , 21 we hypothesized that the RAAS mediates the overactivation of the sympathetic system and the hypertensive phenotype in obese in male mice exposed to MSEW. In this study, we investigated circulating levels of RAAS peptides and the tissue levels of the RAAS components. In addition, we tested whether male MSEW mice show increased pressure response to acute boluses of Ang II and Ang II–dependent hypertension after chronic ACE inhibition.

Methods

The methods and data that support the findings of this study are available from the corresponding author upon reasonable request.

Animal Model

All experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and the experiments were approved and monitored by the Institutional Animal Care and Use Committee at the University of Kentucky.

Experimental Design

The study was conducted following the Animal Research: Reporting of In Vivo Experiments 2.0 guidelines. C57BL/6J (Jackson Laboratory) female and male mice used for breeding had ad libitum access to food and water and were housed in a pathogen‐free environment with constant temperature and humidity. Animals were fed a regular chow diet (Teklad 8604, Madison, WI) and MSEW protocol was performed as described previously. 16 Briefly, pups were separated from the dams and placed in a clean cage inside an incubator (30±1 °C, humidity 60%) for 4 hours from postnatal day 2 to day 5 and for 8 hours from postnatal day 6 to day 16 of life. Early weaning was conducted on postnatal day 17. Normally reared, nonhandled litters that remained with the dams were weaned on postnatal day 21 and served as the control group. Litters were culled to 6 to 8 pups. At weaning, male offspring in each litter were randomized in different diets and experiments. Female littermates were used for other projects. Only one male mouse per litter was used in each experiment.

At weaning, male offspring in each litter were randomized to low‐fat diet (LFD) or HFD (10% or 60% kcal from fat, D12450J and D12492 respectively; Research Diets, Inc., New Brunswick, NJ) for 20 weeks. At week 16, under isoflurane anesthesia, a subset of littermates (n=6–8/group) were implanted with radiotelemeters (PA‐C10; Data Sciences, Inc., St. Paul, MN) for blood pressure and heart rate measurements as described previously. 17 Carprofen (10 mg/kg s.c.) was injected before the surgery and 12 hours after surgery. 17 After 15 days of recovery, baseline blood pressure was recorded for 5 consecutive days. Then, autonomic function and the acute effect of doses of angiotensin II was assessed before and after 1‐week treatment with enalapril maleate salt (2.5 mg/kg per day, 7 days in drinking water, E6888; Sigma‐Aldrich, St. Louis, MO). 17 A second subset of untreated time‐controlled littermates (n=6–8/group) were decapitated for serum collection to quantify angiotensin peptides. Different tissues were collected, snap frozen, and stored at −80 °C for protein analysis.

Molecular Profiling of the Renin–angiotensin–aldosterone system

Angiotensin peptides were measured by Attoquant Diagnostics GmBH (Vienna, Austria) using liquid chromatography–mass spectrometry based peptide quantification (RAAS Fingerprint™). Equilibrium levels of 6 different RAAS angiotensin peptide metabolites: angiotensin I, angiotensin II, angiotensin III, angiotensin IV, angiotensin 1‐5, and angiotensin 1‐7 were quantified in serum samples using previously validated and described methods. 22 , 23 , 24 Following a controlled equilibration and stabilization, samples were spiked with stable isotope‐labeled internal standards and subjected to solid‐phase extraction followed by liquid chromatography–mass spectrometry analysis (TSQ Altis Plus; Thermo Fisher Scientific, Waltham, MA). Internal standards were used to correct for peptide recovery. Analyte concentrations were reported in pmol/L. Equilibrium‐based biomarkers were calculated as plasma renin activity (PRA‐S, pM): [angiotensin I+angiotensin I] and ACE‐S (pM/pM): [angiotensin II/angiotensin I], and aminopeptidase A activity (pM/pM): [angiotensin II/angiotensin I].

Serum and Tissue Angiotensinogen, Angiotensin II, and Aldosterone Concentrations

Serum, adipose tissue, liver, and renal cortex angiotensinogen (AGT) concentrations were determined using an ELISA kit following the manufacturer's protocol (Immuno‐Biological Laboratories America, Minneapolis, MN). Angiotensin II in eWAT and renal cortex was extracted using C18 Sep‐Pak columns (Waters, Milford, MA; cat. no. WAT051910) and measured using an ELISA kit following the manufacturer's protocol (Enzo Life Sciences, Farmingdale, NY; cat. no. ADI‐900‐204). Serum aldosterone was measured by ELISA following the manufacturer's specifications (Cayman, Ann Harbor, MI; item no. 501090).

Angiotensin‐converting enzyme Activity

Enzymatic activity in eWAT and renal cortex were measured using a fluorescence ACE assay, as previously described. 17 , 25 , 26 All samples were homogenized in buffer containing 20 mmol/L HEPES with 0.5% Triton X‐100 (pH 7.3), and then centrifuged at 20 000g for 20 minutes at 4 °C. The supernatant was collected and stored at −80 °C for ACE activity assay. The protein concentrations of samples were determined by the Pierce BCA protein assay kit (ThermoFisher, Rockford, IL). ACE activity was measured using a fluorescence ACE assay, as previously described. 26 For this, 20 μg of protein extract was diluted to 100 μL in assay buffer (50 mmol/L HEPES pH 8, 200 mmol/L NaCl, 10 μmol/L Zn acetate), and then 100 μL of the fluorogenic peptide substrate Mca‐R‐P–P‐G‐F‐S‐A‐F‐K(Dnp)‐OH (R&D Systems, Netherlands) was added into each well at a concentration of 10 μmol/L in assay buffer with or without the ACE inhibitor lisinopril. The degradation of the fluorogenic peptide (fluorescence) was measured over time in a spectrophotometer (FLUOstar Omega; BMG LABTECH, Ortenberg, Germany) at 320 nm excitation and 405 nm emissions. Only the hydrolytic activity inhibited by lisinopril was considered for calculations. ACE expression in eWAT was assessed by Western blot. Briefly, protein homogenates were denatured, resolved, transferred into polyvinylidene fluoride membranes, and then probed with a goat polyclonal antibody against ACE (Santa Cruz Biotechnology, Santa Cruz, CA). GAPDH was used as the protein loading control.

Renin–angiotensin–aldosterone system Component Gene Expression

mRNA was extracted from frozen eWAT and kidney cortex using the Aurum Total RNA Mini Kit (Bio‐Rad Laboratories, Hercules, CA) and iScript Reverse Transcriptase (Bio‐Rad Laboratories) to generate cDNA as previously reported. 27 The quantitative reverse transcription polymerase chain reaction protocol used was: (1) 50 °C 10 minutes; (2) 95 °C 5 minutes; (3) 95 °C 10 seconds; (4) 60 °C 30 seconds; (5) repeat steps 3 to 5 for 45 cycles; (6) 95°C 10 seconds; (7) melt curve 65 °C to 95 °C, increment 0.5 °C for 5 seconds. Primers were designed and validated to determine expression of 18s=F: 5′‐AGTCGGCATCGTTTATGGTC‐3′, R: 5′‐CGAAGCATTTGCCAAGAAT‐3′; ACE=F:5′‐GGAGTACTTCCAACCGGT‐3′, R: 5′‐GCCTTGGCTTCATCAGTC‐3′; ACE2=F: 5′‐TCCAGACTCCGATCATCAAGC‐3′, R: 5′‐GCTCATGGTGTTCAGAATTGTGT‐3′; renin=F: 5′‐CTCTCTGGGCACTCTTGTTGC‐3′, R: 5′‐GGGAGGTAAGATTGGTCAAGGA‐3′; AGT=F: 5′‐GTACAGACAGCACCCTACTT‐3′, 5′‐CACGTCACGGAGAAGTTGTT‐3′; and AT1Rs (angiotensin type 1 receptors)=F: 5′‐CGAAGCGATCTTACATAGGTG‐3′.

Sympathetic Index in Conscious Mice

A 1‐hour baseline was recorded before the experiments. After the baseline period, mice received an acute injection of mecamylamine (5 mg/kg i.p.) to study the effects of MSEW on vasomotor sympathetic tone. To determine the effects on blood pressure, 1‐hour average response was reported as delta pressor response from the baseline. We used the maximal response time point, which was between 2 and 3 hours following the injection. 16

Angiotensin II Acute Response in Conscious Mice

A 1‐hour baseline was recorded prior to the experiments as previously reported. 17 The acute administration of angiotensin II (0, 1, 10 and 50 μg/kg s.c. in sterile saline) was performed allowing blood pressure to recover between doses. A 1‐minute average after each injection was recorded for 15 minutes. In addition, a 10‐minute average of mean arterial pressure was reported as delta pressor response from baseline.

Statistical Analysis

All data are presented as mean±SEM. Two‐way ANOVA followed by Bonferroni post hoc test was used to assess the differences between control and MSEW mice in different dietary conditions. Unpaired t test was used to analyze the differences in angiotensin II concentrations in eWAT and renal cortex, gene expression, and ACE and ACE2 activity in HFD‐fed mice. One‐way ANOVA followed by Tukey's multiple comparisons test was used to analyze the differences in body weight and intake before and after enalapril treatment and the differences in delta blood pressure from LFD‐fed mice and between untreated and enalapril‐treated HFD‐fed mice. Two‐way ANOVA followed by Tukey's multiple comparisons test was used to analyze the effects of AngII doses before and after enalapril treatment. Analyses were performed using GraphPad Software version 10.0.2 for macOS (La Jolla, CA; www.graphpad.com). Due to the small sample sizes per group, normality of outcomes is assumed. Statistical significance was determined by P<0.05.

Results

Circulating Angiotensin Peptides Are Similar in Control and MSEW Mice Fed an HFD

In accordance with our previous reports, body weight and fat pad mass were not different between control and MSEW mice (Table). In serum samples obtained by decapitation, circulating Ang I, Ang II, Ang 1‐7, Ang III and Ang 1‐5 levels did not show a diet or MSEW effects when comparing the groups (Figure 1). Similarly, plasma renin activity (Figure 2A) and aminopeptidase A (Figure 2B) were not influenced by diet or MSEW. Plasma aldosterone levels were higher in HFD‐fed mice compared with LFD‐fed mice (Figure 2C), but differences between control and MSEW were not observed.

Table 1.

Body Weight and Water Intake Before and After 1‐Week Enalapril Treatment in Control and MSEW Mice Fed an HFD

Untreated Enalapril P Interaction P Enalapril P MSEW
Control n=6 MSEW n=6 Control n=6 MSEW n=6
Body weight, g 49.0±2.4 50.6±1.8 48.3±1.9 49.9±2.6 0.827 0.723 0.844
Water intake, mL/d 4.90±0.27 5.78±0.33 5.56±0.16 5.52±0.11 0.359 0.775 0.459

Data were analyzed by 1‐way repeated measures ANOVA followed by Tukey's multiple comparisons test and reported as mean±SEM. HFD indicates high‐fat diet; and MSEW, maternal separation and early weaning.

Figure 1. Serum angiotensin peptides in control and MSEW mice fed a low‐fat diet (LFD) and high‐fat diet (HFD).

Figure 1

Basal levels of the peptides were not affected by MSEW or diet in male mice: angiotensin I (AngI) (A), angiotensin II (AngII) (B), angiotensin 1‐7 (Ang1‐7) (C), angiotensin 1‐5 (Ang1‐5) (D), and angiotensin III (AngIII) (E). Data were analyzed by 2‐way ANOVA followed by Bonferroni post hoc test and reported as mean±SEM. n=5 per group in LFD‐fed mice, n=8 in HFD‐fed mice. MSEW indicates maternal separation and early weaning.

Figure 2. Activity of serum renin–angiotensin–aldosterone system (RAAS) components and levels of serum aldosterone in control and MSEW mice fed a low‐fat diet (LFD) and high‐fat diet (HFD).

Figure 2

Renin activity (A), and aminopeptidase A (B) were not changed by MSEW or diet; however, aldosterone levels increased similarly in both groups in response to an HFD (C). Data were analyzed by 2‐way ANOVA followed by Bonferroni post hoc test and reported as mean ± SEM. n=5 per group in LFD‐fed mice, n=8 in HFD‐fed mice for renin and aminopeptidase A and n=6 per group for aldosterone. MSEW indicates maternal separation and early weaning.

Circulating and Tissue Angiotensinogen

Overall, serum and tissue AGT levels are increased in mice fed a HFD compared with an LFD (Figure 3A through 3D). In liver, HFD increased angiotensinogen levels only in control mice. While MSEW mice fed a LFD showed elevated AGT levels compared with controls, HFD did not increase further this protein (Figure 3B). In addition, HFD increased AGT levels similarly in renal cortex from control and MSEW mice (Figure 3C), while this increase was lesser in eWAT from MSEW mice compared with control (Figure 3D).

Figure 3. Circulating and tissue‐specific angiotensinogen (AGT) in control and MSEW mice fed a low fat diet (LFD) and high fat diet (HFD).

Figure 3

Serum (A), liver (B), renal cortex (C), and epididymal white adipose tissue (eWAT) (D). Data were analyzed by 2‐way ANOVA followed by Bonferroni post hoc test and reported as mean±SEM. ** <0.001, *** <0.005, **** <0.0001, *P<0.05 vs C‐LFD; P<0.05 vs respective LFD. n=7 per group in LFD‐fed mice, n=8 in HFD‐fed mice. C‐LFD indicates Control‐LFD; MSEW, maternal separation and early weaning; and NS, no significative.

Renin Angiotensin System Status in Adipose Tissue and Renal Cortex

In adipose tissue, total Ang II content tended to be reduced (P=0.058) in obese MSEW male mice (Figure 4A). Angiotensinogen, renin, ACE, and AT1R gene expression was similar between obese MSEW and control mice. However, ACE2 was upregulated in obese MSEW mice versus controls (Figure 4B), which was undetectable in LFD‐fed mice. Yet, both ACE and ACE2 activity were similar between groups (Figure 4C), although the ACE/ACE2 ratio was significantly increased in MSEW mice (0.91±0.11 versus 1.55±0.22, P<0.05). In renal cortex, total Ang II content (Figure 4D), renin, ACE, ACE2 and AT1R gene expression (Figure 4E), and ACE and ACE2 activity (Figure 4F) were also similar between obese control and MSEW male mice. Only AGT mRNA was downregulated in MSEW mice compared with controls.

Figure 4. Renin–angiotensin–aldosterone system (RAAS) components in epididymal white adipose tissue (eWAT) and renal cortex in control and MSEW mice fed a high‐fat diet (HFD).

Figure 4

Angiotensin II (AngII) (A), RAAS expression (B), and angiotensin‐converting enzyme (ACE) and ACE2 activity (C) in eWAT. AngII (D), RAAS components (E), and ACE and ACE2 activity (F) in renal cortex. Data were analyzed by t test. *P<0.05 vs control HFD. n=6–10 per group. AGT indicates angiotensinogen; AT1R, angiotensin type 1 receptor; MSEW, maternal separation and early weaning; Ns, no significative; and RFU, relative fluorescence units.

Enalapril Does Not Prevent Sympathetic Activation in MSEW Mice Fed an HFD

Table shows that chronic enalapril treatment did not affect body weight or water intake in either group. Untreated MSEW mice showed increased blood pressure compared with controls. After enalapril treatment, blood pressure remained elevated in MSEW mice compared with controls. Of note, there was no significant interaction between MSEW and enalapril treatment (Figure 5A). Similarly, the delta reduction in blood pressure induced by the chronic enalapril treatment was not statistically different between groups (Figure 5B). In addition, mecamylamine exerted a greater reduction in blood pressure in MSEW mice regardless the peripheral ACE blockade with enalapril (Figure 5C).

Figure 5. Blood pressure in control and MSEW mice fed a high‐fat diet (HFD).

Figure 5

A, Enalapril treatment reduced mean arterial pressure (MAP) similarly in both groups. B, Delta blood pressure in response to enalapril treatment. C, Mecamylamine induced a greater reduction in blood pressure regardless the enalapril treatment. Data were analyzed by 1‐way repeated mesures ANOVA followed by Tukey's multiple comparisons test and reported as mean±SEM, n=6. Enal indicates enalapril; MSEW, maternal separation and early weaning; and ns, not significant.

When testing the sensitivity to Ang II–mediated pressor responses, delta blood pressure was similarly reduced after ACE inhibition in control and MSEW mice before and after enalapril treatment (Figure 6A). Further, acute doses (10 μg/kg) of Ang II induced similar pressor responses in both groups before and after enalapril treatment (Figure 6B).

Figure 6. Acute blood pressure sensitivity to angiotensin II (AngII) before and after angiotensin‐converting enzyme (ACE) inhibition.

Figure 6

A, AngII pressor response was reduced control and MSEW enalapril‐treated mice similarly. B, Blood pressure trace in response to a 10 μg/kg AngII dose. Data were analyzed by 1‐way repeated measures ANOVA followed by Tukey's multiple comparisions test and reported as mean±SEM. # P<0.05 vs untreated; & P<0.05 vs untreated, n=6 per group. ENAL indicates enalapril; MAP, mean arterial pressure; MSEW, maternal separation and early weaning; and UT, untreated.

Discussion

Our study shows that obese male mice exposed to MSEW, a mouse model of neglect, display neurogenic hypertension that is most likely independent of the circulating levels of Ang II, the tissue levels of the Ang II precursor AGT, or the vascular sensitivity to Ang II. As the peripheral ACE inhibition did not attenuate the increased sympathetic activation and blood pressure in male MSEW mice compared with controls, it is unlikely that circulating Ang II mediates the increased vasomotor sympathetic tone in obese male MSEW mice. Therefore, the underlying mechanisms mediating hypertension in obese male MSEW mice seem to be mediatedby the central nervous system activation of the sympathetic outflow.

Obesity is associated with hypertension in clinical and experimental settings. Leptin resistance has been postulated to increase both food intake and sympathetic nerve activity via the activation of the melanocortin 4 (MC4) neurons in the hypothalamus. 28 Although it is well described that sympathetic activation is secondary to diet‐induced obesity in rats, the results are controversial in mice. Specifically, several studies have reported that obesity is not associated with hypertension and sympathetic activation in mice, 29 , 30 while others have shown obesity‐associated hypertension using similar obesogenic diets. 31 , 32 In our hands, HFD does not induce a significant increase in blood pressure and vasomotor sympathetic tone in male controls. 16 However, the obesogenic response in male MSEW mice is associated with elevated blood pressure and heart rate compared with mice fed an LFD and obese controls.

Previous reports from our laboratory have shown the effects of increased fat mass and circulating leptin in a cohort of subjects exposed to adverse childhood experiences. Cumulative adversity factors are positively associated with body mass index in women, but this association is not significant in men. 33 Accordingly, male subjects did not show any association between adverse childhood experiences and increased body mass index. Similarly, we have reported that female MSEW mice showed exacerbated adiposity and adipokine levels including leptin, angiotensin II, and aldosterone despite no evidence of a greater vasomotor sympathetic tone, 15 , 18 , 19 while this phenotype was absent in male mice. Our current study shows that there are other potential mediators for the mechanism underlying high blood pressure in male MSEW mice fed an HFD in addition to fat mass and adipokine levels. Previously, we have shown that the activation of the adipose tissue–brain–blood pressure axis is exacerbated in male MSEW mice. 16 This adipose afferent reflex is a sympathoexcitatory mechanism that, in healthy conditions, contributes to white adipose tissue redistribution by increasing afferent signals to modulate lipolysis. However, obesity induces a milieu in adipose tissue that increases afferent signals to the brain, increasing sympathetic outflow to other organs such as the heart, vasculature, and kidneys. 34 , 35 , 36 , 37 We have shown that MSEW enhances the adipose afferent reflex in obesity‐associated hypertension, and that both total renal denervation and selective epididymal white adipose tissue afferent denervation lowers blood pressure in obese MSEW mice. 16 These data suggest that adipose tissue‐derived signals stimulating afferent neurons that innervate the adipose tissue could contribute to exacerbate the sympathetic tone and, in consequence, blood pressure in this model. Despite the lack of reports showing the capacity of Ang II to stimulate afferent neurons in vitro or in vivo, the results of the current study reinforce the potential role of the adipose afferent reflex in the elevated sympathetic tone and blood pressure in obese MSEW males independently of the peripheral levels of Ang II. Furthermore, this study shows that obese MSEW males display imbalanced RAAS components in different tissues.

Overall, MSEW mice tend to display an attenuated AGT production in liver, kidney, and adipose tissue in response to an HFD. Subsequently, the adipose tissue in these mice showed reduced Ang II concentrations (P<0.058), while the ACE/ACE2 ratio was increased, most likely as a compensatory mechanism. In kidney, despite obese MSEW mice showed reduced AGT mRNA and protein expression compared with controls, Ang II levels were unchanged. Further studies will investigate the mechanisms by which MSEW attenuates the AGT production during obesity in male mice, particularly in adipose tissue.

Numerous studies have shown that activation of RAAS is an important mediator to increasing sympathetic tone and vascular constriction. AT1Rs mediate the constrictive actions of Ang II, while promoting inflammation, oxidative stress and catecholamine release centrally and peripherally. 38 Peripherally, AT1R expressed in the cardiovascular system induce vasoconstriction, tachycardia, and sodium and water retention. 39 Our data showed that blocking AT1R peripherally does not further reduce blood pressure in male MSEW mice compared with controls, indicating that there are other mechanisms underlying sympathetic activation that are independent of the circulating RAAS status. In addition, the acute responses to Ang II boluses were similar between control and MSEW mice before and after enalapril treatment, which suggests a similar vasoactive sensitivity in both groups. However, the current set of experiments does not allow ruling out a potential contribution of the brain renin–angiotensin system. Thus, further studies blocking the central effects of Ang II to investigate any reduction of the sympathetic outflow in obese male mice exposed to MSEW are needed.

The central administration of Ang II induces water and sodium intake and triggers sympathetic outflow to the kidney and other organs. 40 Renin‐angiotensin system blockers or the genetic deletion of AT1R in specific brain areas or cell types can offset these central effects. 41 , 42 , 43 , 44 Specifically, AT1Rs are highly expressed in the circumventricular organs, such as the subfornical organ, the organum vasculosum laminae terminalis, the median eminence and the area postrema, that lack a complete blood–brain barrier and regulate hydroelectrolitic balance and blood pressure. Nevertheless, Ang II plays an important role as a neuromodulator due to the elevated AT1R expression in the median preoptic nucleus, the paraventricular nucleus of the hypothalamus, agouti‐related peptide neurons in the arcuate nucleus, the rostral and caudal ventrolateral medulla, and the nucleus tractus solitarius, brain areas with a complete blood–brain barrier. 40 , 45 , 46 , 47 Furthermore, several studies have demonstrated the predominant role of Ang III in blood pressure regulation. 48 , 49 , 50 In the brain, the conversion of Ang II into Ang III is catalyzed by a zinc metalloprotease, aminopeptidase A and its inhibition prevents increases in blood pressure in models of neurogenic hypertension. Therefore, Ang III is considered a main biologically active peptide of the brain renin–angiotensin system. 51 , 52 Although we did not find differences in circulating Ang III and aminopeptidase A, the measurement of these renin–angiotensin system components in brain will provide insights or rule out the role of brain RAAS in the mechanisms of neurogenic hypertension displayed by obese male MSEW mice.

In conclusion, we showed that the increased vasomotor sympathetic tone in obese male MSEW mice is independent of systemic RAAS activation. Therefore, unlike results obtained in female mice, male MSEW mice display neurogenic, Ang II–independent hypertension in response to a chronic HFD, providing new insights on the potential sex‐specific approaches to reduce the cardiovascular risk secondary to early life stress exposure.

Acknowlegments

The authors thank Mark Ensor for the assistance in the measurement of renal and adipose tissue angiotensin II levels and ACE/ACE2 activity.

Sources of Funding

This study was supported by funds from the National Institutes of Health, National Heart, Lung, and Blood Institute (R01 HL135158 to ASL, R01 HL142672 to Dr Giani), and the University of Kentucky Center of Research in Obesity and Cardiovascular Disease COBRE P20 GM103527.

Disclosures

None.

This manuscript was sent to Julie K. Freed, MD, PhD, Associate Editor, for review by expert referees, editorial decision, and final disposition.

For Sources of Funding and Disclosures, see page 10.

References

  • 1. Ostchega Y, Fryar CD, Nwankwo T, Nguyen DT. Hypertension prevalence among adults aged 18 and over: United States, 2017–2018 . CDC, National Center for Health Statistics (NCHS) Data Brief. 2020;(364):1–8. [PubMed]
  • 2. Li Y, Pan A, Wang DD, Liu X, Dhana K, Franco OH, Kaptoge S, Di Angelantonio E, Stampfer M, et al. Impact of healthy lifestyle factors on life expectancies in the US population. Circulation. 2018;138:345–355. doi: 10.1161/CIRCULATIONAHA.117.032047 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Gay HC, Rao SG, Vaccarino V, Ali MK. Effects of different dietary interventions on blood pressure: systematic review and meta‐analysis of randomized controlled trials. Hypertension. 2016;67:733–739. doi: 10.1161/HYPERTENSIONAHA.115.06853 [DOI] [PubMed] [Google Scholar]
  • 4. Couch SC, Saelens BE, Khoury PR, Dart KB, Hinn K, Mitsnefes MM, Daniels SR, Urbina EM. Dietary approaches to stop hypertension dietary intervention improves blood pressure and vascular health in youth with elevated blood pressure. Hypertension. 2021;77:241–251. doi: 10.1161/HYPERTENSIONAHA.120.16156 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Corlin L, Liu C, Lin H, Leone D, Yang Q, Ngo D, Levy D, Cupples LA, Gerszten RE, Larson MG, et al. Proteomic signatures of lifestyle risk factors for cardiovascular disease: a cross‐sectional analysis of the plasma proteome in the Framingham Heart Study. J Am Heart Assoc. 2021;10:e018020. doi: 10.1161/JAHA.120.018020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Pretty C, O'Leary DD, Cairney J, Wade TJ. Adverse childhood experiences and the cardiovascular health of children: a cross‐sectional study. BMC Pediatr. 2013;13:208. doi: 10.1186/1471-2431-13-208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Danese A, Moffitt TE, Harrington H, Milne BJ, Polanczyk G, Pariante CM, Poulton R, Caspi A. Adverse childhood experiences and adult risk factors for age‐related disease: depression, inflammation, and clustering of metabolic risk markers. Arch Pediatr Adolesc Med. 2009;163:1135–1143. doi: 10.1001/archpediatrics.2009.214 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Felitti VJ, Anda RF, Nordenberg D, Williamson DF, Spitz AM, Edwards V, Koss MP, Marks JS. REPRINT OF: relationship of childhood abuse and household dysfunction to many of the leading causes of death in adults: the adverse childhood experiences (ACE) study. Am J Prev Med. 2019;56:774–786. doi: 10.1016/j.amepre.2019.04.001 [DOI] [PubMed] [Google Scholar]
  • 9. Rich‐Edwards JW, Mason S, Rexrode K, Spiegelman D, Hibert E, Kawachi I, Jun HJ, Wright RJ. Physical and sexual abuse in childhood as predictors of early‐onset cardiovascular events in women. Circulation. 2012;126:920–927. doi: 10.1161/CIRCULATIONAHA.111.076877 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Su S, Jimenez MP, Roberts CT, Loucks EB. The role of adverse childhood experiences in cardiovascular disease risk: a review with emphasis on plausible mechanisms. Curr Cardiol Rep. 2015;17:88. doi: 10.1007/s11886-015-0645-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Ojeda NB, Grigore D, Alexander BT. Developmental programming of hypertension: insight from animal models of nutritional manipulation. Hypertension. 2008;52:44–50. doi: 10.1161/HYPERTENSIONAHA.107.092890 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Hsu CN, Tain YL. Targeting the renin‐angiotensin‐aldosterone system to prevent hypertension and kidney disease of developmental origins. Int J Mol Sci. 2021;22: 2298. doi: 10.3390/ijms22052298 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Nuyt AM, Alexander BT. Developmental programming and hypertension. Curr Opin Nephrol Hypertens. 2009;18:144–152. doi: 10.1097/MNH.0b013e328326092c [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Murphy MO, Cohn DM, Loria AS. Developmental origins of cardiovascular disease: impact of early life stress in humans and rodents. Neurosci Biobehav Rev. 2017;74:453–465. doi: 10.1016/j.neubiorev.2016.07.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Murphy MO, Herald JB, Leachman J, Villasante Tezanos A, Cohn DM, Loria AS. A model of neglect during postnatal life heightens obesity‐induced hypertension and is linked to a greater metabolic compromise in female mice. Int J Obes (Lond). 2018;42:1354–1365. doi: 10.1038/s41366-018-0035-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Dalmasso C, Leachman JR, Ghuneim S, Ahmed N, Schneider ER, Thibault O, Osborn JL, Loria AS. Epididymal fat‐derived sympathoexcitatory signals exacerbate neurogenic hypertension in obese male mice exposed to early life stress. Hypertension. 2021;78:1434–1449. doi: 10.1161/HYPERTENSIONAHA.121.17298 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Dalmasso C, Leachman JR, Ensor CM, Yiannikouris FB, Giani JF, Cassis LA, Loria AS. Female mice exposed to postnatal neglect display angiotensin II‐dependent obesity‐induced hypertension. J Am Heart Assoc. 2019;8:e012309. doi: 10.1161/JAHA.119.012309 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Leachman JR, Cincinelli C, Ahmed N, Dalmasso C, Xu M, Gatineau E, Nikolajczyk BS, Yiannikouris F, Hinds TD Jr, Loria AS. Early life stress exacerbates obesity in adult female mice via mineralocorticoid receptor‐dependent increases in adipocyte triglyceride and glycerol content. Life Sci. 2022;304:120718. doi: 10.1016/j.lfs.2022.120718 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Leachman JR, Rea MD, Cohn DM, Xu X, Fondufe‐Mittendorf YN, Loria AS. Exacerbated obesogenic response in female mice exposed to early life stress is linked to fat depot‐specific upregulation of leptin protein expression. Am J Physiol Endocrinol Metab. 2020;319:E852–E862. doi: 10.1152/ajpendo.00243.2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. King VL, English VL, Bharadwaj K, Cassis LA. Angiotensin II stimulates sympathetic neurotransmission to adipose tissue. Physiol Rep. 2013;1: e00014. doi: 10.1002/phy2.14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Miller AJ, Arnold AC. The renin‐angiotensin system in cardiovascular autonomic control: recent developments and clinical implications. Clin Auton Res. 2019;29:231–243. doi: 10.1007/s10286-018-0572-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Basu R, Poglitsch M, Yogasundaram H, Thomas J, Rowe BH, Oudit GY. Roles of angiotensin peptides and recombinant human ACE2 in heart failure. J Am Coll Cardiol. 2017;69:805–819. doi: 10.1016/j.jacc.2016.11.064 [DOI] [PubMed] [Google Scholar]
  • 23. Haschke M, Schuster M, Poglitsch M, Loibner H, Salzberg M, Bruggisser M, Penninger J, Krähenbühl S. Pharmacokinetics and pharmacodynamics of recombinant human angiotensin‐converting enzyme 2 in healthy human subjects. Clin Pharmacokinet. 2013;52:783–792. doi: 10.1007/s40262-013-0072-7 [DOI] [PubMed] [Google Scholar]
  • 24. Wang K, Gheblawi M, Oudit GY. Angiotensin converting enzyme 2: a double‐edged sword. Circulation. 2020;142:426–428. doi: 10.1161/CIRCULATIONAHA.120.047049 [DOI] [PubMed] [Google Scholar]
  • 25. Eriguchi M, Lin M, Yamashita M, Zhao TV, Khan Z, Bernstein EA, Gurley SB, Gonzalez‐Villalobos RA, Bernstein KE, Giani JF. Renal tubular ACE‐mediated tubular injury is the major contributor to microalbuminuria in early diabetic nephropathy. Am J Physiol Renal Physiol. 2018;314:F531–F542. doi: 10.1152/ajprenal.00523.2017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Wosten‐van Asperen RM, Lutter R, Haitsma JJ, Merkus MP, van Woensel JB, van der Loos CM, Florquin S, Lachmann B, Bos AP. ACE mediates ventilator‐induced lung injury in rats via angiotensin II but not bradykinin. Eur Respir J. 2008;31:363–371. doi: 10.1183/09031936.00060207 [DOI] [PubMed] [Google Scholar]
  • 27. Ahmed N, Kassis A, Malone J, Yang J, Zamzami E, Lin AH, Gordon SM, Gong MC, Bardo M, Dalmasso C, et al. Prenatal morphine exposure increases cardiovascular disease risk and programs neurogenic hypertension in the adult offspring. Hypertension. 2023;80:1283–1296. doi: 10.1161/HYPERTENSIONAHA.122.20262 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Hall JE, da Silva AA, J.M. do Carmo JD, Hamza S, Munusamy S, Smith G, Stec DE. Obesity‐induced hypertension: role of sympathetic nervous system, leptin, and melanocortins. J Biol Chem. 2010;285:17271–17276. doi: 10.1074/jbc.R110.113175 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Calligaris SD, Lecanda M, Solis F, Ezquer M, Gutierrez J, Brandan E, Leiva A, Sobrevia L, Conget P. Mice long‐term high‐fat diet feeding recapitulates human cardiovascular alterations: an animal model to study the early phases of diabetic cardiomyopathy. PLoS One. 2013;8:e60931. doi: 10.1371/journal.pone.0060931 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Bruder‐Nascimento T, Ekeledo OJ, Anderson R, Le HB, Belin de Chantemele EJ. Long term high fat diet treatment: an appropriate approach to study the sex‐specificity of the autonomic and cardiovascular responses to obesity in mice. Front Physiol. 2017;8:32. doi: 10.3389/fphys.2017.00032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Chaar LJ, Coelho A, Silva NM, Festuccia WL, Antunes VR. High‐fat diet‐induced hypertension and autonomic imbalance are associated with an upregulation of CART in the dorsomedial hypothalamus of mice. Physiol Rep. 2016;4: e12811. doi: 10.14814/phy2.12811 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Rahmouni K, Morgan DA, Morgan GM, Mark AL, Haynes WG. Role of selective leptin resistance in diet‐induced obesity hypertension. Diabetes. 2005;54:2012–2018. doi: 10.2337/diabetes.54.7.2012 [DOI] [PubMed] [Google Scholar]
  • 33. Leachman JR, Heier K, Lei F, Ahmed N, Dalmasso C, Duncan MS, Loria AS. Sex and race define the effects of adverse childhood experiences on self‐reported BMI and metabolic health biomarkers. Biol Sex Differ. 2022;13:29. doi: 10.1186/s13293-022-00439-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Ding L, Kang Y, Dai HB, Wang FZ, Zhou H, Gao Q, Xiong XQ, Zhang F, Song TR, Yuan Y, et al. Adipose afferent reflex is enhanced by TNFalpha in paraventricular nucleus through NADPH oxidase‐dependent ROS generation in obesity‐related hypertensive rats. J Transl Med. 2019;17:256. doi: 10.1186/s12967-019-2006-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Ding L, Zhang F, Zhao MX, Ren XS, Chen Q, Li YH, Kang YM, Zhu GQ. Reduced lipolysis response to adipose afferent reflex involved in impaired activation of adrenoceptor‐cAMP‐PKA‐hormone sensitive lipase pathway in obesity. Sci Rep. 2016;6:34374. doi: 10.1038/srep34374 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Xiong XQ, Chen WW, Zhu GQ. Adipose afferent reflex: sympathetic activation and obesity hypertension. Acta Physiol (Oxf). 2014;210:468–478. doi: 10.1111/apha.12182 [DOI] [PubMed] [Google Scholar]
  • 37. Dalmasso C, Leachman JR, Osborn JL, Loria AS. Sensory signals mediating high blood pressure via sympathetic activation: role of adipose afferent reflex. Am J Physiol Regul Integr Comp Physiol. 2020;318:R379–R389. doi: 10.1152/ajpregu.00079.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Zimmerman MC, Lazartigues E, Sharma RV, Davisson RL. Hypertension caused by angiotensin II infusion involves increased superoxide production in the central nervous system. Circ Res. 2004;95:210–216. doi: 10.1161/01.RES.0000135483.12297.e4 [DOI] [PubMed] [Google Scholar]
  • 39. Mehta PK, Griendling KK. Angiotensin II cell signaling: physiological and pathological effects in the cardiovascular system. Am J Physiol Cell Physiol. 2007;292:C82–C97. doi: 10.1152/ajpcell.00287.2006 [DOI] [PubMed] [Google Scholar]
  • 40. Grobe JL, Grobe CL, Beltz TG, Westphal SG, Morgan DA, Xu D, de Lange WJ, Li H, Sakai K, Thedens DR, et al. The brain renin‐angiotensin system controls divergent efferent mechanisms to regulate fluid and energy balance. Cell Metab. 2010;12:431–442. doi: 10.1016/j.cmet.2010.09.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Hilzendeger AM, Cassell MD, Davis DR, Stauss HM, Mark AL, Grobe JL, Sigmund CD. Angiotensin type 1a receptors in the subfornical organ are required for deoxycorticosterone acetate‐salt hypertension. Hypertension. 2013;61:716–722. doi: 10.1161/HYPERTENSIONAHA.111.00356 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Xu J, Sriramula S, Xia H, Moreno‐Walton L, Culicchia F, Domenig O, Poglitsch M, Lazartigues E. Clinical relevance and role of neuronal AT(1) receptors in ADAM17‐mediated ACE2 shedding in neurogenic hypertension. Circ Res. 2017;121:43–55. doi: 10.1161/CIRCRESAHA.116.310509 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Sandgren JA, Linggonegoro DW, Zhang SY, Sapouckey SA, Claflin KE, Pearson NA, Leidinger MR, Pierce GL, Santillan MK, Gibson‐Corley KN, et al. Angiotensin AT(1A) receptors expressed in vasopressin‐producing cells of the supraoptic nucleus contribute to osmotic control of vasopressin. Am J Physiol Regul Integr Comp Physiol. 2018;314:R770–R780. doi: 10.1152/ajpregu.00435.2017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Stern JE, Son S, Biancardi VC, Zheng H, Sharma N, Patel KP. Astrocytes contribute to angiotensin II stimulation of hypothalamic neuronal activity and sympathetic outflow. Hypertension. 2016;68:1483–1493. doi: 10.1161/HYPERTENSIONAHA.116.07747 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Nakagawa P, Sigmund CD. How is the brain renin‐angiotensin system regulated? Hypertension. 2017;70:10–18. doi: 10.1161/HYPERTENSIONAHA.117.08550 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Sigmund CD, Grobe JL. A colorful view of the brain renin‐angiotensin system. Hypertens Res. 2020;43:357–359. doi: 10.1038/s41440-020-0396-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Mehay D, Silberman Y, Arnold AC. The arcuate nucleus of the hypothalamus and metabolic regulation: an emerging role for renin‐angiotensin pathways. Int J Mol Sci. 2021;22:7050. doi: 10.3390/ijms22137050 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Harding JW, Felix D. Angiotensin‐sensitive neurons in the rat paraventricular nucleus: relative potencies of angiotensin II and angiotensin III. Brain Res. 1987;410:130–134. doi: 10.1016/S0006-8993(87)80033-1 [DOI] [PubMed] [Google Scholar]
  • 49. Wright JW, Tamura‐Myers E, Wilson WL, Roques BP, Llorens‐Cortes C, Speth RC, Harding JW. Conversion of brain angiotensin II to angiotensin III is critical for pressor response in rats. Am J Physiol Regul Integr Comp Physiol. 2003;284:R725–R733. doi: 10.1152/ajpregu.00326.2002 [DOI] [PubMed] [Google Scholar]
  • 50. Reaux‐Le Goazigo A, Iturrioz X, Fassot C, Claperon C, Roques BP, Llorens‐Cortes C. Role of angiotensin III in hypertension. Curr Hypertens Rep. 2005;7:128–134. doi: 10.1007/s11906-005-0087-z [DOI] [PubMed] [Google Scholar]
  • 51. Fournie‐Zaluski MC, Fassot C, Valentin B, Djordjijevic D, Reaux‐Le Goazigo A, Corvol P, Roques BP, Llorens‐Cortes C. Brain renin‐angiotensin system blockade by systemically active aminopeptidase a inhibitors: a potential treatment of salt‐dependent hypertension. Proc Natl Acad Sci U S A. 2004;101:7775–7780. doi: 10.1073/pnas.0402312101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Ferdinand KC, Balavoine F, Besse B, Black HR, Desbrandes S, Dittrich HC, Nesbitt SD. Efficacy and safety of firibastat, a first‐in‐class brain aminopeptidase a inhibitor, in hypertensive overweight patients of multiple ethnic origins. Circulation. 2019;140:138–146. doi: 10.1161/CIRCULATIONAHA.119.040070 [DOI] [PubMed] [Google Scholar]

Articles from Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease are provided here courtesy of Wiley

RESOURCES