Abstract
Toothache is one of the most common types of pain, but the mechanisms underlying pulpitis-induced pain remain unknown. The ionotropic purinergic receptor family (P2X) is reported to mediate nociception in the nervous system. This study aims to investigate the involvement of P2X3 in the sensitisation of the trigeminal ganglion (TG) and the inflammation caused by acute pulpitis. An acute tooth inflammation model was established by applying LPS to the pulp of SD rats. We found that the increased expression of P2X3 was induced by acute pulpitis. A selective P2X3 inhibitor (A-317491) reduced pain-like behavior in the maxillofacial region of rats and depressed the activation of neurons in the trigeminal ganglion induced by pulpitis. The upregulated MAPK signaling (p-p38, p-ERK1/2) expression in the ipsilateral TG induced by pulpitis could also be depressed by the application of the P2X3 inhibitor. Furthermore, the expression of markers of inflammatory processes, such as NF-κB, TNF-α and IL-1β, could be induced by acute pulpitis and deduced by the intraperitoneal injection of P2X3 antagonists. Our findings demonstrate that purinergic P2X3 receptor signaling in TG neurons contributes to pulpitis-induced pain in rats and that P2X3 signaling may be a potential therapeutic target for tooth pain.
Keywords: P2X3, oral-facial pain, inflammation, trigeminal nerve, nervous system
Introduction
Toothache is the most common type of pain, and pulpitis is the primary cause. 1 Acute pulpitis has very typical pain symptoms. The infection of pulpitis in one tooth can cause severe pain in that tooth and the adjacent teeth, resulting in ipsilateral chewing pain; the pulpitis of the tooth can even cause spontaneous pain in the face or head on the same side. 2 Understanding the neurobiological mechanisms underlying toothache is a prerequisite for effective management. The dental pulp is densely packed with nerve fibres that originate from trigeminal ganglion (TG) neurons. The trigeminal nerve contains the primary afferent nerves that innervate the maxillofacial sensation, collect sensory information from the face, mouth and nose, integrate and modulate pain information and transmit information into the central nervous system.3,4 Multiple stimuli (e.g., mechanical, thermal and chemical) can act on dental pulp nociceptors, activate various specific receptors or ion channels on trigeminal nerve sensory fibres, activate TG neurons and transmit noxious information to the cerebral cortex. Pulp inflammation causes various pain symptoms, including spontaneous pain, hyperalgesia and allodynia, 5 the mechanisms of which are not fully understood.
Purinoceptors containing the P2X3 subunit belong to the P2X family of ATP-gated ion channels and may participate in primary afferent sensitisation in various pain-related diseases.6,7 When pulpitis occurs, both tissues and nerve endings release ATP, which activates ionotropic purinergic receptors in paracrine and autocrine ways. These receptors regulate afferent sensory pathways when pulp inflammation causes pain. 8 In 1997, Cook et al. discovered that ATP can generate action potentials in nociceptive neurons that innervate the dental pulp, which was the first report on the involvement of the purine signalling pathway and P2X receptors in pain transmission. 9 P2X3 receptors are found largely in small-diameter and medium-diameter unmyelinated C-fibre sensory neurons. 10 Owing to the importance of C-fibre sensory neurons in noxious stimulus detection in damaged dorsosensitive tissues, P2X3-containing channels have emerged as targets of significant interest for treating certain types of pain and visceral sensory function disorders. 11 In a rat model of chronic trigeminal neuralgia, A-317491 reduces P2X3 receptor expression in the rat TG, inhibits mechanical hyperalgesia, and relieves neuropathic pain. 12 In the maxillofacial neuralgia model, P2X3 expression in the TG is upregulated, revealing that the P2X3 receptor may be a potential target for treating chronic temporomandibular joint or masseter pain. 13 Notably, when masseter muscle inflammation occurs, P2X3 receptor expression in TG neurons increases, resulting in masseter muscle hyperalgesia in rats. 14 However, although different mechanisms are involved in pain causation in lipopolysaccharide (LPS)-induced dental pulp inflammation and neuropathic pain, whether P2X3 is also involved in acute pulpitis-induced pain remains unclear. Therefore, in this study, we investigated the mechanisms underlying LPS-induced pulpal pain and determined whether this pain activates P2X3 and c-fos expression in TG neurons. The specific goals are as follows: (1) to establish a pulpitis rat model and verify pulpitis progression via pulp histology and serum cytokine detection; (2) to assess nociceptive behaviour using head withdrawal reflex threshold measurements and face-grooming activity; (3) to determine whether LPS-induced pulpitis activates P2X3 signalling expression and TG neuronal activities; and (4) to investigate the rescue effect of P2X3 channel inhibition on the nociceptive response. Overall, this study provides possible clinical treatment strategies for severe dental pain-related diseases.
Materials and methods
Animals
Male Wistar rats (300–400 g; Hubei Experimental Animal Centre) were housed under a 12:12 light/dark cycle with food and water available ad libitum in our animal facility for at least 1 week before the experiments. The experimental procedure was approved by the Ethics Committee of the School of Stomatology, Wuhan University (SO792109OQ), and the study followed the guidelines of the International Association for the Study of Pain. The authors also followed the Animal Research: Reporting In Vivo Experiments Guidelines.
Experimental groups and acute pulpitis model
There are 4 experimental groups, including the LPS-1 group, LPS-3 group, LPS-1A group and LPS-3A group. The rats in experimental groups were anaesthetised with sodium pentobarbital (50 mg/kg) intraperitoneally. To establish the acute pulpitis model in the experimental groups, an occlusal class I cavity was prepared on the upper left first molar of the rats, and the pulpotomy was done. After the pulpal bleeding had subsided, LPS (Escherichia coli; Sigma, St Louis, Missouri, USA; 6–10 mg/tooth, dissolved in 0.9% NaCl) was applied to the cavity which was then sealed with a self-curing glass ionomer (Fuji II LC;GC Corporation, Tokyo, Japan). The rats in the LPS-1 group were scarified after 1 day to harvest the trigeminal ganglion and the blood, and the rats in the LPS-3 group were scarified after 3 days. The rats in the LPS-1A and LPS-3A groups were injected intraperitoneally with the selective P2X3 inhibitor A-317491 (Sigma, St Louis, Missouri, USA; 0.5 mg/kg, dissolved in 0.9% NaCl) immediately after LPS application, and scarified after 1 day and 3 days respectively. The SHAM operation group without any other intervention were used as the control group.
Behavioural testing
The intensity of pulpitis-induced pain was assessed in each group of rats by recording ipsilateral face-grooming activities and measuring the ipsilateral head retraction reflex threshold on day 1 or day 3 postsurgery. The rats were acclimated to a test chamber for 10 min before testing. The test chamber comprised a metal mesh floor beneath a single plexiglass box on an elevated table. In all tests, animal responses were recorded on an overhead video-tracking system placed vertically 2 m above the test arena. Spontaneous face-grooming activities were monitored and videotaped for 10 min, and the total duration of face-grooming events was evaluated. Referencing the method of Ballonl, 15 an electronic von Frey instrument (24501; Shanghai, China) was used to test the degree of pulpitis pain in rats. The rats were acclimated in cages for 1 h before testing. The rat for testing was placed in a metal mesh cage with a size of approximately 15 × 5 × 5 cm without restricting head movement. The left moustache pad which innerved by the trigeminal nerve of the rats was mechanically stimulated by the von Frey filament every 3 s. The threshold value which induce the head restriction was recorded for a total of three tests, and the average of the three measurements was used to determine the head retraction threshold. An observer blinded to the animal groupings then analysed the results.
Hematoxylin and eosin staining of dental pulp
To verify pulp inflammation, the upper left tooth was stained with hematoxylin and eosin. Neutrophil infiltration is considered a criterion for pulpal inflammation. At the selected time points (d1 and d3), each rat was deeply anaesthetised with sodium pentobarbital (50 mg/kg) and then sacrificed by transcardiac perfusion with saline. The left maxillary bone with intact first molar was taken, immediately placed in 4% paraformaldehyde, and fixed at 4°C for 24 h. Rat maxillae were decalcified in ethylenediaminetetraacetic acid (EDTA) (41.3 g disodium EDTA, 4.4 g NaOH dissolved in 1000 mL distilled water) for 30 days. Decalcified maxillae were dehydrated in graded alcohol solutions ranging from 30% to 100%, cleared with xylene, embedded in paraffin, and cooled at 2°C–8°C. The embedded specimens were sectioned with a rotary microtome to obtain 4 μm thick sections that were stained with hematoxylin and eosin, sealed with a lipid-soluble gel and observed under a microscope.
Immunohistochemistry
At the selected time points (d1 and d3), each rat was deeply anaesthetised with sodium pentobarbital (50 mg/kg) and then perfused transcardially with saline, followed by 4% paraformaldehyde fixative for 10 min. The harvested TG divisions were postfixed for 8 h. Transverse sections (12 μm) were obtained using a cryostat (Leica, Wetzlar, Germany). The sections of trigeminal ganglion were incubated overnight with anti-P2X3 antibodies (rabbit, 1:100 in PBS; Alomone Labs Ltd, Jerusalem, Israel), anti-c-fos (goat, 1:200 in PBS; Abcam Inc., USA), or mouse anti-rat neuronal nuclei (NeuN, 1:100; Millipore, USA). A negative control for immunostaining was performed, in which the sections were incubated with nonimmune sera from the same species as the primary antibody. After being washed with 0.1 M PBS, sections were incubated for 1 h with Cy3-conjugated goat anti-rabbit IgG and Alexa Fluor 488-conjugated goat anti-mouse IgG for double immunofluorescence staining. The sections were sealed after being dripped with anti-attenuation fluorescent film sealer and stored away from light. At least four randomly selected discontinuous fields (20x) per sample were evaluated. The researchers obtained images of immunohistochemical results by light microscopy and digital camera and analysed the immunostaining results using Image-Pro Plus 6.0 image analysis software (Media Cybernctic Inc., USA). The mean area of positive staining in each image percentage and the mean integrated optical density were counted. For immunofluorescence dual-label staining, images were collected using a Leica SP5 confocal microscope (Leica) and sequentially recorded using Leica Application Suite Software (Leica). Nine randomly selected discontinuous scenes (20x) for each sample were evaluated.
RT‒PCR assay
The anaesthesia method was described above at selected time points (d1 and d3); rats in different groups were sacrificed by cardiac perfusion with saline, and the bilateral TG was quickly removed and freeze-dried. RNA isolated from rat TG was used for the RT‒qPCR assay of P2X3 mRNA expression. Total RNA from tissues was extracted using TRIzol reagent following the manufacturer’s instructions (Takara). RNA was transcribed to cDNA using the PrimeScript RT kit (Takara). RT‒qPCR was then performed using the CFX96TM Real Time System (Bio-Rad), and the relative gene expression was normalised to the internal control β-actin. The specificity of amplification was controlled by analysing the melting curves of each amplified PCR product and visualising the PCR amplicons on a 1.5% agarose gel. The primer sequences of the target gene SYBR Green probe are as follows: R-GAPDH-S:CTGGAGAAACCTGCCAAGTATG; R-GAPDH-A:GGTGGAAGAATGGGAGTTGCT; R-P2X3-S:ATAAGATGGAGAACGGCAGCG; and R-P2X3-A:TCAGTGTTGTCTCAGTCACCTCCT.
Western blotting assay
After the rats were anaesthetised by the same anaesthesia method described above, at the selected time points (day 1 and day 3), the rats in different groups were sacrificed by cardiac perfusion with 500 mL of normal saline, and the bilateral TGs were quickly removed and placed into a homogeniser for crushing. Then, an appropriate amount of protein lysis buffer (0.75 mL/100 mg) and protease inhibitor (1/100x protein lysis buffer) were added. The tissue samples were homogenised using ultrasound in an ice bath and centrifuged at 12,000 r/min at 4°C for 15 min, and the supernatant was collected for protein content determination. Protein content was determined using a bicinchoninic acid (BCA) kit (Sigma). The same amount of protein was used for western blotting. Equal amounts of proteins were separated using SDS-polyacrylamide gel electrophoresis (10%) and transferred to polyvinylidene fluoride membranes (Millipore). The samples were resolved in 10% SDS‒PAGE gels and transferred to polyvinylidene fluoride membranes. After blocking in 5% nonfat dry milk for 1 h, membranes were mixed with P2X3 (1:1000; Alomone Labs), p38 (1:500; Millipore), ERK1/2 (1:500; Chemicon), anti-NF-κB (p65) (Abcam, ab32536, 1:5000) and anti-NF-κB (p50) (Abcam, ab32360, 1:1000) antibodies overnight at 4°C. Subsequently, the membrane was reacted with horseradish peroxidase-conjugated IgG antibody (Pierce Biotechnology) for 2 h at room temperature. After extensive washing, the blot was developed using the SuperSignal West Pico Chemiluminescent Substrate Kit (Pierce Biotechnology). For the total protein, β-actin (anti-β-actin: Abcam, ab179467, 1:5000) was used as a loading control. The optical density in the IR band was analysed using Image-Pro Plus software on the gel analysis system.
ELISA detection
To detect cytokine levels, blood was collected from the right atrial appendage of rats under sterile conditions and filled in tubes without anticoagulants. Serum was separated from the collected blood by centrifugation at 3000 r/min for 15 min. The concentrations of IL-1β and TNF-α were determined following the instructions in the ELISA kits (Sigma). Each cytokine sample was run in duplicate, and the mean cytokine concentration was calculated.
Statistical analysis
All data are expressed as the mean ± SEM. Statistical analyses were performed by Student’s t test, one-way analysis of variance (ANOVA), or two-way repeated-measures ANOVA, followed by Bonferroni’s multiple comparison tests, where appropriate. A value of p < .05 was considered statistically significant.
Results
Pulp inflammation
Paraffin-embedded sections of the left maxillary first molar of rats were observed 1 day and 3 days after pulpectomy and LPS application. HE results clearly demonstrated the status and progression of pulpitis. Figure 1(a) showed intact dentin and normal pulp tissue, no debris and no inflammatory cell infiltration in the pulp cavity (Figure 1(d) and (g)). Figure 1(b) shows the morphology of opened pulp cavity of the rat molar, from where the LPS was placed. Debris and inflammatory tissue could be observed below the opened cavity. In the pulp chamber near the opening cavity, inflammatory cells infiltrated the pulp, and blood vessels in the inflammatory area were dilated (Figure 1(e) and (h)). However, the coronal pulp far from the cavity and the root pulp were still normal. After 3 days of LPS application, a large number of inflammatory cells were infiltrated below the opened cavity in the crown (Figure 1(c)), microvascular dilation was observed, and the number of inflammatory cells was significantly increased compared with that in the LPS-1d group (Figure 1(f) and (k)). HE results not only showed that the LPS application to the pulp induced inflammation in the pulp cavity, but also showed that the extent of the inflammatory increased and progressed over time.
Figure 1.
Hematoxylin and eosin staining of left upper first molar in different groups. SHAM group (a), LPS-1 group (b), LPS-3 group (c) pulp tissues were compared (Scale bar = 500 μm). (d)-(f) Figures present enlarged black squares in (a)-(c) and show the extent of the inflammation in the dental cavity, respectively (Scale bar = 100 μm). (g)-(i) Figures indicate enlarged black squares in (d)-(f), respectively (Scale bar = 50 μm). n = 6 for each group.
LPS-induced nociceptive response
To analyze the pain behavior in rats induced by LPS, this study compared the face-grooming behavior and head-withdrawal reflex threshold (HWT) activities of the rats in each group. Compared to the SHAM group, face-grooming time was significantly increased at 1 day and 3 days after LPS application (p < .01, Figure 2(a)). Furthermore, the HWTs to mechanical stimulation were also significantly decreased in the LPS-1 group and LPS-3 group (p < .01, Figure 2(b)). Compared with the LPS-1 group or the LPS-3 group, the spontaneous behavior and nociceptive reflexes of the rats were reversed to baseline on both 1 day and 3 days after administration of the antagonist of P2X3 (p < .01, Figure 2(a) and (b)). These results suggest that LPS-induced pulpitis increases spontaneous behavior and nociceptive reflex in rats, leading to orofacial pain in rats, and antagonism of P2X3 can alleviate this pain to some extent.
Figure 2.
Behavioral analysis after LPS-induced pulpitis. (a) LPS-induced face grooming behaviors are illustrated and compared with each group. Each graph shows the duration of grooming behaviors. (b) Mechanical HWTs at different time points in pulpitis rats. **p < .01 versus SHAM group; ##p < .01 versus LPS-1 group; &&p < .01 versus LPS-3 group; n = 6 for each group.
LPS-induced dental pulp inflammation increases the expression of P2X3 in the trigeminal ganglion
Immunohistochemistry results showed that the expression of P2X3 in the TG of each group. The expression of P2X3 in the left TG was significantly upregulated both 1 day (LPS-1 group) and 3 days (LPS-3 group) after LPS-induced pulp inflammation (p < .01, Figure 3(a) and (b)) compared with the SHAM group. After administration of the P2X3 antagonist A-317491, the expression of P2X3 in the left TG of the LPS-1A and LPS-3A groups was significantly decreased (p < .01, Figure 3(a) and (b)). The results of RT‒qPCR and western blotting also showed that compared with the SHAM group, the expression of P2X3 in the left TGs of the LPS-1 group and LPS-3 group was significantly upregulated (p < .01, Figure 3(c) and (d)). After administration of the P2X3 antagonist A-317491, the expression of P2X3 in the left TG was significantly downregulated (p < .01, Figure 3(c) and (d)).
Figure 3.
LPS induced upregulation of P2X3 expression in the ipsilateral TG. (a) Representative pictures of immunohistochemical labelling for P2X3 in the TG at different time points in pulpitis rats. Some neurons with P2X3 immunopositive nuclei are marked by arrowheads. Red arrows mark neurons with small diameters, blue arrows mark neurons with medium diameters (Bar = 50 μm). (b) The percentage of immunohistochemically positive area of p2x3 expressed in TG was quantitatively analysed. (c) Representative immunoblots of samples from rat TGs subjected to pulpitis model with quantitative densitometric analysis of P2X3 protein with β-actin as an internal standard. The immunoblots were obtained from the microgel running under the same experimental conditions. (d) Graphical representation of P2X3 mRNA expression in TGs. All the data are normalised to the left TG of the SHAM group. **p < .01 versus SHAM group; ##p < .01 versus LPS-1 group; &&p < .01 versus LPS-3 group; n = 6 for each group.
LPS-induced dental pulp inflammation increases neuronal activity and P2X3 expression in the trigeminal ganglion
The expression of c-fos is a marker of neuronal activation. To observe the neuronal activation in the TG caused by LPS stimulation of dental pulp, the expression of c-fos in the TG in each experimental group was observed in this experiment. Immunoreactivity of c-fos and P2X3 was observed in the trigeminal ganglion (TG). The results showed that the number of c-fos cells was significantly increased in the TG of the LPS-1 group and LPS-3 group compared to the sham group. Double-labelled staining revealed that the expression of P2X3 was also increased mainly in c-fos-positive neurons. Therefore, neurons in the TG were activated by LPS stimulation to the pulp of the left maxillary first molar, and the number of neurons expressing c-fos and P2X3 was also increased. (Figure 4).
Figure 4.
A Immunofluorescent staining of c-fos and P2X3 expression in the trigeminal ganglion. Representative photomicrographs of c-fos and P2X3 expression in 5 groups of rats. In the control group, c-fos was only slightly expressed in the TG, and almost no P2X3-positive neurons were found. The expression of c-fos in the LPS-1 group and LPS-3 group was significantly increased, and c-fos and P2X3 were coexpressed in neurons, the c-fos and P2X3 co-positive neurons were marked by white arrowheads. Scale bar: 100 µm. B Changes in the mean percentage of P2X3-IR and TNFR2-IR TG neurons on day1 and day3 following pulpitis. *p < .05 versus SHAM. (n = 6 in each).
LPS induced upregulated MAPK signaling expression in the TG ipsilateral to the inflammatory pulp
To observe whether the P2X3 receptor and MAPK pathway are related in the process of dental pulp inflammation, we detected the expression of p38 and ERK1/2 in the TG of each group of rats. Both immunoblotting and ELISA showed that LPS could increase the phosphorylation of p38 and ERK1/2 in TG, and the phosphorylation levels of p38 and ERK1/2 in TGs in the LPS-1 and LPS-3 groups were significantly higher than those in the SHAM group (p < 0.01, Figure 5). There was no significant difference between LPS-1 and LPS-3 (p < 0.01, Figure 5). Compared with the LPS-1 and LPS-3 groups, p-p38 and p-ERK1/2 were decreased in the LPS-1A and LPS-3A groups, indicating that inhibition of P2X3 can inhibit the phosphorylation of p38 and ERK1/2LPS.
Figure 5.
Representative immunoblot of a rat TG sample subjected to quantitative densitometry with β-actin/lamin B as an internal standard. Immunoblots were obtained from microgels run under the same experimental conditions. (a) Western blotting results showed the phosphorylation levels of p38 and ERK1/2 protein levels in the SHAM group, LPS-1 group, LPS-3 group, LPS-1A group and LPS 3A group. Histogram quantification shows phosphorylation of p38 and ERK1/2 protein levels in TGs of each group. (b) Western blotting results showed the NF-κB (in the nucleus) protein levels, and the histogram quantification shows phosphorylation of NF-κB protein levels in TGs of each group. (c) Results of ELISA for IL-1β and TNF-α in the TGs of different groups of rats: **p < .01 versus SHAM group; ##p < .01 versus LPS-1 group; &&p < .01 versus LPS-3 group; n = 6 for each group.
Discussion
Animal models of pulp inflammation have been widely used to study pain in oral medicine and the pathophysiological changes in the trigeminal nervous system caused by pain. 16 LPS is a component of the cell wall of gram-negative bacteria and is an endotoxin used to induce dental pulp inflammation. 17 In this study, we used LPS to induce an inflammatory response and confirmed acute pulpitis formation. Orofacial pain behaviours associated with inflammatory responses were observed on postoperative 1 day and 3 days. Immunohistochemistry revealed that P2X3 expression levels were upregulated in ipsilateral TGs during dental pulp inflammation. Furthermore, the selective P2X3 inhibitor A-317491 inhibited the increase in neuronal excitability after pulpitis and alleviated orofacial pain in rats. Therefore, P2X3 channels could modulate nociceptive signal processing in the peripheral nervous system during pulp inflammation.
In this experiment, histological changes of the pulpitis were observed at 1 day and 3 days after pulp stimulated by LPS. In this model, the progression of pulp inflammation changed over time. According to previous researches, the development of pulp inflammation at 1 day and 3 days is considered as a typical period of acute inflammation,18,19 but when pulp inflammation progresses till 7 days, various studies have different results. Tarsa et al. believed that pulp inflammation was still in the acute phase after 7 days, 20 but other scholars believed that the inflammation at 7 days progressed to chronic inflammation. 21 When pulp inflammation develops to 28 days, it is considered as chronic inflammation, and the inflammation has developed into the periapical area, resulting in periapical periodontitis and periapical abscess.22,23 In this case, the pain is not only transmitted by the nerves in the dental pulp, but also by the nerves innervated the periodontal ligaments surround the teeth and the alveolar bone. In this experiment, LPS induced pulpal inflammation in 1 day and 3 days, and the inflammation was confined inside the tooth and did not spread to the periodontal area. Therefore, this experiment only selected the acute inflammation period of 1 day and 3 days of pulp inflammation for research.
All the behavioral tests in this experiment showed that acute pulpitis induced ipsilateral oral and maxillofacial pain in rats on 1 day and 3 days after surgery, and the level of pain is consistent with the progression of inflammation. Abnormal behaviors in rats, such as increase in frequency of washing face, rubbing chin, scratching ears, licking paws and threshold reduction of head withdrawing, have been widely used in rats as a supplementary method for assessing oral and maxillofacial pain, and face-grooming is typically considered reliable symptoms of toothache. 24 Our study showed that LPS-induced pulpitis significantly induced the increase of the frequency of painful behaviors in rats, such as face-grooming, consistent with Cha et al. ’s findings. In addition, the pulpitis animals’ avoidance of mechanical stimulation was more pronounced in the HWT test. These results support our model demonstrating that maxillofacial pain induced by pulpitis in rats. Our studies also showed that the selective P2X3 inhibitor A-317491 significantly reduced acute pulpitis-induced nociception. These results indicate that a-317491 can inhibit pain sensitivity in pulpitis rats and reduce pain caused by pulpitis, suggesting that P2X3 receptor plays an important role in toothache.
P2X receptors play an important role in the generation, development and maintenance of pain in sensory nerves. P2X3 receptors are a subunit of ion channel-type purinoceptors that are selectively expressed on primary afferent sensory neurons. Previous studies have confirmed that ATP and P2X purinoceptors play an important role in the process of nociceptive signal transmission,25–28 and P2X3 receptor is closely related to pain transmission and may be involved in the occurrence of trigeminal neuralgia. Our results show that P2X3 expression in TG neurons is induced by pulpitis, especially in the small- and medium-diameter neurons in the TG. The sensory nerve fibers innervating the dental pulp are mainly unmyelinated C-fibers and small-diameter Aδ--fibers, which correspond to the small- and medium-diameter neurons in the TG. 29
Neurons can be activated by inflammation in their innervated areas, increasing sensitivity and transmitting nociceptive information to the central nervous system. C-Fos is an immediate early gene that is considered to be a marker of neuronal activation. When stimulated, the expression of c-fos in the neurons is rapidly and transiently upregulated. 30 Our results indicate that pulpitis can induce the increase of c-fos expression in TG neurons that innervate teeth, indicating that TG neurons can be activated by pulpitis.
Toothache is related to hyperalgesia of neurons in TG. Similar to other inflammatory pain, pulpitis also induces a series of neuroinflammatory responses in TG. 31 Neuroinflammation in the TG induces neuroplasticity and neuronal sensitivity, which are closely associated with diverse pain-related pathological states. The release of various chemical regulators from mast cells, macrophages and immune cells, such as 5-hydroxytryptamine (5-HT), histamine, interleukin (IL-1, IL-6, IL-8) and TNF-a was induced by pulpitis.32,33 These factors participate in local immune responses and act on nerve fibres, activating corresponding receptors or ion channels on sensory nerve endings, promoting neurotransmitter release, and inducing changes in the properties of neurons and ion channels, resulting in the production of other cells and recruitment of factors/chemokines and macrophages—these events are directly involved in the pathogenesis of ectopic pain and hyperalgesia, leading to hyperalgesia or allodynia. 34 Our results showed that pulpitis could lead to the activation of TG neurons and increase the expression of inflammatory factors, while inhibiting the activity of ion channel P2X3 could reduce the expression of inflammatory factors, indicating that P2X3 was involved in the neuroimmune response and the mutual regulation of inflammation and pain signals.
Our experimental results also showed that MAPK signaling pathway (p38 and ERK1/2) was involved in the neuroinflammatory process of pulpitis. Previous studies have shown that the MAPK pathway plays an important role in neuronal plasticity and the transmission of nociception by regulating cell transcription, protein synthesis and receptor expression. 35 In this study, when the P2X3 receptor was inhibited by A-317491, pulp inflammation-induced phosphorylation of p38 and ERK1/2 was inhibited. Notably, direct stimulation of the dental pulp with the P2X3 receptor agonist aβmeATP induces ERK phosphorylation in neurons of multiple sensory nuclei in the brainstem, whereas the administration of the P2X3 receptor inhibitor A-317491 in the pulp results in the inhibition of ERK phosphorylation. 36 In addition, TG target injection of PD98059, an ERK inhibitor, dose-dependently increased the mechanical pain threshold. 37 In this study, the results showed that with the development of pulpitis, the degree of pain, the expression of inflammatory factors and the phosphorylation of MAPK signal increased. When the P2X ion channel was inhibited, the degree of orofacial pain was reduced, and the expression of inflammatory factors and phosphorylation of MAPK signalling pathway were also inhibited. Therefore, both P2X3 receptor and MAPK signalling pathway are involved in the neuroinflammatory response in TG caused by pulpitis, and the P2X3 receptor and MAPK signalling pathway need to be further studied.
Footnotes
Author contributions: Yangxi Chen and Li Wang performed and planned experiments, analysed and interpreted data, and wrote the article; Yiqun Kang performed surgery, behavioral experiments, and optical imaging; Jun Hu contributed to data analysis; and Fang Qi planned experiments and contributed to writing the article. Tiejun Zhang studied concept and revision of the manuscript.
The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This research was by the National Natural Science Foundation of China (grant number: 82001073) to Li Wang and Natural Science Foundation of Hubei Province (grant number: 2022CFB046) to Tiejun Zhang.
ORCID iD
References
- 1.Jain N, Gupta A, Meena M. An insight into neurophysiology of pulpal pain: facts and hypotheses. Korean J Pain 2013; 26: 347–355. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Sessle BJ. Acute and chronic craniofacial pain: brainstem mechanisms of nociceptive transmission and neuroplasticity, and their clinical correlates. Crit Rev Oral Biol Med 2000; 11: 57–91. [DOI] [PubMed] [Google Scholar]
- 3.Agbaje JO, Van de Casteele E, Hiel M, Verbaanderd C, Lambrichts I, Politis C. Neuropathy of trigeminal nerve branches after oral and maxillofacial treatment. J Maxillofac Oral Surg 2016; 15: 321–327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Kim HY, Chung G, Jo HJ, Kim YS, Bae YC, Jung SJ, Kim JS, Oh SB. Characterization of dental nociceptive neurons. J Dent Res 2011; 90(6): 771–776. [DOI] [PubMed] [Google Scholar]
- 5.Sessle BJ. Acute and chronic craniofacial pain: brainstem mechanisms of nociceptive transmission and neuroplasticity, and their clinical correlates. Crit Rev Oral Biol Med 2000; 11: 57–91. [DOI] [PubMed] [Google Scholar]
- 6.Kaan TK, Yip PK, Grist J, Cefalu JS, Nunn PA, Ford APDW, Zhong Y, McMahon SB. Endogenous purinergic control of bladder activity via presynaptic P2X3 and P2X2/3 receptors in the spinal cord. J Neurosci 2010; 30: 4503–4507. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Ford AP, Cockayne DA. ATP and P2X purinoceptors in urinary tract disorders. Handb Exp Pharmacol 2011; 2011: 485–526. [DOI] [PubMed] [Google Scholar]
- 8.Goto T, Iwai H, Kuramoto E, Yamanaka A. Neuropeptides and ATP signaling in the trigeminal ganglion. Jpn Dent Sci Rev 2017; 53: 117–124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Cook SP, Vulchanova L, Hargreaves KM, Elde R, McCleskey EW. Distinct ATP receptors on pain-sensing and stretch-sensing neurons. Nature 1997; 387: 505–508. [DOI] [PubMed] [Google Scholar]
- 10.Nörenberg W, Illes P. Neuronal P2X receptors: localisation and functional properties. Naunyn-Schmiedeberg’s Arch Pharmacol 2000; 362: 324–339. [DOI] [PubMed] [Google Scholar]
- 11.Burnstock G. Purine and pyrimidine receptors. Cell Mol Life Sci 2007; 64: 1471–1483. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Qi D, Yang Y, Ji P, Kong J, Wu Q, Si H. Upregulation of the purinergic receptor subtype P2X3 in the trigeminal ganglion is involved in orofacial pain induced by occlusal interference in rats. J Oral Facial Pain Headache 2016; 30: 51–60. [DOI] [PubMed] [Google Scholar]
- 13.Shinoda M, Ozaki N, Asai H, Nagamine K, Sugiura Y. Changes in P2X3 receptor expression in the trigeminal ganglion following monoarthritis of the temporomandibular joint in rats. Pain 2005; 116: 42–51. [DOI] [PubMed] [Google Scholar]
- 14.Tariba Knežević P, Vukman R, Antonić R, Kovač Z, Uhač I, Simonić-Kocijan S. The role of P2X3 receptors in bilateral masseter muscle allodynia in rats. Croat Med J 2016; 57: 530–539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Ballon Romero SS, Lee YC, Fuh LJ, Chung HY, Hung SY, Chen YH. Analgesic and neuroprotective effects of electroacupuncture in a dental pulp injury model-A basic research. Int J Mol Sci 2020; 21: 2628. DOI: 10.3390/ijms21072628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Kwon M, Jung IY, Cha M, Lee BH. Inhibition of the Nav1.7 channel in the trigeminal ganglion relieves pulpitis inflammatory pain. Front Pharmacol 2021; 12: 759730. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Liu M, Chen L, Wu J, Lin Z, Huang S. Long noncoding RNA MEG3 expressed in human dental pulp regulates LPS-Induced inflammation and odontogenic differentiation in pulpitis. Exp Cell Res 2021; 400: 112495. [DOI] [PubMed] [Google Scholar]
- 18.Fan W, Huang F, Li C, Qu H, Gao Z, Leng S, Li D, He H. Involvement of NOS/NO in the development of chronic dental inflammatory pain in rats. Brain Res Rev 2009; 59: 324–332. [DOI] [PubMed] [Google Scholar]
- 19.Rittling SR, Zetterberg C, Yagiz K, Skinner S, Suzuki N, Fujimura A, Sasaki H. Protective role of osteopontin in endodontic infection. Immunology 2010; 129: 105–114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Tarsa L, Bałkowiec-Iskra E, Kratochvil FJ, Jenkins VK, McLean A, Brown AL, Smith JA, Baumgartner JC, Balkowiec A. Tooth pulp inflammation increases brain-derived neurotrophic factor expression in rodent trigeminal ganglion neurons. Neuroscience; 2010, 167: 1205–1215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Byers MR, Chudler EH, Iadarola MJ. Chronic tooth pulp inflammation causes transient and persistent expression of Fos in dynorphin-rich regions of rat brainstem. Brain Res 2000; 861: 191–207. [DOI] [PubMed] [Google Scholar]
- 22.Torneck CD, Kwan CL, Hu JW. Inflammatory lesions of the tooth pulp induce changes in brainstem neurons of the rat trigeminal subnucleus oralis. J Dent Res 1996; 75: 553–561. [DOI] [PubMed] [Google Scholar]
- 23.Liu Q, Gao Z, Zhu X, Wu Z, Li D, He H, Huang F, Fan W. Changes in nitric oxide synthase isoforms in the trigeminal ganglion of rat following chronic tooth pulp inflammation. Neurosci Lett 2016; 633: 240–245. DOI: 10.1016/j.neulet.2016.09.041. [DOI] [PubMed] [Google Scholar]
- 24.Cha M, Sallem I, Jang HW, Jung IY. Role of transient receptor potential vanilloid type 1 in the trigeminal ganglion and brain stem following dental pulp inflammation. Int Endod J 2020; 53: 62–71. [DOI] [PubMed] [Google Scholar]
- 25.Liu S, Wang M, Wang N, Li S, Sun R, Xing J, Wang Y, Yu S, Li L, Li G, Liang S. Exploring the molecular mechanism of the effect of puerarin on P2X(3). Int J Biol Macromol 2020; 142: 484–491. [DOI] [PubMed] [Google Scholar]
- 26.Villarejo-López L, Jiménez E, Bartolomé-Martín D, Zafra F, Lapunzina P, Aragón C, López-Corcuera B. P2X receptors up-regulate the cell-surface expression of the neuronal glycine transporter GlyT2. Neuropharmacology 2017; 125: 99–116. [DOI] [PubMed] [Google Scholar]
- 27.Krajewski JL. P2X3-Containing receptors as targets for the treatment of chronic pain. Neurotherapeutics 2020; 17: 826–838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Lemes JBP, de Campos Lima T, Santos DO, Neves AF, de Oliveira FS, Parada CA, da Cruz Lotufo CM. Participation of satellite glial cells of the dorsal root ganglia in acute nociception. Neurosci Lett 2018; 676: 8–12. [DOI] [PubMed] [Google Scholar]
- 29.Bender IB. Pulpal pain diagnosis--a review. J Endod 2000; 26: 175–179. [DOI] [PubMed] [Google Scholar]
- 30.Chattipakorn SC, Sigurdsson A, Light AR, Narhi M, Maixner W. Trigeminal c-Fos expression and behavioral responses to pulpal inflammation in ferrets. Pain 2002; 99: 61–69. [DOI] [PubMed] [Google Scholar]
- 31.Solis-Castro OO, Wong N, Boissonade FM. Chemokines and pain in the trigeminal system. Front Pain Res 2021; 2: 689314. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Li JG, Lin JJ, Wang ZL, Cai WK, Wang PN, Jia Q, Zhang AS, Wu GY, Zhu GX, Ni LX. Melatonin attenuates inflammation of acute pulpitis subjected to dental pulp injury. Am J Transl Res 2015; 7: 66–78. [PMC free article] [PubMed] [Google Scholar]
- 33.Kermeoğlu F, Aksoy U, Sebai A, Savtekin G, Özkayalar H, Sayıner S, Şehirli AÖ. Anti-inflammatory effects of melatonin and 5-methoxytryptophol on lipopolysaccharide-induced acute pulpitis in rats. BioMed Res Int 2021: 2021: 8884041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Kanno K, Shimizu K, Shinoda M, Hayashi M, Takeichi O, Iwata K. Role of macrophage-mediated Toll-like receptor 4-interleukin-1R signaling in ectopic tongue pain associated with tooth pulp inflammation. J Neuroinflammation 2020; 17: 312. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.AliHashemi M. Quercetin decreases Th17 production by down-regulation of MAPK- TLR4 signaling pathway on T cells in dental pulpitis. J Dent; 19: 259–264. [PMC free article] [PubMed] [Google Scholar]
- 36.Adachi K, Shimizu K, Hu JW, Suzuki I, Sakagami H, Koshikawa N, Sessle BJ, Shinoda M, Miyamoto M, Honda K, Iwata K. Purinergic receptors are involved in tooth-pulp evoked nocifensive behavior and brainstem neuronal activity. Mol Pain 2010; 6: 59. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Sun S, Sun J, Jiang W, Wang W, Ni L. Nav1.7 via promotion of ERK in the trigeminal ganglion plays an important role in the induction of pulpitis inflammatory pain. BioMed Res Int 2019; 2019: 6973932. [DOI] [PMC free article] [PubMed] [Google Scholar]





