KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
|
| ||
| Anti-Myc Tag Antibody, clone 4A6 | Millipore Sigma | Cat#05-724; RRID:AB_309938 |
| Monoclonal ANTI-FLAG® M2 antibody produced in mouse | Millipore Sigma | Cat#F3165; RRID:AB_259529 |
| C19orf43 Polyclonal Antibody | Invitrogen | Cat#PA5-63805; RRID:AB_2638871 |
| C19orf43 Polyclonal antibody | Proteintech | Cat#19420-1-AP; RRID:AB_10640586 |
| rabbit anti-TNKS1 | Scherthan et al.63 | 762 |
| RNaseH1 Polyclonal Antibody | Proteintech | Cat#15606-AP; RRID:AB_2238624 |
| RNaseH2A Polyclonal Antibody | Invitrogen | Cat#PA5-78330; RRID:AB_2736528 |
| Rad51 Antibody (H-92) | Santa Cruz | Cat#sc-8349; RRID:AB_2253533 |
| Monoclonal Anti-α-Tubulin antibody produced in mouse | Sigma | Cat#T5168; RRID:AB_477579 |
| Amersham ECL Mouse IgG, HRP-linked whole Ab (from sheep) | Cytvia | Cat#NA931; RRID:AB_772210 |
| Amersham ECL Rabbit IgG, HRP-linked whole Ab (from donkey) | Cytvia | Cat#NA934; RRID:AB_772206 |
| Anti-phospho-Histone H2A.X (Ser139) Antibody, clone JBW301 | Millipore | Cat#05636; RRID:AB_309864 |
| 53BP1 Antibody - BSA Free | Novus Biologicals | Cat#NB100-304; RRID:AB_10003037 |
| rabbit anti-TRF1 | Cook et al.64 | 415 |
|
| ||
| Chemicals, peptides, and recombinant proteins | ||
|
| ||
| C19orf43 | This paper | N/A |
| Tankyrase | Smith et al.65 | N/A |
|
| ||
| Critical commercial assays | ||
|
| ||
| 16pter Subtelomere Specific Probe (15μL) | Oxford Gene Technology | Cat#LPT16PG-A |
| 13q14.3 Deletion Probe | Oxford Gene Technology | Cat#LPH006-A |
| Blood & Cell Culture DNA Mini Kit (25) | Qiagen | Cat#13323 |
| RNeasy Mini Kit (50) | Qiagen | Cat#74104 |
|
| ||
| Experimental models: Cell lines | ||
|
| ||
| WI-38 | ATCC | Cat#CCL-75; RRID:CVCL_0579 |
| IMR-90 | ATCC | Cat#CCL-186; RRID:CVCL_0347 |
| 293 [HEK-293] | ATCC | Cat#CRL-1573; RRID:CVCL_0045 |
| TNKS1/2 DKO | Bhardwaj et al.12 | N/A |
| 293FT Cell Line | Invitrogen | Cat#R70007; RRID:CVCL_6911 |
|
| ||
| Oligonucleotides | ||
|
| ||
| siRNAs: RNaseH1#1: UCCUUUAAAUGUAGGCAUUAGACUU | Arora et al.43 | N/A |
| siRNAs: RNaseH1#2: GGGAAAGAGGUGAUCAACA | Yadav et al.66 | N/A |
| siRNAs: RNaseH2A: AUAAUCAGUAUCCAAGUCC | Daley et al.67 | N/A |
| siRNAs: TNKS1: CAAUUCACCGUCGUCCUCU | Dynek et al.14 | N/A |
| siRNAs: RAD51: CCAGAUCUGUCAUACGCUA | Dharmacon | N/A |
| GFP duplex I | Dharmacon | N/A |
| CRISPR guides: C19 guide: GACGGGCGGAGCCTCAGGGC | This paper | N/A |
| PCR primer screen XhoI site fwd: CTTCCCGGCATGCATTGTTC | This paper | N/A |
| PCR primer screen XhoI site fwd: AACCCGCGAGACGGGGGCT | This paper | N/A |
| PCR primer screen XhoI site rev: CACGGCTCCTTACGAAGCTA | This paper | N/A |
| Telo C Probe: (CCCTAA)4 | This paper | N/A |
| 18s rRNA probe: CCATCCAATCGGTAGTAGCG | This paper | N/A |
| For primers for qPCR | This paper | see Table S1 |
|
| ||
| Recombinant DNA | ||
|
| ||
| pLKO.1 puro Vector | Broad Institute | N/A |
| pLKO.1.shC19orf43#1_5′- GCCTCGTGAGACTTCATAGAA-3′ | This paper | N/A |
| pLKO.1.shC19orf43#4_5′-AGACGGAGGATGAGGTATTAA-3′ | This paper | N/A |
| pLKO-tet-on vector | Addgene | #21915 |
| pLKO-Tet-On_shC19orf43#1 | This paper | N/A |
| pLHCX vector | Clontech | N/A |
| pLHCX_RNaseH1_WT | Arora et al.43 | N/A |
| pLHCX_RNaseH1_CD_D145A | Arora et al.43 | N/A |
| p3XFlag-CMV-10 Vector | Sigma | N/A |
| p3XFlag-CMV-10_C19orf43.WT | This paper | N/A |
|
| ||
| Software and algorithms | ||
|
| ||
| ImageJ- Fiji | NIH | https://fiji.sc |
| GraphPad Prism v9.0 | GraphPad Software Inc. | https://www.graphpad.com |