REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Cx43	Cell Signaling Technology	Cat. #: 3512S; RRID: AB_2294590
pCx43 S368	Cell Signaling Technology	Cat. #: 3511S; RRID: AB_2110169
PKCμ	Cell Signaling Technology	Cat. #: 90039S; RRID: AB_2800149
pPKCμ S916	Cell Signaling Technology	Cat. #: 2051S; RRID: AB_330841
HA	Sigma	Cat. #: H6908; RRID: AB_260070
GST	Santa Cruz Biotechnology	Cat. #: sc-138; RRID: AB_627677
Tubulin	Sigma	Cat. #: T5168; RRID: AB_477579
Alexa Fluor™ 488 donkey anti-rabbit IgG (H+L)	Molecular Probes	Cat. #: A-21206; RRID: AB_2535792
Alexa Fluor™ 568 donkey anti-rabbit IgG (H+L)	Thermo Fisher Scientific	Cat. #: A10042; RRID: AB_2534017
Donkey anti-goat IgG (H+L) Alexa Fluor™ Plus 647	Thermo Fisher Scientific	Cat. #: A32849; RRID: AB_2762840
Bacterial and virus strains
DH5-alpha Competent E. coli (High Efficiency)	NEB	Cat. #: C2987
BL21 (DE3) Competent Cells	Thermo Fisher Scientific	Cat. #: ECO114
Biological samples
Human Native Ready-to-use Skin 11 mm Diameter	Genoskin	Batch #: 20230912.2
Human Wound Skin with 2 mm Central Wound	Genoskin	Batch #: 20230912.2
Chemicals, peptides, and recombinant proteins
Calcium Chloride Dihydrate	Acros Organics	Cat. #: 423525000; CAS: 10035-04-8
HEPES	Sigma	Cat. #: H4034; CAS: 7365-45-9
Sodium Chloride	Fisher Bioreagents	Cat. #: BP358-10; CAS: 7647-14-5
Potassium Chloride	Sigma-Aldrich	Cat. #: P9333; CAS: 7447-40-7
Sodium Phosphate Dibasic Anhydrous	Fisher Bioreagents	Cat. #: BP332; CAS: 7558-79-4
Sodium Hydroxide	Fisher Chemical	Cat. #: SS255-1; CAS: 1310-73-2
Sodium Dodecyl Sulfate	VWR Life Science	Cat. #: 0227-1KG; CAS: 151-21-3
Sodium Azide	Sigma-Aldrich	Cat. #: S2002-500G; CAS: 26628-22-8
Sodium Deoxycholate	Sigma-Aldrich	Cat. #: D6750; CAS: 302-95-4
Tween 20	Fisher Bioreagents	Cat. #: BP337-100; CAS: 9005-64-5
Triton X-100	Fisher Bioreagents	Cat. #: BP151-500; CAS: 9002-93-1
Agarose	Thermo Fisher Scientific	Cat. #: R0492; CAS: 9012-36-6
Agar	Fisher Bioreagents	Cat. #: BP9744-500; CAS: 9002-18-0
Bromophenol Blue	Sigma-Aldrich	Cat. #: B0126-25G; CAS: 115-39-9
DMSO	Fisher Bioreagents	Cat. #: BP231-100; CAS: 67-68-5
Glycerol	Fisher Bioreagents	Cat. #: BP229-1; CAS: 56-81-5
Ethidium Bromide Solution	Invitrogen	Cat. #: 15585011; CAS: 1239-45-8
EDTA	Fisher Bioreagents	Cat. #: BP118-500; CAS: 60-00-4
Glycine	Thermo Fisher Scientific	Cat. #: A13816.0C; CAS: 56-40-6
LB Broth	Fisher Bioreagents	Cat. #: BP9731-5; CAS: 56-40-6
Tris Base	EMD Millipore Corp	Cat. #: 648310-2.5KG; CAS: 77-86-1
2-Propanol	Fisher Bioreagents	Cat. #: A416P-4; CAS: 67-63-0
Acetic Acid	Fisher Bioreagents	Cat. #: A38-212; CAS: 64-19-7
Hydrochloric Acid	Fisher Bioreagents	Cat. #: A481-212 CAS: 7647-01-0
Ethanol	Decon Labs, Inc.	Cat. #: UN1170; CAS: 64-17-5
Methanol	EMD Millipore Corp	Cat. #: MX0490-4; CAS: 67-56-1
Cycloheximide	Sigma	Cat. #: 01810-5G; CAS: 66-81-9
Ampicillin Sodium Salt	Fisher Bioreagents	Cat. #: BP1760-25; CAS: 69-52-3
Glutathione (Reduced)	Fisher Bioreagents	Cat. #: BP2521-5; CAS: 70-18-8
IPTG	Sigma	Cat. #: I6758-1G; CAS: 367-93-1
Phenylmethanesulfonyl Fluoride	Sigma-Aldrich	Cat. #: P7626-5G; CAS: 329-98-6
Fluoroshied with DAPI	Sigma-Aldrich	Cat. #: F6057-20ml
Carbenoxolone Disodium Salt	Thermo Fisher Scientific	Cat. #: J63714.03; CAS: 7421-40-1
Bovine Serum Albumin	Fisher Bioreagents	Cat. #: BP1605-100; CAS: 9048-46-8
Paraformaldehyde Solution	ChemCruz	Cat. #: sc-281692; CAS: 30525-89-4
Dithiothreitol (DTT)	Fisher Bioreagents	Cat. #: BP172-25; CAS: 3483-12-3
30% Acrylamide/Bis Solution 37.5:1	Bio-Rad	Cat. #: 1610158
Puromycin	Thermo Fisher Scientific	Cat. #: J67236.XF; CAS: 53-79-2
Polybrene	Santa Cruz	Cat. #: sc-134220; CAS: 28728-55-4
N, N, N’, N’-Tetramethyl Ethylenediamine	Acros Organics	Cat. #: 433831000; CAS: 110-18-9
Halt Protease and Phosphatase Inhibitor Cocktail	Thermo Fisher Scientific	Cat. #: 78442
Lucifer Yellow CH	Invitrogen	Cat. #: L453
Magnesium Chloride Hexahydrate	Sigma-Aldrich	Cat. #: M9272-500G; CAS: 7791-18-6
Kinase buffer	Cell Signaling Technology	Cat. #: 9802S
Lysozyme	Sigma	Cat. #: L6876-1G; CAS: 12650-88-3
ATP	Cell Signaling Technology	Cat. #: 9804S; CAS: 987-65-5
Protein A/G Plus	Santa Cruz	Cat. #: SC-2003
Brilliant Blue G-250	Fisher Scientific	Cat. #: BP100-25; CAS: 6104-58-1
Ponceau S	Sigma-Aldrich	Cat. #: P3504-100G; CAS: 6226-79-5
Pierce Anti-HA Agarose	Thermo Fisher Scientific	Cat. #: 26181
Collagen Type I, Rat Tail	EMD Millipore Corp	Cat. #: 08-115
Phorbol 12-myristate 13-acetate (PMA)	Thermo Fisher Scientific	Cat. #: J63916.MCR CAS: 16561-29-8
CRT 0066101	Tocris	Cat. #: 4975; CAS: 1883545-60-5
Lambda Protein Phosphatase	New England Biolabs	Cat. #: P0753S
Trypan Blue	Invitrogen	Cat. #: T10282; CAS:72-57-1
Mitomycin C	Roche	Cat. #: 1010740900; CAS: 50-07-7
Antennapedia (H-RQPKIWFPNRRKPWKK-OH)	Biosynth	Lot #: LP11809
α-CT1 RIS (H-RQPKIWFPNRRKPWKKIELDDPRPR-OH)	Biosynth	Lot #: LP11810
α-CT1 (H-RQPKIWFPNRRKPWKKRPRPDDLEI-OH)	Biosynth	Lot #: BU19813
HA-PKCμ	This manuscript	N/A
HA-PKCμ (K612W)	This manuscript	N/A
GST-Cx43	This manuscript	N/A
GST	This manuscript	N/A
Experimental models: Cell lines
HEK293T	ATCC	Cat. #: CRL-3216; RRID: CVCL__0063
HaCaT	Norbert E. Fusenig, German Cancer Research Center (DKFZ), Heidelberg, Germany.	N/A
Oligonucleotides
shRNA PKCμ A	CCCACGCTCTCTTTGTTCATT	This manuscript
shRNA PKCμ B	CAGGAAGAGATGTAGCTATTA	This manuscript
Cx43 shRNA	GGTGGTAATTGTGGCTAAATA	This manuscript
Recombinant DNA
pGEX-4T-3	Amersham	Available from other sources
GST-Cx43	This manuscript	N/A
HA-PKCμ	Addgene	Plasmid #: 10808
HA-PKCμ (K612W)	Addgene	Plasmid #: 10809
pcDNA3.1 (+)	Thermo Fisher Scientific	Cat. #: V79020
pLKO.1 shRNA EGFP	Addgene	Plasmid #: 30323
pLKO.1 shRNA PKCμ A	This manuscript	N/A
pLKO.1 shRNA PKCμ B	This manuscript	N/A
psPAX2	Addgene	Plasmid #: 12260
pMD2.G-VSV.G	Addgene	Plasmid #: 12259
pLKO.1 shRNA Cx43	This manuscript	N/A
pLenti-GFP-Blasticidin	This manuscript	N/A
pLenti-Cx43-Blasticidin	This manuscript	N/A
pLenti-Cx43 (S368D)-Blasticidin	This manuscript	N/A
pLenti-Cx43 (S368A)-Blasticidin	This manuscript	N/A
Critical commercial assays
Immobilon Western Chemiluminescent HRP Substrate	Millipore	Cat. #: WBKLS0500
DC Protein Assay	Bio-Rad	Cat. #: 5000114
Pierce Glutathione Superflow Agarose	Thermo Fisher Scientific	Cat. #: 25236
PCR and Gel Cleanup Kit	Qiagen	Cat. #: 28506
T4 DNA Ligase	New England Biolabs	Cat. #: M0202
Amicon Ultra-15 Centrifugal Filters -100K	Merck Millipore	Cat. #: UFC910096
Sonic Dismembrator	Fisher Scientific	Cat. #: FB-705
Nitrocellulose Membranes, 0.45μM	Bio-Rad	Cat. #: 162-0251
Bright-line Hemacytometer	Hausser Scientific	Cat. #: Z359629-1EA
Software and algorithms
Image Lab™ Software (Version 5.2.1)	Bio-Rad	RRID:SCR_014210
Illustrator 2023	Adobe	N/A
Prism 9 Version 9.5.0	GraphPad Software	RRID:SCR_002798
ImageJ	National Institutes of Health	RRID:SCR_003070
Gen5 3.10	BioTek	RRID:SCR_017317
NIS-Elements AR 5.02.091 64-bit	Nikon	RRID:SCR_014329
Other
Forma Steri-Cycle CO2 Incubator	Thermo Fisher Scientific	Cat. #: 381
IsoTemp 220	Fisher Scientific	Cat. #: 15-462-20Q
Micro12	EKF Diagnostics	Cat. #: 23-550-103
Mighty Slim Power supply	Hoeter	Cat. #: SX259
PowerPac	Bio-Rad	Cat. #: 1645050
Mini-PROTEAN Glass Plates	Bio-Rad	Cat. #: 1653311
Mini Trans-Blot Foam Pads	Bio-Rad	Cat. #: 1703933
Molecular Imager ChemiDoc XRS+	Bio-Rad	Cat. #: 1708265
BioTek Cytation 5 Imaging Reader	Agilent	N/A
C25 Incubator Shaker	New Brunswick Scientific	Cat. #: M1246-0000
Avanti J-E Centrifuge	Beckman Coulter	Cat. #: 369001