Skip to main content
. 2005 May;49(5):1957–1964. doi: 10.1128/AAC.49.5.1957-1964.2005

TABLE 2.

Primers used in this study

Primer Sequence (5′-3′) Nucleotide positions corresponding to the insert of pBK-LHK-5 shown in Fig. 1 Purpose
LPW606 GGCAGGCAGCAACCATTC 673 to 690 Sequencing of insert of pBK-LHK-5
LPW608 ATTGACCTGTCTGCACCG 1412 to 1429 Sequencing of insert of pBK-LHK-5 and ampC gene
LPW621 GGCTATCTGTTGCAGCAACC 19 to 38 PCR and sequencing of ampR gene
LPW622 CGACCAGTGCAGTAAACGGT 1385 to 1366 PCR and sequencing of ampR gene and PCR for preparation of the 298-bp blaLHK-5 probe
LPW663 CGGATTACCCCATTTTCCCG 1088 to 1107 PCR and sequencing of ampC gene and PCR for preparation of the 298-bp blaLHK-5 probe
LPW664 CATGTCTGCCCGGAATGTGC 2405 to 2386 PCR and sequencing of ampC gene
LPW665 CAATCTAACGAGGGCTGAGT −118 to −99 PCR and sequencing of ampR gene
LPW679 TGTTCGACTCGTCGATAGGC 239 to 220 PCR and sequencing of ampR gene
LPW697 ATTGCGGTCGGCATTACAGC 1906 to 1925 Sequencing of ampC gene
LPW1946 GATCAAAGGCCTGGCTGGC 878 to 896 PCR of ampC-ampR gene for construction of recombinant plasmid pLHKCR
LPW1947 GGTCGAACCATCGTGAACC −2 to 17 PCR of ampC gene for construction of recombinant plasmid pLHKC
LPW1948 ATGTCTGCCCGGAATGTGC 2405 to 2387 PCR of ampC and ampC-ampR genes for construction of recombinant plasmids pLHKC and pLHKCR