KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit polyclonal anti-BRF1/2 | Cell Signaling Tech | Cat#2119; RRID: AB_10695874 |
| Rat monoclonal anti- CD11b, PerCP-Cy5.5 conjugated | Biolegend | Cat#101228; RRID: AB_893232 |
| Rat monoclonal anti-CD31 | BD Biosciences | Cat#557355; RRID: AB_396660 |
| Rat monoclonal anti-CD31, FITC conjugated, Clone MEC 13.3 | BD Biosciences | Cat#553372; RRID: AB_394818 |
| Hamster monoclonal anti-CD31 (clone 2H8) | Bogen65 | N/A |
| Rat monoclonal anti-CD45, Brilliant Violet 421 conjugated | Biolegend | Cat#109831; RRID: AB_10900256 |
| Goat polyclonal anti-CDH5 | R&D Systems | Cat#AF938; RRID: AB_355726 |
| Rabbit monoclonal anti-CDH5 | Cell Signaling Tech | Cat#2500; RRID: AB_10839118 |
| Hamster monoclonal anti-CDH5 (clone Hec1) | Ali et al.66 | N/A |
| Rabbit monoclonal anti-ERG | Abcam | Cat#Ab115555; RRID: AB_10898854 |
| Rabbit monoclonal anti-ERG- Alexa Fluor 647 | Abcam | Cat#Ab196149 |
| Rabbit monoclonal anti-ERG- Alexa Fluor 488 | Abcam | Cat#Ab196374 |
| Goat polyclonal anti-ESM1 | R&D Systems | Cat#AF1999; RRID: AB_2101810 |
| Rabbit polyclonal anti-gamma-Tubulin | Abcam | Cat#11321; RRID: AB_297926 |
| Mouse monoclonal anti-GAPDH | Millipore Sigma | Cat#MAB374; RRID: AB_2107445 |
| Rabbit polyclonal anti-phospho-Histone H3 (Ser10) | Cell Signaling Tech | Cat#9701; RRID:AB_331535 |
| Rabbit monoclonal anti-JAG1 | Cell Signaling Tech | Cat#2620; RRID: AB_10693295 |
| Goat polyclonal anti-JAG1 | Sigma-Aldrich | Cat#J4127; RRID: AB_260348 |
| Mouse monoclonal anti-JAG1 (E–12) | Santa Cruz | Cat#Sc-390177; RRID: AB_2892141 |
| Rabbit monoclonal anti-NICD (Val1744) | Cell Signaling Tech | Cat#4147; RRID: AB_2153348 |
| Rabbit monoclonal anti-Notch1 | Cell Signaling Tech | Cat#3608; RRID: AB_2153354 |
| Rabbit monoclonal anti-phospho-VR2 (Tyr1175) | Cell Signaling Tech | Cat#2478; RRID: AB_31377 |
| Goat polyclonal anti-uPAR | R&D Systems | Cat#AF534; RRID: AB_2165351 |
| Rabbit monoclonal anti-VR2 | Cell Signaling Tech | Cat#2479; RRID: AB_2212507 |
| Rabbit monoclonal anti-ZFP36 | Cell Signaling Tech | Cat#71632; RRID: AB_2799806 |
| Rabbit polyclonal anti-ZFP36 | Millipore Sigma | Cat#ABE285; RRID: AB_11205589 |
| Bacterial and virus strains | ||
| Ad-Cre-GFP | Vector Biolabs | Cat#1700 |
| Ad-GFP | Vector Biolabs | Cat#1060 |
| lentiCRISPR v2 | Sanjana et al.67 | Cat#52961; RRID:Addgene_52961 |
| Biological samples | ||
| Human umbilical vein endothelial cells | Lonza | Cat# C2517A; Lot# 18TL072772, 18TL072771, 18TL061650, 21TL169354, 21TL195719, 20TL293905, 0000632996, 0000296747 |
| Human umbilical vein endothelial cells, pooled | Lonza | Cat#C2519A; Lot#0000460587 |
| Human aortic endothelial cells | University of California, Los Angeles | N/A |
| Human Dermal Microvascular Endothelial Cells | PromoCell | Cat#C-12212 |
| Chemicals, peptides, and recombinant proteins | ||
| ZM323881 hydrochloride | Tocris | Cat#2475/1 |
| Actinomycin D | Invitrogen | Cat#A7592 |
| VEGFA165 | Peprotech | Cat#100-20 |
| Recombinant human Jagged1 Fc Chimera | R&D systems | Cat#1277 |
| Human IgG, Fc fragment | Sigma-Aldrich | Cat#AG714 |
| eBioscience 1xRBC lysis buffer | Invitrogen | Cat#00-4333-57 |
| Methalcholine chloride, 100.4% | MP Biomedicals | Cat#0219023105 |
| Lipofectamine 2000 | Thermo Fisher | Cat#11668019 |
| Restore Western Blot Stripping Buffer | Thermo Fisher | Cat#21059 |
| Dynabeads Protein A | Thermo Fisher | Cat#10001D |
| ProLong Gold Antifade Mountant | Thermo Fisher | Cat#P36930 |
| Puromycin | Invitrogen | Cat#ANTPR1 |
| Polybrene | Millipore Sigma | Cat#TR-1003-G |
| cOmplete EDTA-free Protease Inhibitor Cocktail | Sigma-Aldrich | Cat#11873580001 |
| Recombinant Human Jagged1 Fc Chimera Protein, CF | R&D Systems | Cat#1277-JG-050 |
| Cytodex 3 microcarriers | Cytiva | Cat#17048501 |
| Fibronogen | Sigma-Aldrich | Cat#F-8630 |
| Aprotinin | Sigma-Aldrich | Cat#A-1153 |
| Thrombin | Sigma-Aldrich | Cat#T-3399 |
| 2.5% Trypsin, 10x | Corning | Cat#MT25054CI |
| Paraformaldehyde (PFA) 4%, in PBS | Thermo Fisher | Cat#AAJ61899AP |
| Triton X-100 | Thermo Fisher | Cat#BP151500 |
| Tween 20 | Sigma-Aldrich | Cat#P9416 |
| Normal Donkey Serum | Jackson ImmunoResearch | Cat#017-000-121 |
| Phalloidin-AF488 | Thermo Fisher | Cat#A12379 |
| Hoechst 33342 | Enzo | Cat#ENZ-52401 |
| Critical commercial assays | ||
| RNeasy Plus Micro Kit | Qiagen | Cat#74034 |
| RNeasy Mini Kit | Qiagen | Cat#74104 |
| TruSeq Total RNA library prep kit | Illumina | Cat#20020594 |
| Trans-Blot Turbo RTA Midi Nitrocellulose Transfer Kit | Bio-Rad | Cat#1704271 |
| Thermo Scientific Pierce Detergent Compatible Bradford Assay | Fisher Scientific | Cat#PI23246 |
| Pierce BCA Protein Assay Kit | Thermo Fisher | Cat#23227 |
| 4–20% Mini-PROTEAN TGX Precast Protein Gels | Bio-Rad | Cat#4561095, 4561094 |
| 4–20% Criterion TGX Stain-Free Protein Gel | Bio-Rad | Cat#5678093 |
| Liver dissociation kit, mouse | Miltenyi | Cat#130-105-807 |
| Superscript III First-Strand Synthesis System | Invitrogen | Cat#18080051 |
| SsoAdvanced Universal SYBR Green Supermix | Bio-Rad | Cat#1725274 |
| Dual-Glo Luciferase Assay System | Promega | Cat#E2940 |
| Lipofectamine 3000 Transfection Reagent | Thermo Fisher | Cat#L3000015 |
| Deposited data | ||
| HUVEC RNAseq | This paper | GSE235462 |
| Retinal single-cell mRNA profiles of WT P6 mice (GSM5350878) | Zarkada et al.40 | GSE175895 |
| eCLIP-seq | Cicchetto et al.26 | PRJNA943291 |
| Experimental models: Cell lines | ||
| Lenti-X 293T | Takara | Cat#632180 |
| Experimental models: Organisms/strains | ||
| Mouse: Tg(Cdh5-cre/ERT2)1Rha | (Sorensen et al.68 | N/A |
| Mouse: Zfp36f/f | Qiu et al.69 | N/A |
| Mouse: Gt(ROSA)26Sortm14(CAG tdTomato)Hze | Jackson Laboratory | RRID: IMSR_JAX:007914 |
| Mouse: Jag1f/f | Mancini et al.70 | N/A |
| Mouse: Zfp36f/fZl1f/fZl2f/f | This paper | N/A |
| Oligonucleotides | ||
| qPCR primers (Table S1) | See Table S1 | N/A |
| gRNA ZFP36 Forward: CACCGTGCCCGTGCCATCCGACCA | This paper | N/A |
| gRNA ZFP36 Reverse: AAACTGGTCGGATGGCACGGGCAC | This paper | N/A |
| Recombinant DNA | ||
| pLV[Exp]-Puro-EF1A>NLS-EGFP: {mJag1_3′ UTR_565bp} | This Paper - Vector Builder custom order | Cat#VB220720-1510tzf |
| pLV[Exp]-Puro-EF1A>NLS-EGFP: {mJag1_3′ UTR_517bp(del 48bp)} | This Paper - Vector Builder custom order | Cat#VB220720-1515agk |
| pRP[Exp]-Hygro-CAG-Luciferase&{hJAG1_3UTR_1814bp} | This Paper – Vector Builder custom order | Cat#VB230730-1401fzh |
| pRP[Exp]-Hygro-CAG-Luciferase&{hJAG1_3UTR’(del 331bp-429bp)} | This Paper – Vector Builder custom order | Cat#VB230807-1714sjb |
| psPAX2 | Addgene | Cat# 12260; RRID: Addgene_12260 |
| pMD2.G | Addgene | Cat# 12259; RRID: Addgene_12259 |
| pCMV-GFP | Matsuda et al.71 | Cat#11153; RRID: Addgene_11153 |
| Software and algorithms | ||
| FIJI | Schindelin et al.72 | RRID:SCR_002285 |
| Imaris (v9.9.0) | Bitplane | RRID:SCR_007370 |
| Seurat (v4.1.1) | Hao et al.73 | RRID:SCR_016341 |
| NIS Elements | Nikon | RRID:SCR_014329 |
| Image Lab Software | BioRad | RRID:SCR_014210 |
| CFX Manager (v3.1) | BioRad | RRID:SCR_017251 |
| STAR (v2.7.3) | Dobin et al.74 | RRID:SCR_004463 |
| FlowJo | BD Biosciences | RRID:SCR_008520 |
| BioRender | BioRender | RRID:SCR_018361 |
| Adobe Illustrator | Adobe | RRID:SCR_010279 |
| Prism 9 | Graphpad | RRID:SCR_002798 |
| UMI-tools | GitHub | RRID:SCR_017048 |
| PureCLIP | GitHub | https://github.com/skrakau/PureCLIP |
| DESeq2 | GitHub | RRID:SCR_015687 |
| FastQC | GitHub | RRID:SCR_014583 |
| AREsite2 | Gruber et al.75 | http://nibiru.tbi.univie.ac.at/AREsite2/welcome |
| BioTek Gen5 | Agilent | RRID:SCR_017317 |
| Wound_healing_size_tool | Suarez-Arnedo et al.76 | https://github.com/AlejandraArnedo/Wound-healing-size-tool/wiki |
| Other | ||
| HiSeq3000 | Illumina | Cat#SY-401-3001 |
| IncuCyte S3 Live Cell Analysis System | Sartorius | Cat#4647; RRID:SCR_023147 |
| Glass bottom well-plates | Cell Vis | Cat# P06-1.5H-N, P12-1.5H-N, P24-1.5H-N |
| BioTek Synergy H1 Microplate Reader | Agilent | Cat#SH1M2-SN; RRID:SCR_019748 |
| Incucyte Wound Maker 96-Tool | Sartorius | Cat# 4563 |