Summary
Convergent extension requires the coordinated action of the PCP proteins 1,2 and the actin cytoskeleton 3-6, but this relationship remain incompletely understood. For example, PCP signaling orient actomyosin contractions, yet actomyosin is also required for the polarized localization of PCP proteins 7,8. Moreover, the actin-regulating Septins play key roles in actin organization 9 and are implicated in PCP and CE in frogs, mice, and fish 5,6,10-12, but execute only a subset of PCP-dependent cell behaviors. Septin loss recapitulates the severe tissue-level CE defects seen after core PCP disruption, yet leaves overt cell polarity intact 5. Those results highlight the general fact that cell movement requires coordinated action by distinct but integrated actin populations actin, such as lamella and lamellipodia in migrating cells 13 or medial and junctional actin populations in cells engaged in apical constriction 14,15. In the context of Xenopus mesoderm CE, three such actin populations are important (Figure S1), a superficial meshwork known as the “node-and-cable” system 4,16-18, a contractile network at deep cell-cell junctions 6,19, and mediolaterally oriented actin-rich protrusions which are present both superficially and deep 4,19-21. Here, we exploited the amenability of the uniquely “two-dimensional” node and cable system to probe the relationship between PCP proteins, Septins, and the polarization of this actin network. We find that The PCP proteins Vangl2 and Prickle2 and septins co-localize at nodes, and that the node and cable system displays a cryptic, PCP- and septin-dependent anteroposterior polarity in its organization and dynamics
Blurb:
Devitt et al. explore the interplay of PCP proteins, actin, and septins during convergent extension, revealing new complexity to the polarization of the actin cytoskeleton during gastrulation.
Results and Discussion:
PCP protein and Septin localization in the actin node and cable network during Xenopus convergent extension.
We first examined localization of the core PCP proteins Vangl2 and Prickle2 in the node and cable system. During CE in zebrafish, both proteins were shown to localize to polarized foci, but the nature of these foci is unknown 22-24. We found that fluorescent fusions to either Vangl2 or Prickle2 in Xenopus were also present in foci, and moreover, that these foci were coincident with 1-2 actin rich nodes (Figure 1A, B). PCP foci (and thus actin-rich nodes, see Figure 2, below) were not initially polarized, but became progressively biased to the anterior over time (Figure 1D-E, H), suggesting that the PCP foci in Xenopus mesenchymal cells follow the pattern of progressive polarization observed for junction accumulation of PCP proteins in epithelial cells 2,25. The localization of these foci was confirmed by immunostaining for endogenous Vangl2 (Figure S2). By contrast, a fusion to the core PCP protein Dishevelled was localized to posteriorly biased foci that also developed progressively (Figure 1C, G, F, H), similar to that reported in zebrafish 22, but these were not co-localized with actin-rich nodes.
Figure 1: PCP protein and septin localization in actin rich nodes.
A-C. Still images of FP fusions to indicated PCP proteins (green) and Lifeact (magenta) in polarized cells, insets show magnified view of nodes. D-F. Still images of indicated PCP proteins (green) and Lifeact (magenta) in pre-polarized cells, insets show magnified view of nodes. G, H. Quantification of the position of FP-labeled PCP foci in polarized and pre-polarized cells. I-L. Images of indicated Septin subunit s(green) and Lifeact (Magenta) at nodes; Scalebar = 10 um. M. Schematic interpretation of data in A-L. N, O. Vangl2-GFP localization in control and Sept7MO cells. P. Quantification of AP positioning of Vangl2 puncta. N values and statistics are provided in Supplemental Information. See also Figures S1-S3.
Figure 2: Progressive polarization of the actin node and cable system requires PCP and Septins.
A-D. Individual cells mosaically labeled with Lifeact-RFP at times indicated at left (maximum intensity projections of cortical actin 10um into cell). a’-d’. Cyan box and inlay highlight individual nodes. Heatmap showing orientation of actin fibers quantified with OrientationJ (Legend in a’; cyan = mediolateral, red = anteroposterior). a”-d” Quantification of actin filament orientation. E. Quantification of cell length-to-width ratios over time. F. Upper panel, schematic of AP localization, arrow representing cellular anterior-posterior axis. Lower panel, quantification of Lifeact-RFP labelled nodes over time. G-K. Representative images of cells with indicated manipulations. (Maximum intensity projection of cortical actin 10um into cell). Inlay shows actin node and cable, where present, indicated by magenta box). g’, g”. Schematics of quantification. h’-k’: Quantification of actin fiber alignment in cells. h”-k” Quantification of actin cable positioning. Scale= 10um. N values and statistics are provided in Supplemental Information.
We next assessed the localization of Septins, which are known to assemble into hetero-oligomeric complexes comprised of one each of four Septin subgroups (see Figure S3A, B)26. We first examined Sept2 and Sept7 subunits, which are essential for in CE 5,6. Both were enriched in anterior actin-rich nodes (Figure 1I,J ; Figure S3D,E). To represent the two remaining Septin subgroups (Figure S3A,B), we chose Sept8 and Sept9 based on their strong expression in the dorsal mesoderm during CE 27, and these, too, were strongly enriched at nodes (Figure 1K, L; Figure S3F,G). The localization of Septins reflected the diverse morphology of nodes, but as a population, their localization was highly consistent, as shown by overlapping peaks of Septin and actin intensity plots (Figure S3d”-g”; Figure 1M).
In light of their colocalization, we next probed the functional interrelationship between PCP proteins and Sept7. Interestingly, we found that actin rich, Vangl2+ nodes still form in the absence of Sept7, though they are mispositioned, and not as strongly biased to anterior regions (Figure 1N-P). Conversely, KD of Vangl2 elicited a robust and generalized loss of detectable of Sept7-GFP in cells (Figure S2D-F), which could reflect either disrupted localization/diffusion of Sept7 or a generalized loss of the protein. These interdependent phenotypes, with Vangl2 required for Sept7 localization and Sept7 also required for anterior positioning of Vangl2+ nodes, reflect the complex reciprocal relationship shown previously for PCP proteins and actomyosin during CE 7,8.
A cryptic anteroposterior polarity in the node and cable system requires PCP proteins and Sept7.
These data raise an interesting question, because while the orientation of actin fibers within the node and cable system and their myosin-driven contraction are polarized mediolaterally 4,16-18, no aspect of the system is yet known to be polarized in the A/P axis marked by PCP protein localization. These finding prompted us to further explore polarity within the node and cable system.
First, time-lapse analysis revealed that actin fibers were initially random, but became progressively aligned and oriented over time as cells progressively polarize and elongate 20,28 (Figure 2A-E). Interestingly, however, this progressive mediolateral polarization of fibers was coincident with the progressive polarization of actin-rich nodes to the anterior region of cells (Figure 2F), reflecting the polarization of PCP proteins described above.
PCP disruption is known to completely abolish all aspects of planar polarity during CE, and accordingly, knockdown (KD) of Vangl2 or Prickle 2 (Pk2) or expression of dominant negative Disheveled (Xdd1), severely disrupted both mediolateral alignment of actin fibers (Figure 2G, g’ - J, j’) and the anterior positioning of actin cables (Figure 2g” - j”). By contrast, Sept7 loss strongly disrupts CE at the tissue level but leaves overt cell polarity intact 5, and consistent with that effect, loss of Sept 7 did not affect the mediolaterally polarized alignment of individual actin filaments (Figure 2K, k’) but did significantly disrupt the anterior enrichment of actin cables (Figure 2k”). This result was paradoxical. On the one hand, the lack of effect on actin fiber alignment was consistent with the normal overall cellular polarity in Sept7 KD cells 5. On the other, the effect on anterior actin cable positioning suggests the presence of a cryptic Sept7-dependent anteroposterior-oriented organization of the actin system in these cells.
This possibility prompted us to develop another metric of actin organization that was more granular than cable formation yet independent of actin fiber alignment. We therefore segmented Lifeact-GFP labeled actin fibers from our TIRF movies using SOAX software 29 and used customized scripts to quantify their persistence length (Lp)(Figure 3A). This metric reflects the bending stiffness of polymers in isolation, but in the complex environment of the cell, we reasoned that it may serves instead as a more general proxy for overall actin organization. Indeed, we found that actin fibers in the anterior region of cells displayed significantly higher Lp compared to those in the posterior (Figure 3B-D).
Figure 3: PCP- and Septin-dependent anteroposterior pattern in the node and cable system.
A. Representative TIRF image of a control cell, outlined in pink. Boxes highlighting anterior (cyan) and posterior (yellow) regions of the cell. B, C. Representative anterior and posterior cropped ROIs from A. b’-c’. tSOAX segmentation. b”-c”. representative single actin filament traces used for quantification. D. Quantification of persistence length (Lp) of actin filaments in anterior (A) or posterior (P) cellular regions of control, Sept7MO, and Vangl2MO cells. E, F. Lifeact-RFP labeling the actin cortex in control and Sept7 MO cells. Boxes indicate regions used for kymograph, below. e’, f’. Kymograph of representative actin fiber coalescence over time. G. Quantification of actin filament coalescence over time, 0 sec indicates the full coalescence to a single fiber. N values and statistics are provided in Supplemental Information. See also Figure S4.
Strikingly, the anteroposterior-polarized asymmetry in Lp of actin fibers was eliminated by loss of either Vangl2 or Sept7 (Figure 3D; Figure S4), an effect resulting specifically from reduction in actin persistence lengths in anterior regions (Figure 3D). Together, these findings reveal that the actin node and cable system displays two vectors of polarity: individual actin fibers align mediolaterally in a Vangl2-dependent manner, while higher level actin organization quantified either by cable positioning or by Lp of actin fibers is patterned anteroposteriorly in a manner that requires both Vangl2 and Sept7.
Sept7 is required for progressive coalescence of the anterior actin cables
The data so far indicate that Vangl2 acts via Sept7 to control anteroposterior actin organization in the node and cable system. To avoid the additional pleiotropic effects of core PCP loss, we focused a deeper exploration on Sept7 KD, starting with a time-lapse analysis of the evolution of the Sept7 KD phenotype over time (Figure 3E, F). In movies, we observed that while individual, smaller actin cables form in the absence of Sept7, they fail to coalesce into a single, anteriorly positioned cable. Using kymographs, we quantified this phenotype, revealing that after Sept7 KD, coalescence was severely disrupted, with actin filaments remaining well-spaced on average, even at later time points (Figure 3e’, f’, G).
Sept7 controls local dynamics of polarized actin flow
Finally, we probed the effect of Sept7 loss on actin dynamics using fluorescent speckle microscopy 30, in which mosaically labeled actin monomers trace both the bulk flow of actin and the turnover of individual actin filaments 31,32. Specifically, we imaged the overall actin network with Lifeact-RFP and identified nodes with Prickle2-GFP, as shown in Figure 4A, with an enlarged region and split channels shown in Figure 4B, C. In the same cells, we also imaged single actin speckles using dye-labelled actin monomers (Figure 4A, D).
Figure 4: Sept7 controls local dynamics of polarized actin flows.
A. TIRF image of a single cell labeled with Lifeact-RFP, Pk2-GFP, and actin-647 speckles. B-D. Zoomed, split channels of the boxed region in A. Orange and purple boxes indicate regions quantified in Panel I, below). E. Heatmap and vector diagram of PIV data for the region shown in A. Arrows indicate the vector and direction of flow; legend shows heatmap indicates positive divergence of flow (blue) or negative divergent (i.e. convergence, yellow). F. Zoomed view of the boxed region of the heatmap in E. G. Line plot of Pk2-GFP pixel intensities in multiple cells. H. Line plot showing vector divergence along the same line from which Pk2 intensity was derived, above. Note maximal vector convergence is coincident with the peak of Pk2 intensity (i.e., in nodes). I. Quantification of actin speckle lifetimes in regions indicated by boxes in panels B and D, above. N values and statistics are provided in Supplemental Information.
We then used Particle Imaging Velocimetry (PIV)33 analysis to understand the bulk flow of actin. Tracing actin speckles revealed a consistent pattern in which actin flows medially along anterior actin cables into Pk2+ nodes (Figure 4E, F; arrows indicate the vector and magnitude of particle flow). To quantify flow, we measured the divergence of speckle trajectories over time which we represented with a heat map where yellow represents vector divergence, and blue represents negative divergence (i.e convergence of two vectors). We consistently observed a dark blue region at the anterior of cells (Figure 4E, F), correlating with the Pk2+ node, indicating that actin speckles converge at the node. To quantify this effect across samples, we overlaid line plots of Pk2-GFP (Figure 4G) intensity with line plots of vector divergence (Figure 4H), and these bulk data reveal a peak of Pk2-GFP intensity at nodes coincident with the inverted peak of negative vector divergence (Figure 4G, H).
Noting that actin frequently flows to regions of enhanced depolymerization and that actin depolymerizing factors are required for normal CE 3,4,34, we examined several such factors. We found strong enrichment of Cfl1, Twf1, and Cap in actin nodes (Figure S3H-J), suggesting that the node is a region of high actin turnover and that PCP proteins may organize actin flows through the recruitment of such factors.
Finally, we quantified actin filament turnover by tracking individual actin speckles over time, independently measuring lifetimes in nodes and in nearby cables (Figure 4B, D; orange and purple boxes, respectively). We found that the lifetime of actin speckles in nodes was significantly shorter than the lifetimes in the cable (Figure 4I, left), suggesting faster turnover at nodes and increased actin filament stability in anterior cables. Because Sept7 is required for cable formation anteriorly (Figure 3E-G), we asked how loss of Sept7 impacts dynamics of actin speckles in nodes and cables, and we observed a very specific effect: Sept7 KD significantly reduced the longer actin speckle lifetimes observed in cables (Figure 4I, right), but did not alter the shorter lifetime of actin speckles in nodes (Figure 4I). These data suggest a role for Sept7 in stabilizing actin in the cable region.
Conclusions:
Here, we exploited the actin node and cable system of Xenopus mesoderm cells engaged in CE for an in-depth analysis of the relationship between PCP proteins, Septins, and actin, providing two important insights. First, while the superficial actin node and cable system is essential for CE in Xenopus 16,17, and its dynamics are controlled by PCP 18, how the overt planar polarization of the system relates to PCP proteins has not been obvious. For example, both myosin-driven contraction of the system 16-18 and the orientation of actin fibers within it 4 are polarized mediolaterally, yet PCP proteins are well-known to mark the anteroposterior axis of cells engaged in CE 22-24,35,36. Our findings here are important then for revealing a previously cryptic anteroposterior-directed planar polarity of the actin node and cable system, displayed both by the anterior coalescence of actin cables (Figure 2) and by the longer persistence length of actin fibers anteriorly (Figure 3). Crucially, PCP proteins and Sept7 are essential for both.
Second, when considered as a whole, our data suggest a preliminary model for the emergence of both mediolateral and anteroposterior polarity in the node and cable system. PCP proteins (Figure 2) and Twf14 are each essential for mediolateral alignment of actin fibers, arguing they act in concert and independently of Sept7 to govern this aspect of polarity. At the same time, PCP proteins are anteriorly biased (Figure 1), where they help to establish the higher-level, anteroposteriorly polarized actin organization described above. Specifically, the order observed anteriorly after loss PCP or Septins is similar to that normally observed posteriorly (Figure 3). In addition, speckle microscopy revealed that Sept7 is required to stabilize actin filaments in anterior cables. Altogether, these data suggest that PCP may recruit Sept7, where it imparts stability to actin and increases overall order, which in turn facilitates cable formation specifically in anterior regions of cells.
Finally, these data on polarization of an actin network may shed light on our emerging understanding that very local, sub-cellular mechanical heterogeneities play key roles in cell behavior 37-39. Both experiments and theory now argue that such heterogeneities are essential for normal CE 40-42. It is tempting to speculate that the highly local patterning of the actin cytoskeleton described here may provide a basis for local patterning of cell mechanics.
STAR Methods
Lead contact
Further information and reagent requests should be directed to John B. Wallingford (Wallingford@austin.utexas.edu).
Material availability
All reagents available from lead contact with completed MTA upon request.
Data and code availability
All data reported in this paper will be shared by the lead contact upon request.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
Experimental model and subject details
Xenopus embryo manipulations:
Xenopus laevis females were super-ovulated by injection of hCG (human chorionic gonadotropin). The following day, eggs were squeezed from the females. In vitro fertilization was performed by homogenizing a small part of a harvested testis in 1X Marc’s Modified Ringer’s (MMR) and mixing with collected eggs. Embryos were dejellied in 3% cysteine (pH 7.9) at the two-cell stage. Fertilized embryos were rinsed and reared in 1/3X Marc’s Modified Ringer’s (MMR) solution. For microinjections, embryos were placed in a 2% ficoll in 1/3X MMR solution and injected using forceps and an Oxford universal micromanipulator. Morpholino oligonucleotide or CRISPR/Cas9 was injected into two dorsal blastomeres to target the dorsal marginal zone (DMZ). Embryos were microinjected with mRNA at the 4-cell stage for uniform labeling and at the 64- to 128- cell stage for mosaic labeling. Embryos were staged according to Nieuwkoop and Faber (Nieuwkoop and Faber, 1994). All animal work has been approved by the IACUC of UT, Austin, protocol no. AUP-2021-00167.
Method details
Plasmids, mRNA, protein, and MOs for microinjections:
Xenopus gene sequences were obtained from Xenbase (www.xenbase.org) and open reading frames (ORF) of genes were amplified from the Xenopus cDNA library by polymerase chain reaction (PCR), and then are inserted into a pCS10R vector fused with eGFP. The following constructs were cloned into pCS vector: Sept8-GFP, Sept9-GFP. These constructs were linearized and the capped mRNAs were synthesized using mMESSAGE mMACHINE SP6 transcription kit (ThermoFisher Scientific, Waltham, MA, USA). Concentration for GFP localization was titrated to the lowest concentration where we could still detect GFP signal, but no cellular phenotype was observed. The amount of injected mRNAs per blastomere are as follows: Lifeact-GFP or −RFP [50-100pg 43], Pk2-GFP [35pg] 44, Vangl2-GFP [35pg] 44, Dvl2-GFP [5-8pg] 45, Cap1-GFP[25pg] 4, Septin2-GFP [50pg] 5,6, Septin7-GFP [35pg] 5,6, Septin8-GFP [40pg], Septin9GFP [40pg] and Xdd1 [500pg] 45.
Morpholinos:
Morpholinos used were previously designed to target exon-intron splicing junction (Gene Tools, Philomath, OR, USA). The MO sequences and the working concentrations include: Septin7 morpholino5,6, 5’ TGCTGTAGAGTCAGTGCCTCGCCTT 3’, 40 ng per injection at 4-cell stage; Vangl2 morpholino46, 5’ CGTTGGCGGATTTGGGTCCCCCCGA 3’, 20ng per injection at 4-cell stage; Pk2 morpholino44, 5’ GAACCCAAACAAACACTTACCTGTT 3’, 20ng per injection at 4-cell stage.
Actin Speckle Microscopy:
For fluorescent actin speckle microscopy, labeled actin monomers (Alexa 647 conjugated Actin, Catalog number A12374, ThermoFisher, Waltham, MA, USA; initial experiments were performed with Alexa 568, yielding the same results) were reconstituted in a 2mg/ml stock solution. A 0.01ug/ul working solution was prepared for each 10nl injection, and 0.1 ng was injected into dorsal blastomeres of 4-cell stage embryos. This concentration was determined empirically by titrating the amount injected until no cellular phenotype was observed and labeled actin monomers were sparse enough to detect individual “speckles” 31,32.
Live imaging of Keller explants:
mRNAs were injected at the dorsal side of 4 cell stage embryos, and the dorsal marginal zone (DMZ) tissues were dissected out at stage 10.5 using forceps, hairloops, and eyebrow hair knives. Each explant was mounted to a fibronectin-coated dish in Steinberg’s solution, and cultured at 16°C for half a day before imaging with a Zeiss LSM700 confocal microscope (Jena, Germany), or Nikon N-STORM combined TIRF/STORM microscope (Minato City, Tokyo, Japan).
Inhibitor treatments:
Inhibitors were solubilized in DMSO to a stock concentration of 10mM for Latrunculin B and 100mM for (+) Blebbistatin. Explants with labeled actin and Vangl2 were treated with 1uM LatrunculinB (diluted 1:10,000 in Steinberg’s solution)(CAS Number: 76343-94-7), a cell permeable actin polymerization inhibitor, or 100uM (+) Blebbistatin (diluted 1:1,000 in Steinberg’s solution)(CAS Number 856925-75-2), a non-muscle myosin inhibitor. Samples were treated with DMSO (vehicle control) or specific inhibitors and imaged immediately after application.
Image analysis:
Images were processed with the Fiji distribution of ImageJ and Photoshop (Adobe) software suites, and figures were assembled in Illustrator (Adobe) and Affinity Designer (***).
Cell length and width measurements were manually taken in Fiji along the long axis and through the centroid of the cell.
AP positioning of node and PCP proteins measurements were taken by manually drawing a vertical line though the AP axis of a cell through the node and cable region. Intensity plots were measured using the multiplot feature in Fiji. The pixels of highest fluorescent intensity were identified for proteins of interest and the corresponding position within the cell was noted. To compare across many samples, this position was scaled between 0 and 1 with 0 representing the most anterior position within a cell and 1 representing the most posterior position.
Similarly, Anterior cable intensity measurements were taken by drawing a vertical line through the midline of the cell with a line width matching the average width of a single cell (150 pixels). Using the multiplot feature in Fiji, the average actin intensity averaged across the anterior posterior axis of a cell was quantified and averaged over several samples.
Actin cable orientations were taken from TIRF images of single cell cortical actin network using the OrientationJ plugin in Fiji (http://bigwww.epfl.ch/demo/orientation/).
Actin cable bundling measurements were taken using kymographs and manual measurements between two points in Fiji. Kymographs were taken across the anteroposterior axis of individual cells near the actin node. We then measured the distance between adjacent actin filaments over time over specified time intervals.
Divergence measurements of actin speckles were taken using the PIVlab software in Matlab. Specific xy coordinates within the cell were identified to link divergence measurements obtained in PIVlab/Matlab with intensity values demarcating the node taken with Fiji.
Fluorescent actin speckle lifetime measurements were taken by tracking individual speckles using MosaicSuite (http://mosaic.mpi-cbg.de) object tracking plugin in Fiji. Custom scripts were written in Matlab to count the lifetime of each speckle. We defined the node by localization of anterior PCP proteins (Vangl2-GFP or PK2 GPF) and actin (Lifeact-RFP). We defined the cable region by actin fiber morphology and localization directly adjacent to the node. Each anterior and posterior actin speckle ROI is 100px x 100px.
Persistence length measurements of actin filaments:
The open-source biopolymer tracking software TSOAX v0.1.8 29 (https://www.lehigh.edu/~div206/tsoax/) was used to track actin fibers from TIRF movies automatically. The ridge threshold, stretch-factor, and gaussian std (pixels) parameters were set to 0.01, 1.5, and 1 respectively. These values were chosen as they resulted in accurate filament labeling. The remaining parameters were unchanged from default values. TIRF movies were processed prior to TSOAX analysis with the application of a gaussian blur of sigma radius = 1 to enhance the accuracy of fiber tracking. TSOAX output containing the spatial and temporal coordinates that define labeled fibers and track groupings was further analyzed to quantify the persistent length of each fiber using customized Python and MATLAB scripts. Briefly, we treated each actin filament as a non-equilibrated semi-flexible polymer. Its persistent length can be obtained via an equation derived from the worm-like chain model (WLC)47:
where is the length of an arbitrary segment of the filament, is the end-to-end distance of the segment, and is set to 1.5 for non-equilibrated fibers. The measure of the mean square of is a function of for each fiber, and the weighted least squares is used to measure.
Quantification and statistical analysis:
Statistical analyses were carried out using Microsoft Excel, Matlab (Natick, MA, USA), and GraphPad Prism (Graphpad, San Diego, CA, USA) software. Each experiment was conducted on multiple days and included biological replicates. Due to non-normality observed and low n-number in some observations, we used non-parametric tests for statistical comparisons throughout the manuscript. We used Mann Whitley U tests, Kruskal-Wallis tests, or Kolmogorov–Smirnov tests for statistical comparisons of two groups, multiple groups, or distributions, respectively. MEAN and SD are plotted along with individual data points throughout the manuscript.
N values and Statistics for each figure are as follows:
Panel G: Polarized: Kruskal-Wallis test; Vangl2 vs Pk2 p>0.999, Vangl2 vs Dvl2 p<0.0001, Pk2 vs Dvl2 p<0.0001; Vangl2 GFP n= 74 cells from 10 embryos; Pk2GFP n= 45 cells from 3 embryos; Dvl2-GFP n= 75 cells from 9 embryos)
Panel H: Pre-polarized: Kruskal-Wallis, p>0.999 n.s., Vangl2 GFP n= 31 cells from 7 embryos; Pk2GFP n= 42 cells from 9 embryos; Dvl2-GFP n= 84 cells from 3 embryos).
Panel P: Mann-Whitney test, control vs Sept7 MO, p<0.0001****, n=34 control cells from 3 embryos; n= 60 Sept7MO cells from 6 embryos).
Panels A-F: Hr1 n= 103 cells, Hr2 n=117 cells, Hr3 n=98 cells, Hr4 n=73 cells).
Panels G-K: Vangl 2 MO: Kolmogorov-Smirnov test, actin filament orientation p<0.0001; n= 38 control cells from 12 embryos; n=46 morphant cells from 13 embryos; Pk2MO, KS test, actin filament orientation p<0.0001; n= 23 control cells from 4 embryos; n= 23 morphant cells from 4 embryos). D) dominant negative (DN) disheveled (Xdd1) (control vs Xdd1, Kolmogorov-Smirnov test, actin filament orientation p<0.0001; n=23 control cells from 13 embryos; n= 38 mutant cells from 8 embryos) and E) Sept7 morphant cell, inlay of actin node and cable, magenta box highlighting region of inlay (control vs Sept7MO, Kolmogorov-Smirnov test, actin filament orientation p=0.5596; n= 26 control cells from 10 embryos; n= 31 morphant cells from 10 embryos).
Panel D. Kruskal-Wallis test, (Control A vs P p=0.0046**, Sept7MO A vs P p>0.999 n.s.,
Vangl2 MO A vs P p>0.999 n.s., Control A vs Sept7MO A p=0.0481*, Control A vs Sept7MO P p= 0.0037**, all other pairwise comparisons p>0.999 n.s.)
Panel G. (control vs Sept7 MO, n=16 control cells from 6 embryos; n= 19 Vangl2MO cells from 6 embryos). Scale= 10um.
Panel G, H: n=7 control cells from 6 embryos.
Panel I: (Kruskal-Wallis test, control node vs control cable p=0.0093, control node vs Sept7MO node ns p>0.9999, control cable vs Sept7MO cable p<0.0001, Sept7MO node vs Sept7MO cable p>0.999, control cable vs Sept7MO nodes p=0.0033, nodes vs Sept7MO cable n.s. p=0.5498; n= 31 control node, n=29 control cable from 12 embryos; n= 13 Sept7MO node, n= 19 Sept7MO cable from 7 embryos).
Supplementary Material
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Experimental subjects | ||
| Xenopus laevis (male and female) | Xenopus1 | https://xenopus1.com/ |
| Antibodies | ||
| Rat anti-Vangl2 antibody (GST-tagged recombinant Vangl2 N-term fragment) | Millipore-Sigma | MABN750 |
| Antibodies | ||
| Rat anti-Vangl2 antibody (GST-tagged recombinant Vangl2 N-term fragment) | Millipore-Sigma | MABN750 |
| Chemicals, peptides, and recombinant proteins | ||
| hCG (human chorionic gonadotropin) | Merck | Code# 133754 |
| Alexa 647 conjugated Actin | ThermoFisher | Cat# A12374 |
| Latrunculin B | AbCam | Cat# Ab144291 |
| Blebbistatin | Millipore Sigma | Cat# 203390 |
| Critical commercial assays | ||
| mMessage mMachine SP6 transcription kit | ThermoFisher | Cat# AM1340 |
| Oligonucleotides | ||
| Vangl2 morpholino | Park & Moon46 | Gene-tools.com |
| Pk2 morpholino | Butler & Wallingford44 | Gene-tools.com |
| Septin7 morpholino | Kim et al.5 | Gene-tools.com |
| Recombinant DNA | ||
| Lifeact-RFP | Riedl, et al. 43 | N/A |
| Vangl2-GFP | Butler & Wallingford44 | N/A |
| Pk2-GFP | Butler & Wallingford44 | N/A |
| Dvl2-GFP | Wallingford, et al.45 | N/A |
| Septin7-GFP | Shindo & Wallingford5 | N/A |
| Septin2-GFP | Shindo & Wallingford5 | N/A |
| Sept8-GFP | Cloned for this paper | N/A |
| Sept9-GFP | Cloned for this paper | N/A |
| Twf1-GFP | Devitt, et al.4 | N/A |
| Cfl2-GFP | Devitt, et al.4 | N/A |
| CAP1-GFP | Devitt, et al.4 | N/A |
| DN Dishevelled (Xdd1) | Wallingford, et al.45 | N/A |
| Software and algorithms | ||
| Prism | GraphPad Software | Graphpad.com |
| Excel | Microsoft | Microsoft.com |
| Matlab | MathWorks | Mathworks.com |
| Python | Python | Python.org |
| Orientation J | Püspöki, et al. | http://bigwww.epfl.ch/demo/orientation/ |
| MosaicSuite | Sbalzarini & Koumoutsakos | http://mosaic.mpi-cbg.de |
| TSOAX v0.1.8 | Xu, et al. | https://www.lehigh.edu/~div206/tsoax/ |
Highlights:
PCP proteins localize to the actin node and cable system during Xenopus gastrulation
The node and cable system displays a cryptic anteroposterior polarity
Anteroposterior polarity of the node and cable system is PCP and Septin-dependent
Sept7 controls local dynamics of polarized actin flow
Acknowledgements
We would like to acknowledge the Microscopy and Imaging Facility of the Center for Biomedical Research Support at The University of Texas at Austin for use of equipment and specifically thank Anna Webb and Julie Hayes for assistance and technical expertise. And a big thank you to all of the members of the Wallingford lab for their advice and critical feedback! This work was supported by the NICHD (R01HD099191).
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Declaration of interests
The authors declare no completing interests.
References Cited
- 1.Huebner RJ, and Wallingford JB (2018). Coming to Consensus: A Unifying Model Emerges for Convergent Extension. Dev Cell 46, 389–396. 10.1016/j.devcel.2018.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Butler MT, and Wallingford JB (2017). Planar cell polarity in development and disease. Nat Rev Mol Cell Biol 18, 375–388. 10.1038/nrm.2017.11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Mahaffey JP, Grego-Bessa J, Liem KF Jr., and Anderson KV (2013). Cofilin and Vangl2 cooperate in the initiation of planar cell polarity in the mouse embryo. Development 140, 1262–1271. 10.1242/dev.085316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Devitt CC, Lee C, Cox RM, Papoulas O, Alvarado J, Shekhar S, Marcotte EM, and Wallingford JB (2021). Twinfilin1 controls lamellipodial protrusive activity and actin turnover during vertebrate gastrulation. J Cell Sci 134. 10.1242/jcs.254011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Kim SK, Shindo A, Park TJ, Oh EC, Ghosh S, Gray RS, Lewis RA, Johnson CA, Attie-Bittach T, Katsanis N, et al. (2010). Planar Cell Polarity Acts Through Septins to Control Collective Cell Movement and Ciliogenesis. Science 329, 1337–1340. science. 1191184 [pii] 10.1126/science.1191184. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Shindo A, and Wallingford JB (2014). PCP and septins compartmentalize cortical actomyosin to direct collective cell movement. Science 343, 649–652. 343/6171/649 [pii] 10.1126/science.1243126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Ossipova O, Kim K, and Sokol SY (2015). Planar polarization of Vangl2 in the vertebrate neural plate is controlled by Wnt and Myosin II signaling. Biol Open 4, 722–730. 10.1242/bio.201511676. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Newman-Smith E, Kourakis MJ, Reeves W, Veeman M, and Smith WC (2015). Reciprocal and dynamic polarization of planar cell polarity core components and myosin. Elife 4, e05361. 10.7554/eLife.05361. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Spiliotis ET, and Nakos K (2021). Cellular functions of actin- and microtubule-associated septins. Curr Biol 31, R651–r666. 10.1016/j.cub.2021.03.064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Cui C, Chatterjee B, Lozito T, Zhang Z, and Lo CW (2013). Wdpcp, a PCP Protein Required for Ciliogenesis, Regulates Directional Cell Migration and Cell Polarity by Direct Modulation of the Actin Cytoskeleton. PLoS Biol. 11, e1001720. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Dash SN, Lehtonen E, Wasik AA, Schepis A, Paavola J, Panula P, Nelson WJ, and Lehtonen S (2014). sept7b is essential for pronephric function and development of left–right asymmetry in zebrafish embryogenesis. J Cell Sci 127, 1476–1486. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Torii H, Yoshida A, Katsuno T, Nakagawa T, Ito J, Omori K, Kinoshita M, and Yamamoto N (2016). Septin7 regulates inner ear formation at an early developmental stage. Dev Biol 419, 217–228. 10.1016/j.ydbio.2016.09.012. [DOI] [PubMed] [Google Scholar]
- 13.Ponti A, Machacek M, Gupton SL, Waterman-Storer CM, and Danuser G (2004). Two distinct actin networks drive the protrusion of migrating cells. Science 305, 1782–1786. 10.1126/science.1100533 305/5691/1782 [pii]. [DOI] [PubMed] [Google Scholar]
- 14.Martin AC, Kaschube M, and Wieschaus EF (2009). Pulsed contractions of an actin-myosin network drive apical constriction. Nature 457, 495–499. nature07522 [pii] 10.1038/nature07522. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Roh-Johnson M, Shemer G, Higgins CD, McClellan JH, Werts AD, Tulu US, Gao L, Betzig E, Kiehart DP, and Goldstein B (2012). Triggering a cell shape change by exploiting preexisting actomyosin contractions. Science 335, 1232–1235. 10.1126/science.1217869. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Pfister K, Shook DR, Chang C, Keller R, and Skoglund P (2016). Molecular model for force production and transmission during vertebrate gastrulation. Development 143, 715–727. 10.1242/dev.128090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Skoglund P, Rolo A, Chen X, Gumbiner BM, and Keller R (2008). Convergence and extension at gastrulation require a myosin IIB-dependent cortical actin network. Development 135, 2435–2444. dev.014704 [pii] 10.1242/dev.014704. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Kim HY, and Davidson LA (2011). Punctuated actin contractions during convergent extension and their permissive regulation by the non-canonical Wnt-signaling pathway. J Cell Sci 124, 635–646. jcs.067579 [pii] 10.1242/jcs.067579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Weng S, Huebner RJ, and Wallingford JB (2022). Convergent extension requires adhesion-dependent biomechanical integration of cell crawling and junction contraction. Cell Rep 39, 110666. 10.1016/j.celrep.2022.110666. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Shih J, and Keller R (1992). Cell motility driving mediolateral intercalation in explants of Xenopus laevis. Development 116, 901–914. [DOI] [PubMed] [Google Scholar]
- 21.Keller R, Cooper MS, Danilchik M, Tibbetts P, and Wilson PA (1989). Cell intercalation during notochord development in Xenopus laevis. J Exp Zool 251, 134–154. [DOI] [PubMed] [Google Scholar]
- 22.Yin C, Kiskowski M, Pouille PA, Farge E, and Solnica-Krezel L (2008). Cooperation of polarized cell intercalations drives convergence and extension of presomitic mesoderm during zebrafish gastrulation. J Cell Biol 180, 221–232. jcb.200704150 [pii] 10.1083/jcb.200704150. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Ciruna B, Jenny A, Lee D, Mlodzik M, and Schier AF (2006). Planar cell polarity signalling couples cell division and morphogenesis during neurulation. Nature 439, 220–224. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Yang W, Garrett L, Feng D, Elliott G, Liu X, Wang N, Wong YM, Choi NT, Yang Y, and Gao B (2017). Wnt-induced Vangl2 phosphorylation is dose-dependently required for planar cell polarity in mammalian development. Cell Res 27, 1466–1484. 10.1038/cr.2017.127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Strutt H, and Strutt D (2009). Asymmetric localisation of planar polarity proteins: Mechanisms and consequences. Semin Cell Dev Biol 20, 957–963. S1084-9521(09)00044-5 [pii] 10.1016/j.semcdb.2009.03.006. [DOI] [PubMed] [Google Scholar]
- 26.Woods BL, and Gladfelter AS (2021). The state of the septin cytoskeleton from assembly to function. Curr Opin Cell Biol 68, 105–112. 10.1016/j.ceb.2020.10.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kakebeen AD, Huebner RJ, Shindo A, Kwon K, Kwon T, Wills AE, and Wallingford JB (2021). A temporally resolved transcriptome for developing "Keller" explants of the Xenopus laevis dorsal marginal zone. Dev Dyn 250, 717–731. 10.1002/dvdy.289. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Shih J, and Keller R (1992). Patterns of cell motility in the organizer and dorsal mesoderm of Xenopus laevis. Development 116, 915–930. [DOI] [PubMed] [Google Scholar]
- 29.Xu T, Langouras C, Koudehi MA, Vos BE, Wang N, Koenderink GH, Huang X, and Vavylonis D (2019). Automated Tracking of Biopolymer Growth and Network Deformation with TSOAX. Sci Rep 9, 1717. 10.1038/s41598-018-37182-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Waterman-Storer CM, Desai A, Bulinski JC, and Salmon ED (1998). Fluorescent speckle microscopy, a method to visualize the dynamics of protein assemblies in living cells. Curr Biol 8, 1227–1230. 10.1016/s0960-9822(07)00515-5. [DOI] [PubMed] [Google Scholar]
- 31.Vallotton P, Gupton SL, Waterman-Storer CM, and Danuser G (2004). Simultaneous mapping of filamentous actin flow and turnover in migrating cells by quantitative fluorescent speckle microscopy. Proc Natl Acad Sci U S A 101, 9660–9665. 10.1073/pnas.0300552101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Watanabe N, and Mitchison TJ (2002). Single-molecule speckle analysis of actin filament turnover in lamellipodia. Science 295, 1083–1086. 10.1126/science.1067470. [DOI] [PubMed] [Google Scholar]
- 33.Stamhuis E, and Thielicke W (2014). PIVlab–towards user-friendly, affordable and accurate digital particle image velocimetry in MATLAB. Journal of open research software 2, 30. [Google Scholar]
- 34.Daggett DF, Boyd CA, Gautier P, Bryson-Richardson RJ, Thisse C, Thisse B, Amacher SL, and Currie PD (2004). Developmentally restricted actin-regulatory molecules control morphogenetic cell movements in the zebrafish gastrula. Curr Biol 14, 1632–1638. 10.1016/j.cub.2004.08.024. [DOI] [PubMed] [Google Scholar]
- 35.Butler MT, and Wallingford JB (2018). Spatial and temporal analysis of PCP protein dynamics during neural tube closure. Elife 7. 10.7554/eLife.36456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Shindo A, Inoue Y, Kinoshita M, and Wallingford JB (2019). PCP-dependent transcellular regulation of actomyosin oscillation facilitates convergent extension of vertebrate tissue. Dev Biol 446, 159–167. 10.1016/j.ydbio.2018.12.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Lieber AD, Schweitzer Y, Kozlov MM, and Keren K (2015). Front-to-rear membrane tension gradient in rapidly moving cells. Biophys J 108, 1599–1603. 10.1016/j.bpj.2015.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Strale PO, Duchesne L, Peyret G, Montel L, Nguyen T, Png E, Tampe R, Troyanovsky S, Henon S, Ladoux B, et al. (2015). The formation of ordered nanoclusters controls cadherin anchoring to actin and cell-cell contact fluidity. J Cell Biol 210, 333–346. 10.1083/jcb.201410111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Shi Z, Graber ZT, Baumgart T, Stone HA, and Cohen AE (2018). Cell membranes resist flow. Cell 175, 1769–1779. e1713. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Vanderleest TE, Smits CM, Xie Y, Jewett CE, Blankenship JT, and Loerke D (2018). Vertex sliding drives intercalation by radial coupling of adhesion and actomyosin networks during Drosophila germband extension. Elife 7. 10.7554/eLife.34586. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Huebner RJ, Malmi-Kakkada AN, Sarıkaya S, Weng S, Thirumalai D, and Wallingford JB (2021). Mechanical heterogeneity along single cell-cell junctions is driven by lateral clustering of cadherins during vertebrate axis elongation. Elife 10. 10.7554/eLife.65390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Cavanaugh KE, Staddon MF, Chmiel TA, Harmon R, Budnar S, Yap AS, Banerjee S, and Gardel ML (2022). Force-dependent intercellular adhesion strengthening underlies asymmetric adherens junction contraction. Curr Biol 32, 1986–2000.e1985. 10.1016/j.cub.2022.03.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Riedl J, Crevenna AH, Kessenbrock K, Yu JH, Neukirchen D, Bista M, Bradke F, Jenne D, Holak TA, Werb Z, et al. (2008). Lifeact: a versatile marker to visualize F-actin. Nat Methods 5, 605–607. 10.1038/nmeth.1220. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Butler MT, and Wallingford JB (2015). Control of vertebrate core planar cell polarity protein localization and dynamics by Prickle 2. Development 142, 3429–3439. 10.1242/dev.121384. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Wallingford JB, Rowning BA, Vogeli KM, Rothbacher U, Fraser SE, and Harland RM (2000). Dishevelled controls cell polarity during Xenopus gastrulation. Nature 405, 81–85. 10.1038/35011077. [DOI] [PubMed] [Google Scholar]
- 46.Park M, and Moon RT (2002). The planar cell-polarity gene stbm regulates cell behaviour and cell fate in vertebrate embryos. Nat Cell Biol 4, 20–25. [DOI] [PubMed] [Google Scholar]
- 47.Lamour G, Kirkegaard JB, Li H, Knowles TPJ, and Gsponer J (2014). Easyworm: an open-source software tool to determine the mechanical properties of worm-like chains. Source Code for Biology and Medicine 9, 16. 10.1186/1751-0473-9-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data reported in this paper will be shared by the lead contact upon request.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.




