Resources
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Chicken anti-GFP | Aves | GFP-1020 |
| Mouse anti-HA.11 – Clone 16B12 | Covance | MMS-101R |
| Rabbit anti-RFP | Abcam | Ab62341 |
| Mouse anti-DNA | American Research Products Inc | 03-61014 |
| Rabbit anti-ERp72 (D70D12) | Cell Signaling Tech | 5033S |
| Rabbit anti-Tom20 | Abcam | ab78547 |
| Mouse anti-DNA | Progen Biotechnik | 61014 |
| Rabbit anti-TFAM | Abcam | ab131607 |
| Chicken anti-Map2 | Abcam | ab5392 |
| Rat anti-Pan-Neurofascin | UC Davis/NIH NeuroMab Facility | 75-172 |
| Rabbit anti-GFP | Abcam | ab6556 |
| Goat-anti-rabbit-AF594 | Thermo Fisher Sci | A-11037 |
| donkey-anti-mouse-AF594 | Thermo Fisher Sci | A-21203 |
| goat-anti-rabbit-S635P | Abberior | 2-0012-007-2 |
| goat-anti-mouse-S635P | Abberior | 2-0002-007-5 |
| goat-anti-mouse-AF488 | Thermo Fisher Sci | A-11001 |
| goat-anti-chicken-AF488 | abcam | ab150173 |
| goat-anti-mouse-DyLight405 | Thermo Fisher Sci | 35501BID |
| FluoTag®-X4 anti-GFP | NanoTag Biotech. | N0304-Ab580 |
| FluoTag®-X4 anti-GFP | NanoTag Biotech. | 0304-Ab635-L |
| Kits | ||
| Infusion HD Cloning Plus | Clontech | 638911 |
| QuantiNova Probe PCR Kit | Qiagen | 208254 |
| Lipofectamine 2000 Transfection Reagent | Thermo Fisher Sci | 11668019 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Fast Green | Sigma | F7258 |
| Hank’s Balance Salt Solution | Thermo Fisher Sci | 14185-052 |
| HEPES | Thermo Fisher Sci | 15630-080 |
| B27 Supplement | Thermo Fisher Sci | 17504-004 |
| GlutaMAX | Thermo Fisher Sci | 35050-061 |
| Neurobasal | Thermo Fisher Sci | 21103-049 |
| Penicillin/Streptomycin | Thermo Fisher Sci | 15140-122 |
| Papain | Worthington | LK003178 |
| DNase | Sigma | D5025 |
| Poly-D-Lysine | Sigma | P0899 |
| Fetal Bovine Serum | Gemini Bio-Products | 100-500 |
| Normal Goat Serum | Thermo Fisher Sci | 16210-064 |
| BSA | Sigma | A7906 |
| PBS | Sigma | P4417 |
| NaCl | Sigma | 746398 |
| KCl | Sigma | P5405 |
| NaH2PO4 | Sigma | S5011 |
| CaCl2 | Sigma | C5670 |
| Glucose | Sigma | G7021 |
| NH4Cl | Sigma | A9434 |
| Tetramethylrhodamine methyl ester perchlorate (TMRM) | Sigma | T5428 |
| Trizma | Sigma | T1503 |
| Trizma-HCl | Sigma | T3253 |
| MgCl2 | Sigma | M4880 |
| Protease and phosphatase cocktail inhibitors | Sigma | 11836170001 |
| Benzonase | EMD Millipore | 70664-3 |
| EDTA | Sigma | E6758 |
| NP-40 | Sigma | NP40 |
| Triton X-100 | Sigma | X100 |
| Tween 20 | Sigma | P9416 |
| FCCP | Sigma | C2920 |
| Antimycin A | Sigma | A8674 |
| Oligomycin | Sigma | O4876 |
| Bongkrekic Acid | Sigma | B6179 |
| FuGENE transfection reagent | Promega | E2311 |
| Neurobasal medium | Gibco | 21103049 |
| PBS | Nissui | 05913 |
| MitoBright LT Green | Dojindo | MT10 |
| NaCl | FUJIFILM Wako | 190-13921 |
| KCl | FUJIFILM Wako | 163-03545 |
| CaCl2 | Nacalai tesque | 08894-25 |
| MgCl2 | FUJIFILM Wako | 133-15051 |
| HEPES | Thermo Fisher Sci | 15630106 |
| Glucose | FUJIFILM Wako | 047-31161 |
| Yeast RNA | Roche | 10109223001 |
| Minimum Essential Medium, MEM | Thermo Fisher Sci | 21090022 |
| poly-D-ornithine | Sigma Aldrich | P8638 |
| HEPES | Thermo Fisher Sci | 15630-080 |
| B27 Supplement | Thermo Fisher Sci | 17504-004 |
| Horse Serum | Thermo Fisher Sci | 26050088 |
| Neurobasal | Thermo Fisher Sci | 21103-049 |
| Penicillin/Streptomycin | Sigma Aldrich | P4333 |
| L-Glutamine | Thermo Fisher Sci | 25030-024 |
| Sodium pyruvate | Thermo Fisher Sci | 11360-070 |
| NaCl | Sigma | 746398 |
| KCl | Sigma | P5405 |
| CaCl2 · 2H2O | Sigma | C3881 |
| MgCl2 * 6 H2O | Sigma | M2670 |
| Triton X-100 | Sigma | X100 |
| Glucose | Sigma | D8375 |
| BSA | Sigma | A7906 |
| Paraformaldehyde | Sigma | P6148 |
| DABCO | Thomas Scientific | C966M75 |
| Experimental Models: Cell Lines | ||
| Human: HEK cells | ATCC | CRL-11268 |
| Human: HEK293T cells | RIKEN BRC | RCB2202 |
| Mouse: NIH3T3 cells | RIKEN BRC | RCB2767 |
| Experimental Models: Organisms/Strains | ||
| Mouse: CD1 IGS | Charles River Labs | Strain Code: 022 |
| Mouse: Slc:ICR | SLC | |
| Rat: Sprague Dawley | Janvier Labs | Strain: RjHan:SD |
| Oligonucleotides | ||
| Mff shRNA: CCGGGATCGTGGTTACAGGAAATAACTCGAGTTATTTCCTGTAACCACGATCTTTTTTG | Sigma | TRCN0000174665 |
| Control shRNA: CCGCAGGTATGCACGCGT | (51) | Addgene Plasmid 10879 |
| Recombinant DNA | ||
| pCAG HAmCherry-ActA | This paper | N/A |
| pCAG Twinkle-venus | This paper | N/A |
| pCAG TFAM-tdTomato | This paper | N/A |
| pCAG mt-YFP | (33) | N/A |
| pCAG mt-SypHer | This paper | N/A |
| pCAG mt-SypHer p2a mt-HAmCherry | This paper | N/A |
| pCAG 4xmt-iATPSnFR1.0 | This paper | N/A |
| pCAG 4xmt-mScarlet-iATPSnFR1.0 | This paper | N/A |
| pCAG mTAGBFP2 | (10) | N/A |
| pCAG mScarlet | (10) | Addgene Plasmid 85042 |
| pLKO1.5 | (51) | Addgene Plasmid 10879 |
| FUW mito-YFP | This paper | N/A |
| FUW Twinkle-mRuby3 | This paper | N/A |
| FUW Twinkle-mScarlet | This paper | N/A |
| pOMP25-rsEGFP2 | (52) | N/A |
| Others | ||
| #1.5 18 mm glass coverslips | Marienfeld | 0117580 |
| Software | ||
| Imspector | Max-Planck-Innov. | |
| OriginPro2020 | OriginLab | |