Skip to main content
. 2024 Feb 12;13:e86168. doi: 10.7554/eLife.86168

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene (Homo sapiens) EZH2 RefSeq 2146, NM_001203247.2 DNA sequencing authentication.
Strain (Mus musculus) Kdm1afl/+conditional
mutant strain
Jackson Laboratory B6.129-Kdm1a tm1.1Sho/J;
Strain #: 023969
Kerenyi et al., 2013
Strain (Mus musculus) Transgenic actin-Cre-ER strain Jackson Laboratory CAGGCre-ER,
B6.Cg-Tg(CAG-cre/Esr1*)
5Amc/J; Strain #: 004682
Hayashi and McMahon, 2002
Strain (Mus musculus) Transgenic Vav-iCre
transgenic mice
Jackson Laboratory B6.Cg-Commd10Tg(Vav1-icre)A2Kio/J;
Strain #:008610
de Boer et al., 2003
Strain (Mus musculus) transgenic Sox2-Cre strain Jackson Laboratory B6.Cg-Edil3Tg(Sox2-cre)1Amc/J;
Strain #: 008454
Hayashi et al., 2002
Strain (Mus musculus) L3mbt3+/-mutant strain Leng et al., 2018, Mbt-1+/-, B6;129-L3mbtl3tm1Tmiy Arai and Miyazaki, 2005
Strain (Mus musculus) Dcaf5+/-mutant strain This paper Centre for Phenogenomics
(Toronto, Canada)
produced with gRNA1: CTAGTTAGGTACAATAGGGC

and gRNA2: TATTCCTCTGCGACCACTCA.
Strain (Mus musculus) L3mbtl3fl/+ mutant strain European Mouse Mutant Cell
Repository (EuMMCR)
L3mbtl3tm1a(EUCOMM)
Hmgu mice
Produced with the FLPo-10 mouse strain.
Strain (Mus musculus) FLPo-10 mouse strain Jackson Laboratory B6.Cg-Tg(Pgk1-flpo)10Sykr/J;
Strain #: 011065
Wu et al., 2009
Cell line (Homo sapiens) 293T ATCC CRL-3216 Authenticated by high levels of CDK
inhibitor CDKN2A and p53
Cell line (Homo sapiens) HCT116 ATCC CCL-247 Authenticated by expression of wild-
type p53 and induction of CDKN1A
by UV irradiation
Cell line (Homo sapiens) G401 CRL-1441 ATCC Authenticated by lack of
expression of SMARCB1
Cell line (Homo sapiens) T47D ATCC HTB-133 Authenticated by lack of
ARID1A expression
Cell line (Homo sapiens) HeLa ATCC CRM-CCL-2 Authenticated by high levels of
CDK inhibitor CDKN2A and p53
Cell line (Homo sapiens) PA-1 ATCC CRL-1572 Authenticated by expression
of SOX2 and OCT4
Cell line (Homo sapiens) H1299 (NCI-H1299) ATCC CRL-5803 Authenticated by lack of p53
Cell line (Homo sapiens) H520 (NCI-H520) ATCC HTB-182 Authenticated by high
expression of SOX2
Cell line (Mus musculus) Mouse embryonic
fibroblasts (MEFs)
This paper Primary embryonic
fibroblasts from
isolated
mouse embryos
Primary cells; prepared according to IACUC
approved protocols (IACUC-01161)
711621 and (IACUC-01177)832146.
Cell line (Mus musculus) Mouse embryonic
fibroblasts (MEFs) from
K20R mutant mice
This paper Mouse embryonic
fibroblasts (MEFs) from
homozygous
Ezh2K20R/K20R
mutant mice
Primary cells; prepared according to IACUC
approved protocols (IACUC-01161)
711621 and (IACUC-01177)832146.
Cell line (Mus musculus) L3mbtl3-knockout MEFs This paper MEFs from homozygous
L3mbtl3 KO mutant mice
Primary cells; prepared according to IACUC approved
protocols (IACUC-01161)711621 and
(IACUC-01177)832146.
Cell line (Mus musculus) Kdm1afl/fl MEFs This paper MEFs from homozygous
Kdm1afl/fl mutant mice
Primary cells; prepared according to IACUC
approved protocols (IACUC-01161)
711621 and (IACUC-01177)832146.
Cell line (Mus musculus) L3mbtl3tm1a(EUCOMM)Hmgu
(L3mbtl3fl/fl)
This paper MEFs from homozygous
(L3mbtl3fl/fl) mice
Primary cells; prepared according to IACUC
approved protocols (IACUC-01161)
711621 and (IACUC-01177)832146.
Cell line (Mus musculus) Kdm1afl/fl/ L3mbtl3fl/fl/ actin-Cre-ER This paper Kdm1afl/fl/ L3mbtl3fl/fl/ actin-Cre-ER Primary cells; prepared according to IACUC
approved protocols (IACUC-01161)
711621 and (IACUC-01177)832146.
Transfected construct (human) Kdm1a siRNA #1 Synthesized from Horizon Discovery Guo et al., 2022 transfected construct (human)
Transfected construct (human) Kdm1a siRNA #2 Synthesized from Horizon Discovery Guo et al., 2022 transfected construct (human)
Transfected construct (human) Kdm1a-3’UTR siRNA Synthesized from Horizon Discovery Guo et al., 2022 transfected construct (human)
Transfected construct (human) Dcaf5-1 siRNA #1 Synthesized from Horizon Discovery Guo et al., 2022 transfected construct (human)
Transfected construct (human) Dcaf5-2 siRNA #1 Synthesized from Horizon Discovery Guo et al., 2022 transfected construct (human)
Transfected construct (human) L3mbtl3-1 siRNA #1 Synthesized from Horizon Discovery Guo et al., 2022 transfected construct (human)
Transfected construct (human) L3mbtl3-2 siRNA #1 Synthesized from Horizon Discovery Guo et al., 2022 transfected construct (human)
Transfected construct (human) Set7-1 siRNA #1 Synthesized from Horizon Discovery Guo et al., 2022 transfected construct (human)
Transfected construct (human) Set7-2 SMART pool Synthesized from Horizon Discovery Guo et al., 2022 transfected construct (human)
Antibody Anti-KDM1A antibody Fortis Life Sciences A300-215A IF(1:1000), WB (1:1000)
Antibody anti-L3MBTL3 antibody Fortis Life Sciences A302-852 IF(1:1000), WB (1:1000)
Antibody anti-SUZ12 antibody Fortis Life Sciences A302-407A IF(1:1000), WB (1:1000)
Antibody anti-SET7 antibody Fortis Life Sciences A301-747A IF(1:1000), WB (1:1000)
Antibody Anti-EED antibody Abcam ab236292 IF(1:1000), WB (1:1000)
Antibody Anti-Phospho-EZH2 (S21) Affinity Biosciences AF3822 IF(1:1000), WB (1:1000)
Antibody Anti-K20me antibody This paper Affinity purified Anti-K20me antibody IF(1:1000), WB (1:1000)
Antibody anti-GFI1B antibody Cell Signaling Technology 5849 IF(1:1000), WB (1:1000)
Antibody Anti-EZH2 antibody Cell Signaling Technology 5246 IF(1:1000), WB (1:1000)
Antibody anti-H3K27me3 antibody Cell Signaling Technology 9733 IF(1:1000), WB (1:1000)
Antibody Anti-Actin antibody Santa Cruz Biotechnologies Sc-1616 WB (1:5000)
Antibody Anti-FLAG M2 antibody Sigma F1804 WB (1:5000)
Antibody ant-HA antibody Sigma 11867423001 WB (1:5000)
Antibody anti-GFP antibody Sigma 11814460001 WB (1:5000)
Antibody Anti-GAPDH Proteintech 60004–1-Ig WB (1:5000)
Antibody Rabbit anti-L3MBTL3 This paper Guo et al., 2022 IP(1:1000), WB (1:1000)
Antibody Anti-DCAF5 antibody This paper Guo et al., 2022 IP(1:1000), WB (1:1000)
Commercial assay or kit Lipofectamine 2000
Transfection Reagent
Thermo Fisher Scientific 11668019
Commercial assay or kit Oligofectamine Regent Thermo Fisher Scientific 2399123
Commercial assay or kit DharmaFECT 1
Transfection Reagent
Horizon Discovery T-2001–03
Commercial assay or kit TRIzol reagent Life Technologies 423707
Commercial assay or kit SuperScript III First-Strand
Synthesis System for RT-PCR
Life Technologies 2490151
Commercial assay or kit E.Z.N.A TISSUE DNA Kit Omega d3396-02
Commercial assay or kit Sulfolinkcoupled-resins ThermoFisher Scientific XC339981
Recombinant DNA reagent pMSCV--Puro vector Clontech 634401
Recombinant DNA reagent pEGFP-C1 Clontech 6084–1
Recombinant DNA reagent pCDNA3.1-puro vector Invitrogen Size: 5446 NT
Recombinant DNA reagent pKH3-vector Addgene 12555