Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | EZH2 | RefSeq | 2146, NM_001203247.2 | DNA sequencing authentication. |
| Strain (Mus musculus) | Kdm1afl/+conditional mutant strain |
Jackson Laboratory | B6.129-Kdm1a tm1.1Sho/J; Strain #: 023969 |
Kerenyi et al., 2013 |
| Strain (Mus musculus) | Transgenic actin-Cre-ER strain | Jackson Laboratory | CAGGCre-ER, B6.Cg-Tg(CAG-cre/Esr1*) 5Amc/J; Strain #: 004682 |
Hayashi and McMahon, 2002 |
| Strain (Mus musculus) | Transgenic Vav-iCre transgenic mice |
Jackson Laboratory | B6.Cg-Commd10Tg(Vav1-icre)A2Kio/J; Strain #:008610 |
de Boer et al., 2003 |
| Strain (Mus musculus) | transgenic Sox2-Cre strain | Jackson Laboratory | B6.Cg-Edil3Tg(Sox2-cre)1Amc/J; Strain #: 008454 |
Hayashi et al., 2002 |
| Strain (Mus musculus) | L3mbt3+/-mutant strain | Leng et al., 2018, | Mbt-1+/-, B6;129-L3mbtl3tm1Tmiy | Arai and Miyazaki, 2005 |
| Strain (Mus musculus) | Dcaf5+/-mutant strain | This paper | Centre for Phenogenomics (Toronto, Canada) |
produced with gRNA1: CTAGTTAGGTACAATAGGGC
and gRNA2: TATTCCTCTGCGACCACTCA. |
| Strain (Mus musculus) | L3mbtl3fl/+ mutant strain | European Mouse Mutant Cell Repository (EuMMCR) |
L3mbtl3tm1a(EUCOMM) Hmgu mice |
Produced with the FLPo-10 mouse strain. |
| Strain (Mus musculus) | FLPo-10 mouse strain | Jackson Laboratory | B6.Cg-Tg(Pgk1-flpo)10Sykr/J; Strain #: 011065 |
Wu et al., 2009 |
| Cell line (Homo sapiens) | 293T | ATCC | CRL-3216 | Authenticated by high levels of CDK inhibitor CDKN2A and p53 |
| Cell line (Homo sapiens) | HCT116 | ATCC | CCL-247 | Authenticated by expression of wild- type p53 and induction of CDKN1A by UV irradiation |
| Cell line (Homo sapiens) | G401 | CRL-1441 | ATCC | Authenticated by lack of expression of SMARCB1 |
| Cell line (Homo sapiens) | T47D | ATCC | HTB-133 | Authenticated by lack of ARID1A expression |
| Cell line (Homo sapiens) | HeLa | ATCC | CRM-CCL-2 | Authenticated by high levels of CDK inhibitor CDKN2A and p53 |
| Cell line (Homo sapiens) | PA-1 | ATCC | CRL-1572 | Authenticated by expression of SOX2 and OCT4 |
| Cell line (Homo sapiens) | H1299 (NCI-H1299) | ATCC | CRL-5803 | Authenticated by lack of p53 |
| Cell line (Homo sapiens) | H520 (NCI-H520) | ATCC | HTB-182 | Authenticated by high expression of SOX2 |
| Cell line (Mus musculus) | Mouse embryonic fibroblasts (MEFs) |
This paper | Primary embryonic fibroblasts from isolated mouse embryos |
Primary cells; prepared according to IACUC approved protocols (IACUC-01161) 711621 and (IACUC-01177)832146. |
| Cell line (Mus musculus) | Mouse embryonic fibroblasts (MEFs) from K20R mutant mice |
This paper | Mouse embryonic fibroblasts (MEFs) from homozygous Ezh2K20R/K20R mutant mice |
Primary cells; prepared according to IACUC approved protocols (IACUC-01161) 711621 and (IACUC-01177)832146. |
| Cell line (Mus musculus) | L3mbtl3-knockout MEFs | This paper | MEFs from homozygous L3mbtl3 KO mutant mice |
Primary cells; prepared according to IACUC approved protocols (IACUC-01161)711621 and (IACUC-01177)832146. |
| Cell line (Mus musculus) | Kdm1afl/fl MEFs | This paper | MEFs from homozygous Kdm1afl/fl mutant mice |
Primary cells; prepared according to IACUC approved protocols (IACUC-01161) 711621 and (IACUC-01177)832146. |
| Cell line (Mus musculus) | L3mbtl3tm1a(EUCOMM)Hmgu
(L3mbtl3fl/fl) |
This paper | MEFs from homozygous (L3mbtl3fl/fl) mice |
Primary cells; prepared according to IACUC approved protocols (IACUC-01161) 711621 and (IACUC-01177)832146. |
| Cell line (Mus musculus) | Kdm1afl/fl/ L3mbtl3fl/fl/ actin-Cre-ER | This paper | Kdm1afl/fl/ L3mbtl3fl/fl/ actin-Cre-ER | Primary cells; prepared according to IACUC approved protocols (IACUC-01161) 711621 and (IACUC-01177)832146. |
| Transfected construct (human) | Kdm1a siRNA #1 | Synthesized from Horizon Discovery | Guo et al., 2022 | transfected construct (human) |
| Transfected construct (human) | Kdm1a siRNA #2 | Synthesized from Horizon Discovery | Guo et al., 2022 | transfected construct (human) |
| Transfected construct (human) | Kdm1a-3’UTR siRNA | Synthesized from Horizon Discovery | Guo et al., 2022 | transfected construct (human) |
| Transfected construct (human) | Dcaf5-1 siRNA #1 | Synthesized from Horizon Discovery | Guo et al., 2022 | transfected construct (human) |
| Transfected construct (human) | Dcaf5-2 siRNA #1 | Synthesized from Horizon Discovery | Guo et al., 2022 | transfected construct (human) |
| Transfected construct (human) | L3mbtl3-1 siRNA #1 | Synthesized from Horizon Discovery | Guo et al., 2022 | transfected construct (human) |
| Transfected construct (human) | L3mbtl3-2 siRNA #1 | Synthesized from Horizon Discovery | Guo et al., 2022 | transfected construct (human) |
| Transfected construct (human) | Set7-1 siRNA #1 | Synthesized from Horizon Discovery | Guo et al., 2022 | transfected construct (human) |
| Transfected construct (human) | Set7-2 SMART pool | Synthesized from Horizon Discovery | Guo et al., 2022 | transfected construct (human) |
| Antibody | Anti-KDM1A antibody | Fortis Life Sciences | A300-215A | IF(1:1000), WB (1:1000) |
| Antibody | anti-L3MBTL3 antibody | Fortis Life Sciences | A302-852 | IF(1:1000), WB (1:1000) |
| Antibody | anti-SUZ12 antibody | Fortis Life Sciences | A302-407A | IF(1:1000), WB (1:1000) |
| Antibody | anti-SET7 antibody | Fortis Life Sciences | A301-747A | IF(1:1000), WB (1:1000) |
| Antibody | Anti-EED antibody | Abcam | ab236292 | IF(1:1000), WB (1:1000) |
| Antibody | Anti-Phospho-EZH2 (S21) | Affinity Biosciences | AF3822 | IF(1:1000), WB (1:1000) |
| Antibody | Anti-K20me antibody | This paper | Affinity purified Anti-K20me antibody | IF(1:1000), WB (1:1000) |
| Antibody | anti-GFI1B antibody | Cell Signaling Technology | 5849 | IF(1:1000), WB (1:1000) |
| Antibody | Anti-EZH2 antibody | Cell Signaling Technology | 5246 | IF(1:1000), WB (1:1000) |
| Antibody | anti-H3K27me3 antibody | Cell Signaling Technology | 9733 | IF(1:1000), WB (1:1000) |
| Antibody | Anti-Actin antibody | Santa Cruz Biotechnologies | Sc-1616 | WB (1:5000) |
| Antibody | Anti-FLAG M2 antibody | Sigma | F1804 | WB (1:5000) |
| Antibody | ant-HA antibody | Sigma | 11867423001 | WB (1:5000) |
| Antibody | anti-GFP antibody | Sigma | 11814460001 | WB (1:5000) |
| Antibody | Anti-GAPDH | Proteintech | 60004–1-Ig | WB (1:5000) |
| Antibody | Rabbit anti-L3MBTL3 | This paper | Guo et al., 2022 | IP(1:1000), WB (1:1000) |
| Antibody | Anti-DCAF5 antibody | This paper | Guo et al., 2022 | IP(1:1000), WB (1:1000) |
| Commercial assay or kit | Lipofectamine 2000 Transfection Reagent |
Thermo Fisher Scientific | 11668019 | |
| Commercial assay or kit | Oligofectamine Regent | Thermo Fisher Scientific | 2399123 | |
| Commercial assay or kit | DharmaFECT 1 Transfection Reagent |
Horizon Discovery | T-2001–03 | |
| Commercial assay or kit | TRIzol reagent | Life Technologies | 423707 | |
| Commercial assay or kit | SuperScript III First-Strand Synthesis System for RT-PCR |
Life Technologies | 2490151 | |
| Commercial assay or kit | E.Z.N.A TISSUE DNA Kit | Omega | d3396-02 | |
| Commercial assay or kit | Sulfolinkcoupled-resins | ThermoFisher Scientific | XC339981 | |
| Recombinant DNA reagent | pMSCV--Puro vector | Clontech | 634401 | |
| Recombinant DNA reagent | pEGFP-C1 | Clontech | 6084–1 | |
| Recombinant DNA reagent | pCDNA3.1-puro vector | Invitrogen | Size: 5446 NT | |
| Recombinant DNA reagent | pKH3-vector | Addgene | 12555 |