Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Forward and Reverse primers of CYP1A2 and ADSL genes
| Gene | Sequence (5′- > 3′) | Length | Tm | GC% | Self complementarity | Self 3′ complementarity | Product length | |
|---|---|---|---|---|---|---|---|---|
| CYP1A2 | F | GCCTCGACCTCTCTCTCAAAGT | 20 | 59.11 | 55.00 | 4.00 | 1.00 | 140 |
| R | GCAGGCTAGGGGGAAATGT | 19 | 59.38 | 57.89 | 4.00 | 2.00 | ||
| ADSL | F | GCCTGTAGTTTCAGGGAATTGAT | 23 | 5873 | 43.48 | 6.00 | 2.00 | 325 |
| R | CATTCCAGTCCTGTCACTAACT | 22 | 57.46 | 45.45 | 4.00 | 1.00 |
