Antibodies |
|
PE mouse anti-human CD31 (1:500) |
BD Biosciences |
555446 |
FITC mouse anti-human CD34 (1:500) |
BD Biosciences |
555821 |
APC mouse anti-human CD45 (1:500) |
BD Biosciences |
555485 |
APC mouse anti-human CD43 (1:500) |
BD Biosciences |
560198 |
7-Amino-actinomycin D (7-AAD) (1:500) |
BD Biosciences |
559925 |
APC anti-mouse/human CD11b antibody (1:500) |
BioLegend |
101212 |
APC anti-human CD14 antibody (1:500) |
BioLegend |
325608 |
FITC anti-human CD40 antibody (1:500) |
BioLegend |
334306 |
APC anti-human CD80 antibody (1:500) |
BioLegend |
305220 |
PE anti-human CD163 antibody (1:500) |
BioLegend |
333606 |
APC anti-human CD206 (MMR) antibody (1:500) |
BioLegend |
321110 |
|
Chemicals, peptides, and recombinant proteins |
|
Vitronectin XF |
STEMCELL Technologies |
07180 |
Cell Adhere dilution buffer |
STEMCELL Technologies |
07183 |
TeSR-E8 |
STEMCELL Technologies |
05990 |
STEMdiff APEL 2 medium |
STEMCELL Technologies |
28995 |
KnockOut DMEM |
Gibco |
10829018 |
RPMI 1640 medium |
Gibco |
22400089 |
Fetal bovine serum (FBS) |
HyClone |
SH30071 |
Y-27632 dihydrochloride |
Tocris |
1254 |
100X Insulin-Transferrin-Selenium-X (ITS-X) supplement |
Gibco |
51500056 |
Recombinant human BMP4 protein |
R&D |
314-BP |
Recombinant human VEGF 165 protein |
R&D |
293-VE |
Recombinant human SCF protein |
R&D |
255-SC |
Recombinant human Thrombopoietin (NS0-expressed) protein |
R&D |
288-TPN |
Recombinant human IL-3 protein |
R&D |
203-IL |
Recombinant human IL-6 protein |
R&D |
206-IL |
Recombinant human Flt-3 ligand/FLT3L protein |
R&D |
308-FK |
Recombinant human M-CSF |
PeproTech |
300-25 |
Lipopolysaccharides |
Sigma |
L2630 |
Human IFN-γ |
Miltenyi Biotec |
130-096-872 |
Human IL-4 |
Miltenyi Biotec |
130-095-373 |
Human IL-13 |
Miltenyi Biotec |
130-112-409 |
Latex beads, carboxylate-modified polystyrene, fluorescent yellow-green |
Sigma-Aldrich |
L4530-1ML |
|
Experimental models: Cell lines |
|
CMC hiPSC lines |
Korea National Stem Cell Bank |
CMC-003/009/011 |
iPS-NT4-S1 hiPSC lines |
CHA University |
N/A |
|
Oligonucleotides |
|
Primer: GAPDH forward |
Bioneer |
TGCACCACCAACTGCTTAGC |
Primer: GAPDH reverse |
Bioneer |
GGCATGGACTGTGGTCATGAG |
Primer: T forward |
Bioneer |
ATGAGCCTCGAATCCACATAGT- |
Primer: T reverse |
Bioneer |
TCCTCGTTCTGATAAGCAGTCA |
Primer: MIXL1 forward |
Bioneer |
GGATCCAGGTATGGTTCCAG |
Primer: MIXL1 reverse |
Bioneer |
GGAGCACAGTGGTTGAGGAT |
|
Software and algorithms |
|
GraphPad Prism 10.0 |
GraphPad Software |
https://www.graphpad.com/ |
FlowJo software |
Tree Star |
https://www.flowjo.com/ |
|
Other |
|
35 mm cell culture dish |
SPL |
11035 |
6-well clear multiple well plates |
Corning |
3516 |
70 μm cell strainer |
SPL |
93070 |
Dissection microscope |
Olympus |
CKX53 |