Skip to main content
. Author manuscript; available in PMC: 2024 Mar 6.
Published in final edited form as: Mol Cell. 2023 May 9;83(10):1623–1639.e8. doi: 10.1016/j.molcel.2023.04.014

KEY RESOURCES TABLE.

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
MPP8 – Rabbit polyclonal Proteintech Cat# 16796-1; RRID: AB_2266644
GFP – Rabbit polyclonal Thermo Fisher Scientific Cat# A11122; RRID: AB_221569
H3K9me3 – Rabbit polyclonal Abcam Cat# Ab8898; RRID: AB_306848
WDR82 – Rabbit monoclonal Cell Signaling Technology Cat# 99715; RRID: AB_2800319
H3K4me3 – Rabbit polyclonal Abcam Cat# ab8580; RRID: AB_306649
HRP conjugated mouse monoclonal anti-HSP90 Cell Signaling Technology Cat# 79641S; RRID: AB_2799937
HA – Rabbit polyclonal Abcam Cat# ab9110; RRID: AB_307019
LINE-1 ORF1p-Rabbit monoclonal Abcam Cat# ab216324; RRID: AB_2921327
Bacterial and virus strains
10-beta Competent E. coli (high efficiency) NEB C3019H
5-alpha Competent E. coli NEB C2987H
Chemicals, peptides, and recombinant proteins
MEK inhibitor PD0325901 Selleck Chemicals Cat# S1036
GSK3b inhibitor CHIR99021 Selleck Chemicals Cat# S2924
polyL-ornithine Sigma-Aldrich Cat# P4638-100MG
Laminin Life Technologies Cat# 23017015
Fibronectin ThermoFisher Cat# FC01010MG
Indole-3-acetic acid sodium salt (auxin analog) Sigma-Aldrich Cat# 5148-2G
cOmplete, EDTA-free Protease Inhibitor Cocktail Millipore Sigma 11873580001
PhosSTOP Millipore Sigma 4906845001
SUPERaseIn ThermoFisher AM2694
Critical commercial assays
Lipofectamine2000 ThermoFisher Cat#11668019
NEBNext Ultra II DNA Library Prep Kit for Illumina New England BioLabs Cat# E7645S
TRIzol Reagent Invitrogen Cat# 15596018
NEBNext Multiplex Oligos for Illumina kit New England BioLabs Cat# E7335S
AMPure XP Beckman Coulter Cat# A63881
Dynabeads Protein G for Immunoprecipitation Invitrogen Cat# 10004D
Qubit dsDNA HS Assay Kit Invitrogen Cat# Q32854
Ovation RNA-seq FFPE Nugen discontinued
Unicersal Plus Total RNA-seq library preparation kit with NuQuant, mouse any-deplete Tecan Cat# 9157-24
RNeasy Plus Mini Qiagen Cat# 74134
DNA Clean & Concentrator-5 Zymo Cat# D4014
HyperSep C18 Plates ThermoFisher 60300-425
Deposited data
ChIP-seq, RNA-seq, and PRO-seq This paper GEO: GSE208753
Western blot raw images This paper Mendeley DOI: 0.17632/v5y87syfcc.1
Experimental models: Cell lines
R1 mESC WT This paper N/A
R1 mESC TASOR-AGH TIRI mCherry This paper N/A
R1 mESC TASOR-AGH TIR1-mCherry KO T1 This paper N/A
R1 mESC TASOR-AGH TIR1 mCherry WDR82 KO T5 This paper N/A
R1 mESC Sox2-1kb 1311 TRE Cas9 Blast This paper N/A
R1 mESC Sox2-1kb MPP8 KO M1 TRE Cas9 Blast This paper N/A
R1 mESC Sox2-1kb MPP8 KO M16 TRE Cas9 Blast This paper N/A
R1 mESC Sox2-100kb BG4 This paper N/A
R1 mESC MPP8-AID-HA TIR1-mCherry This paper N/A
R1 mESC Sox2-1kb This paper N/A
R1 mESC CPSF3-AGH TIR1-mCherry This paper N/A
R1 mESC WDR82 KO W4 This paper N/A
R1 mESC WDR82 KO W8 This paper N/A
R1 mESC MPP8-AGH This paper N/A
R1 mESC Sox2-1kb DICER1 KO Clone 22 This paper N/A
R1 mESC Sox2-1kb DICER1 KO Clone 23 This paper N/A
Oligonucleotides
Sox2 C-term endogenous tagging sgRNA: TGCCCCTGTCGCACATGTGA This paper N/A
Sox2-1kb deletion upstream sgRNA: GGCCGAATGATTAATAACG This paper N/A
Sox2-1kb deletion downstream sgRNA: AGCAGCTGAGCATCAAAGGG This paper N/A
Primers and sgRNA sequences, see Table S4 This paper N/A
Recombinant DNA
Super piggyBac Transposase expression vector System Biosciences (SBI) Cat# PB210PA-1
pGEM-T Promega Cat# A1360
Plasmid: pAS_pb_Ef1a-TIR1_Ubc-mCherry-Puro This paper Addgene Cat# 195567
Plasmid: pAS458-U6_CBA-mCherry This paper Addgene Cat# 195566
Plasmid: pbTRE3G-SpCas9-IRES-Blast This paper Addgene Cat# 195506
Plasmid: px458-mCherry Gu et al.56 Addgene Cat# 161974
Plasmid library: Mouse CRISPR Deletion Morgens et al.57 Addgene Cat# 1000000121
Library - Apoptosis and cancer
Software and algorithms
bedtools V2.25.0 Quinlan and Hall58 N/A
IGV Thorvaldsdóttir et al.59 N/A
MACS3 Zhang et al.60 N/A
STAR Dobin et al.61 N/A
MaxQuant Cox and Mann62 N/A
CasTLE Morgens et al.63 N/A
Bowtie 2 Langmead and Salzberg64 N/A
DESeq2 Michael Love65 N/A
Other
NextSeq 500 Illumina N/A
NovaSeq 6000 Illumina
LightCycler 480 Roche N/A
Bioanalyzer Agilent N/A
Amaxa 4D nucleofector Lonza N/A
Covaris sonicator E220 Covaris N/A
LSRII Flow Cytometer BD N/A
FACSARIA II Flow Cytometer BD N/A