Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Guide RNA sequences for knock-out of Dicer-2 in Hi5 cells.
| Start position | Strand | Sequence | GC % | Target domain |
|---|---|---|---|---|
| 1923 | + | GCCCATCGCTTGCCCTATTAAGG | 55.00 | dsRNA-binding |
| 2044 | – | CCCTTGACGATGCTGCCAATGCG | 55.00 | dsRNA-binding |
| 2647 | – | CCGCCGTATGAGGACAGGATTAA | 45.00 | PAZ |
| 2773 | – | CCTCAGTCTCATTTCGATTCAGA | 40.00 | PAZ |
