Skip to main content
BMC Veterinary Research logoLink to BMC Veterinary Research
. 2024 Mar 11;20:100. doi: 10.1186/s12917-024-03951-x

CheV enhances the virulence of Salmonella Enteritidis, and the Chev-deleted Salmonella vaccine provides immunity in mice

Lu Zhang 1, Tonglei Wu 1,, Fengjie Wang 1, Wan Liu 1, Guixin Zhao 1, Yanying Zhang 1, Zhiqiang Zhang 1, Qiumei Shi 1,
PMCID: PMC10926574  PMID: 38468314

Abstract

Background

Salmonella enteritidis (SE) is a major zoonotic pathogen and causes infections in a variety of hosts. The development of novel vaccines for SE is necessary to eradicate this pathogen. Genetically engineered attenuated live vaccines are more immunogenic and safer. Thus, to develop a live attenuated Salmonella vaccine, we constructed a cheV gene deletion strain of SE (named ΔcheV) and investigated the role of cheV in the virulence of SE. First, the ability to resist environmental stress in vitro, biofilm formation capacity, drug resistance and motility of ΔcheV were analyzed. Secondly, the bacterial adhesion, invasion, intracellular survival assays were performed by cell model. Using a mouse infection model, an in vivo virulence assessment was conducted. To further evaluate the mechanisms implicated by the reduced virulence, qPCR analysis was utilized to examine the expression of the strain’s major virulence genes. Finally, the immune protection rate of ΔcheV was evaluated using a mouse model.

Results

Compared to C50336, the ΔcheV had significantly reduced survival ability under acidic, alkaline and thermal stress conditions, but there was no significant difference in survival under oxidative stress conditions. There was also no significant change in biofilm formation ability, drug resistance and motility. It was found that the adhesion ability of ΔcheV to Caco-2 cells remained unchanged, but the invasion ability and survival rate in RAW264.7 cells were significantly reduced. The challenge assay results showed that the LD50 values of C50336 and ΔcheV were 6.3 × 105 CFU and 1.25 × 107 CFU, respectively. After the deletion of the cheV gene, the expression levels of fimD, flgG, csgA, csgD, hflK, lrp, sipA, sipB, pipB, invH, mgtC, sodC, rfbH, xthA and mrr1 genes were significantly reduced. The live attenuated ΔcheV provided 100% protection in mice against SE infection.

Conclusion

All the results confirmed that the deletion of the cheV gene reduces the virulence of SE and provides significant immune protection in mice, indicating that ΔcheV could be potential candidates to be explored as live-attenuated vaccines.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-024-03951-x.

Keywords: Salmonella enteritidis, cheV, Gene deletion, Virulence, Vaccine

Background

Salmonella Enteritidis (SE) ranks as a major zoonotic pathogen, prevalent in both livestock, poultry wildlife and humans. It leads to considerable economic losses in animal agriculture and is responsible for numerous human fatalities. This pathogen poses a severe threat to both economic progress and public health [1]. SE infection in humans is mainly transmitted through the environment, animal carriers, and water. Poultry and livestock, as food-producing animals, are considered the primary sources of human SE infections [2].

For many years, using antibiotics was the primary method for controlling Salmonella infection. However, the development of multiple antibiotic resistance mechanisms in bacteria has led to a reevaluation of antibiotic use. Currently, vaccination is considered the most effective and cost-efficient method to reduce or control Salmonella infection [3]. Salmonella vaccines commercially available are typically classified into three main types: live attenuated vaccines, inactivated vaccines, and subunit vaccines. The immunological effects of these vaccines vary significantly, as established by numerous studies. While inactivated vaccines are known for their safety and ability to elicit high antibody levels, they often fall short in providing adequate immune protection. This shortfall is attributed to their lack of ability to induce robust cell-mediated immunity, which is essential for the eradication of intracellular pathogens like Salmonella [4, 5]. On the other hand, subunit vaccines are also safe but usually necessitate multiple doses to extend the duration of immunity, and require suitable adjuvants to elicit a potent cellular immune response. Genetically the live attenuated vaccines, created by knocking out virulence genes, can induce strong cell-mediated immunity, because the vaccine strain can invade the host and present nearly all antigenic components of the bacteria [68]. Identifying virulence genes is key to developing gene deletion live vaccines, and many researchers have already developed a variety of vaccines using this method, including for Brucella, Salmonella Typhimurium, Yersinia pestis, Vibrio anguillarum, and Edwardsiella tarda [913].

SE spreads through the fecal-oral route and, to successfully colonize the host, must overcome the acidic stress of the gastrointestinal tract, adhere to the intestinal mucosa, and disrupt epithelial cells. It can also penetrate beneath the mucosa to be phagocytosed by macrophages. As an intracellular parasite, SE has evolved remarkable capabilities to resist intracellular bactericidal components. It then spreads throughout the body via the bloodstream or lymphatic system, carried by macrophages, leading to systemic infection [14]. The chemotaxis allows Salmonella to perceive changes in the external environment within host tissues, such as pH, osmotic pressure and temperature, and evade host immune pressure, overcome colonization resistance and resist antimicrobial treatment by regulating the expression of specific genes, thus surviving and colonizing within the host. Additionally, the chemotaxis also controls drug resistance, biofilm formation and virulence [1518]. Researches indicate that CheV is a crucial chemotactic protein closely associated with various pathogenic processes. These include the adhesion and chemotaxis in Vibrio cholerae, chemotaxis in Bacillus subtilis, biofilm formation and motility in Campylobacter jejuni and Vibrio anguillarum, the adhesion, chemotaxis, and motility of Vibrio harveyi, as well as the colonization and infection processes in Helicobacter pylori [1922]. Genomic analysis has revealed that Salmonella Enteritidis (SE) carries the cheV gene. Researchers using differential proteomics analysis on Salmonella Typhimurium found that CheV expression decreases after infecting epithelial cells, suggesting that this gene may influence the virulence of SE through multiple mechanisms [23].

Based on these studies, we hypothesize that the cheV gene plays an important role in SE’s biofilm formation, adhesion, invasion ability and virulence. To test this hypothesis, we constructed a cheV gene deletion strain using homologous recombination technology and analyzed the impact of the cheV gene on the virulence of SE through in vitro stress simulation tests, detection of biofilm formation ability, drug resistance, motility, adhesion, invasion, intracellular survival assays, LD50 determination and virulence gene expression analysis. Additionally, to demonstrate the feasibility of using the cheV gene deletion strain as a vaccine against Salmonella, we evaluated the immune protection rate of ΔcheV using a mouse model. These study results provide an important theoretical basis for understanding the impact of the cheV gene on SE’s virulence.

Methods

Bacterial strains, cells and plasmids

Bacterial strains and plasmids used in this study are listed in Table 1. Salmonella enteritidis C50336 was maintained in the Key Laboratory of Preventive Veterinary Medicine, Hebei Province. The bacteria are grown in Luria-Bertani (LB) broth (Haibo Biotechnology Co., Ltd., China) at 37 °C, unless otherwise specified. The Caco-2 BBE cells and RAW264.7 cells used in this study were provided by BeNa Culture Collection (Shanghai, China). Both types of cells are cultured in DMEM (Thermo Fisher Scientific Co., Ltd., China) containing 10% fetal bovine serum (Thermo Fisher Scientific Co., Ltd., China), add antibiotics when necessary, such as 50 µg/mL streptomycin and 50 U/mL penicillin, or 50 µg/mL gentamicin, in an incubator with 5% CO2.

Table 1.

Bacterial strains and plasmids used in this study

Strains Relevant characteristics Sources
C50336 Wild-type S. enteritidis This study
ΔcheV::cat a first recombination strain This study
ΔcheV a second recombination strain This study
ΔcheV + cheV ΔcheV-complemented strain This study
Plasmids Characteristics Sources
pKD3 FRT-Cm-FRT cassette (CbR CmR) invitrigen
pKD46 Apr, containing the Red recombinase of λ phage invitrigen
pCP20 FLP recombinase, temperature sensitive replication (AMR) invitrigen

Experimental animals

Kunming mice were purchased from Beijing Speifu Biotechnology Co., Ltd. (Beijing, China). Female Kunming mice aged 4–6 weeks were used for LD50 testing, and female Kunming mice aged 6–8 weeks were used for immune protection testing.

Construction of the cheV gene deletion strain

The cheV gene deletion strain was constructed using the λ-Red recombination technique [24]. The C50336 strain carrying the pKD46 plasmid was cultured in LBA containing 225 mg/mL L-arabinose at 30 °C until its OD600 nm reached 0.6–0.8. It was then washed 3 times with pre-cooled autoclaved ultrapure water and 10% glycerol to prepare competent cells. Next, using the pKD3 plasmid as a template, specific primers P1, P2 (Table 2) were used to amplify homologous fragments. The purified fragments were electroporated into C50336 (pKD46) competent cells, followed by the addition of 1 mL of LB liquid medium and incubation at 30 °C for 2 h. The culture was then spread on LB agar containing 50 µg/mL chloramphenicol (Cm). Colonies that grew were identified using specific primers P3, P4 (Table 2). Positive strains, after removal of the pKD46 plasmid at 42 °C, were named ΔcheV::cat. To remove the Cm segment, the pCP20 plasmid was electroporated into ΔcheV::cat, following the same process, and mutants were identified using specific primers P3, P4. The positive strains, after removal of the pCP20 plasmid at 42 °C, were named ΔcheV.

Table 2.

Primers used for constructing the mutant and the complemented strain

Primer Sequence (5’ − 3’)
P1: TGGGCATGGTCAATATTCGGGATCAGGTCATTCCGGTGATTGATTTGCCAGCGGTAGCGTGTGTAGGCTGGAGCTGCTTCG
P2: TCATTGGCGCTGCCGGAAAGCGAGGAGTGGATAACGACCGGGATCTTTTTCAGCCGTTCCATATGAATATCCTCCTTAG
P3: TGAACTGCTGTTATTCCGTCTTGG
P4: ATCAGTGGTCCCTGGCTGTTTG
P5: GTTAGGATGGACAATTTTCAGAAAGATA
P6: TCAGGCGCTTTTGCGGCTGATCAGTGGT

To generate the ΔcheV-complemented strain, polymerase chain reaction (PCR) was performed with the primers P5, P6 (Table 2) to amplify the cheV open reading frame. The purified PCR product was then chemically transformed into PMD-19T vector. The PMD-19T-cheV was electroporated into ΔcheV and P5, P6 was used to confirm the complemented strain. The positive strains were named ΔcheV + cheV.

In vitro stress simulation assay

The bacterial culture during the logarithmic phase was washed 3 times with sterilized saline, and then serially diluted for counting, to determine the original bacterial count. The culture was incubated separately in strong acid solution (pH 3.5), strong alkaline solution (pH 10), at 42 °C for 1 h and in an oxidative stress solution (10 mmol/L H2O2) for 10 min. The bacteria were counted again after these stress treatments to determine the post-stress bacterial count. The survival rate was calculated as the post-stress bacterial count divided by the original bacterial count.

Detection of biofilm formation

Referring to previous research methods, the ability to form biofilms was assessed using the crystal violet (CV) staining method [25]. C50336, ΔcheV and ΔcheV + cheV were inoculated into 6 mL of LB liquid medium (ΔcheV + cheV was in LBA) and incubated statically at 28 °C for 3 days. The biofilms were washed with PBS, fixed in absolute methanol for 15 min, and stained with 2% CV for 15 min to observe the thickness and staining of the bacterial ring. The quantitative detection method is as follows: 150 µL of bacterial suspension was added to each well of a 96-well plate, stained as above, and finally, 200 µL of absolute ethanol was added to each well to dissolve the CV. The absorbance was measured at 570 nm, and the assay was repeated 3 times.

We also studied the effect of the cheV gene on the main components of biofilms: curli and cellulose formation. Referring to previous methods [26], 5 µL of overnight-cultured bacterial suspension was inoculated onto LB agar containing 160 mg/L Congo red and 10 mg/L Coomassie brilliant blue without salt, incubated at 28 °C for 2 days, and the colony morphology and color were observed to assess the production of curli. Similarly, 5 µL of overnight-cultured bacterial suspension was inoculated onto LB agar without salt containing Calcofluor White Stain (200 mg/L) and incubated at 28 °C for 2 days. The production of cellulose was evaluated by observing the fluorescence intensity under ultraviolet (UV) light (366 nm).

Detection of drug resistance

The sensitivity of ΔcheV to antibiotics was tested using the Kirby-Bauer (K-B) method. According to the standards of the United States National Committee for Clinical Laboratory Standards (NCCLS), 17 drugs were selected for testing. These drugs include: ampicillin, piperacillin, amoxicillin, cefazolin, cephalothin, cefoperazone, cefuroxime, ceftriaxone, gentamicin, amikacin, kanamycin, streptomycin, tetracycline, doxycycline, minocycline, ciprofloxacin and levofloxacin. Overnight-cultured bacterial suspension was evenly spread on LB agar plates. Commercial antibiotic susceptibility disks were placed on the inoculated plates using tweezers. The plates were then incubated at 37 °C for 12 h, and the diameters of the inhibition zones were measured. The results were interpreted according to the NCCLS antibiotic susceptibility testing standards.

Motility assay

Referring to previous methods [27, 28], 5 µL of overnight-cultured bacterial suspension was inoculated onto LB semi-solid agar plates (0.3% agar). The plates were then incubated at 37 °C for 5–6 h. The diameter of the swimming halo was measured, and the assay was repeated 3 times.

Adhesion, invasion and intracellular survival assays

As previously described [9, 25], Caco-2 cells were seeded at a density of 1 × 105 cells per well in a 12-well plate. C50336, ΔcheV and ΔcheV + cheV were resuspended in PBS for counting and added to the cells with a multiplicity of infection (MOI) of 100. The mixture was centrifuged at 1000 rpm for 5 min and then incubated in a 37 °C, 5% CO2 incubator for 1 h. The cells were lysed with 1% Triton X-100 for 8 min, and the lysates were serially diluted for counting. For the invasion assay, after infecting the cells as described above, the cells were further incubated in DMEM containing gentamicin (100 µg/mL) for 1 h to remove extracellular bacteria. The cells were then lysed with 1% Triton X-100 and counted. Adhesion rate = (number of adherent bacteria) / (number of infecting bacteria per well) × 100%; Invasion rate = (number of invaded bacteria) / (number of infecting bacteria per well) × 100%.

For the intracellular survival assay, as previously described [25, 28, 29], RAW264.7 cells were seeded at a density of 105 cells per well in 2–12 well plates. C50336, ΔcheV and ΔcheV + cheV infected the cells with an MOI of 100 and were incubated in a 37 °C, 5% CO2 incubator for 2 h. The cells were then washed twice with PBS to remove non-adherent/invasive bacteria. Subsequently, the cells were incubated in DMEM containing gentamicin (100 µg/mL) for 1 h to eliminate all remaining extracellular bacteria. The cells were lysed with 1% Triton X-100 and counted as the 3-h intracellular bacterial count. Cells in the other plate were incubated in DMEM containing 10 µg/mL gentamicin for 20 h, lysed with 1% Triton X-100, and counted as the 23-h intracellular bacterial count. Intracellular survival rate = (number of intracellular bacteria at 23 h) / (number of intracellular bacteria at 3 h) × 100%.

Determination of LD50 in mice

Referring to previous methods [9], 55 female Kunming mice, aged 4–6 weeks, were randomly divided into 11 groups (n = 5). The first five groups were intraperitoneally (i.p.) injected with C50336 at doses ranging from 2 × 107 to 2 × 103 CFU/mouse. The next five groups were i.p. injected with ΔcheV at doses ranging from 2.5 × 109 to 2.5 × 105 CFU/mouse. The remaining group was i.p. injected with an equal volume of PBS. The death of mice was observed and recorded over a period of 14 days. The LD50 value was calculated using the formula of log10 [50% endpoint] = A + (B × C), where A = log10 [infectious dose showing a mortality next below 50%], B = difference of logarithms = [50% – (mortality at infectious dose next below 50%)] / [(mortality next above 50%) – (mortality next below 50%)], and C = log10 [difference between serial infectious doses used in challenge studies] [30].

RNA extraction and quantitative real-time PCR (qPCR)

To further investigate the role of the cheV gene in the virulence of SE, we employed qPCR technology to detect the expression levels of virulence genes. RNA was extracted using a bacterial RNA extraction kit (Beijing Aidlab Biotechnologies Co., Ltd., China), and DNA was removed through DNase I treatment. Then, RNA was reverse-transcribed into cDNA using a reverse transcription kit (Bohang Biotechnology Co., Ltd., China). Using this cDNA as a template and based on literature [31, 32], primers were designed (Table 3). qPCR detection was performed using the SYBR Green dye method.

Table 3.

Primers used for qPCR

Gene Sequence (5’ − 3’)
fimD-F CGCGGCGAAAGTTATTTCAA
fimD-R CCACGGACGCGGTATCC
flgG-F GCGCCGGACGATTGC
flgG-R CCGGGCTGGAAAGCATT
prot6E-F GAACGTTTGGCTGCCTATGG
prot6E-R CGCAGTGACTGGCATCAAGA
csgA-F AATGCCACCATCGACCAGTG
csgA-R CAAAACCAACCTGACGCACC
csgD-F GCCTCATATTAACGGCGTG
csgD-R AGCGGTAATTTCCTGAGTGC
bcsA-F GCCCAGCTTCAGAATATCCA
bcsA-R TGGAAGGGCAGAAAGTGAAT
ompR-F TGTGCCGGATCTTCTTCCA
ompR-R CTCCATCGACGTCCAGATCTC
hflK-F AGCGCGGCGTTGTGA
hflK-R TCAGACCTGGCTCTACCAGATG
tatA-F AGTATTTGGCAGTTGTTGATTGTTG
tatA-R ACCGATGGAACCGAGTTTTTT
lrp-F TTAATGCCGCCGTGCAA
lrp-R GCCGGAAACCAAATGACACT
sipA-F CAGGGAACGGTGTGGAGGTA
sipA-R AGACGTTTTTGGGTGTGATACGT
sipB-F GCCACTGCTGAATCTGATCCA
sipB-R CGAGGCGCTTGCTGATTT
pipB-F GCTCCTGTTAATGATTTCGCTAAAG
pipB-R GCTCAGACTTAACTGACACCAAACTAA
invH-F CCCTTCCTCCGTGAGCAAA
invH-R TGGCCAGTTGCTCTTTCTGA
mgtC-F CGAACCTCGCTTTCATCTTCTT
mgtC-R CCGCCGAGGGAGAAAAAC
sodC-F CACATGGATCATGAGCGCTTT
sodC-R CTGCGCCGCGTCTGA
orf245-F CAGGGTAATATCGATGTGGACTACA
orf245-R GCGGTATGTGGAAAACGAGTTT
rfbH-F ACGGTCGGTATTTGTCAACTCA
rfbH-R TCGCCAACCGTATTTTGCTAA
xthA-F CGCCCGTCCCCATCA
xthA-R CACATCGGGCTGGTGTTTT
mrr1-F CCATCGCTTCCAGCAACTG
mrr1-R TCTCTACCATGAACCCGTACAAATT

16 S rRNA-F

16 S rRNA-R

CCAGGGCTACACACGTGCTA

TCTCGCGAGGTCGCTTCT

Immunization of ΔcheV via i.p. route

Referring to previous methods [8], 30 female Kunming mice, aged 6–8 weeks, were randomly divided into 3 groups (n = 10), namely the immune group (Group A), the C50336 infection group (Group B) and the PBS control group (Group C). Group A was i.p. injected with a dose of 2.5 × 106 CFU/mouse of ΔcheV (once on day 0 and once on day 14), while Group B and C were i.p. injected with an equal volume of PBS. 45 days after the second immunization, mice in Groups A and B were simultaneously i.p. injected with a dose of 2 × 107 CFU/mouse of C50336, and Group C was injected with an equal volume of PBS. The survival of mice was recorded daily for 14 days post-infection (dpi). The immune protection rate of ΔcheV to mice can be calculated according to the formula: (mortality rate of the control group - mortality rate of the immune group)/mortality rate of the control group × 100%.

Statistical analysis

Statistical analyses were conducted using GraphPad Prism v 8.0, employing one-way Analysis of Variance (ANOVA) followed by t-tests. Data are presented as mean ± standard error. Significant differences are indicated with an asterisk (*), where *p < 0.05, **p < 0.01, ***p < 0.001 are considered to represent statistically significant differences in mean values.

Results

The cheV gene affects the resistance of SE to environmental stress

Using λ-Red recombination technology, a cheV gene deletion mutant was constructed in C50336. As shown in Fig. 1A, the deletion strain of the cheV gene and the complementation strain were successfully constructed.

Fig. 1.

Fig. 1

(A) PCR verification of the cheV gene deletion strain and ΔcheV-complemented strain. C50336 means the wild-type strain; ΔcheV::cat means a first recombination strain; ΔcheV means a second recombination strain, ΔcheV + cheV means ΔcheV‐complemented strain. The PCR product of C50336 has a length of 924 bp, the product of ΔcheV::cat has a length of 1510 bp, the product of ΔcheV has a length of 493 bp and the product of ΔcheV + cheV has a length of 1008 bp. (B) The survival rate of ΔcheV under various environmental stresses. The data represents the average of 3 replicates (*p < 0.05, ***p < 0.001, ns means not significant)

To study whether the cheV gene influences the resistance of SE to various environmental stresses, we compared the survival of C50336 and ΔcheV in strong acid stress solution, strong alkaline stress solution, at 42 °C and in oxidative stress solution. The results (Fig. 1B) showed that, compared to C50336, the survival rate of the ΔcheV significantly decreased in acidic, alkaline and thermal environments. There was no significant change in survival rate under oxidative stress conditions. This indicates that the cheV gene plays a role in affecting the resistance of SE to acid, alkaline and thermal stresses.

The cheV gene does not affect biofilm formation ability and drug resistance of SE

Biofilm formation assays were conducted for C50336, ΔcheV and ΔcheV + cheV. The results showed that in test tubes, C50336, ΔcheV and ΔcheV + cheV were all capable of forming biofilms (Fig. 2A), with no significant differences in thickness and color intensity. Quantitative results revealed that the biofilms formed by the 3 strains had similar OD570 nm values after staining and dissolution (Fig. 2B). Curli detection indicated that all 3 strains formed red, rough colonies (Fig. 2C), suggesting that all strains could produce curli. The cellulose detection results showed that the colonies of all 3 strains emitted the same fluorescence intensity under UV light (Fig. 2D). These findings suggest that the cheV gene does not affect biofilm formation in SE.

Fig. 2.

Fig. 2

(A) Detection of biofilm formation in glass test tubes. (B) Qualitative detection of biofilm formation in microtiter plates, with absorbance measured at 570 nm (ns means not significant). (C) Curli formation detection. (D) Cellulose formation detection

Drug susceptibility tests were conducted using the K-B method, and the results were interpreted according to the standards of the NCCLS. The results (Table 4) showed that compared to the C50336, ΔcheV only exhibited increased resistance to cefoperazone. There were no significant differences in sensitivity to other antibiotics. This indicates that the cheV gene has a minimal impact on the drug resistance of SE.

Table 4.

Antibiotic susceptibility test of cheV gene deletion strain

Drug Name Standard of inhibition zone diameter (mm) Diameter (mm)
R I S C50336 ΔcheV ΔcheV + cheV
Ampicillin ≤ 13 14–16 ≥ 17 20 19 0
Piperacillin ≤ 17 18–20 ≥ 21 20 18 0
Amoxicillin ≤ 13 14–17 ≥ 18 24 22 0
Cefazolin ≤ 19 20–22 ≥ 23 24 24 0
Cephalothin ≤ 14 15–17 ≥ 18 18 19 0
Cefoperazone ≤ 15 16–20 ≥ 21 24 18 22
Cefuroxime ≤ 14 15–17 ≥ 18 16 15 20
Ceftriaxone ≤ 13 14–20 ≥ 21 17 16 25
Gentamicin ≤ 12 13–14 ≥ 15 17 19 27
Amikacin ≤ 14 15–16 ≥ 17 18 18 22
Kanamycin ≤ 13 14–17 ≥ 18 18 18 26
Streptomycin ≤ 11 12–14 ≥ 15 15 15 17
Tetracycline ≤ 14 15–18 ≥ 19 15 15 20
Doxycycline ≤ 12 13–15 ≥ 16 15 13 16
Minocycline ≤ 14 15–18 ≥ 19 11 12 15
Ciprofloxacin ≤ 15 16–20 ≥ 21 23 27 27
Levofloxacin ≤ 13 14–16 ≥ 17 24 22 30

The cheV gene does not affect the motility of SE

Using 0.3% semi-solid agar for motility testing, the results showed that the average diameters of motility for the C50336, ΔcheV and ΔcheV + cheV strains were 25 mm, 24 and 25 mm respectively (Fig. 3). There was no significant difference among the 3 strains, indicating that the deletion of the cheV gene does not affect the motility of SE.

Fig. 3.

Fig. 3

(A) The images shown are representatives of several independent assays. (A) The motility of the strains was evaluated on 0.3% agar plates, measured after 5 h of incubation. The data represents the average of 3 replicates (ns means not significant)

The cheV gene affects the invasion and intracellular survival ability of SE

Using Caco-2 and RAW264.7 cell models, the adhesion, invasion and intracellular survival abilities of the ΔcheV were tested (Fig. 4). The results showed that the adhesion ability of the ΔcheV to Caco-2 cells was not significantly different compared to C50336. However, its invasion ability and intracellular survival ability significantly decreased. These results indicate that the deletion of the cheV gene does not affect the adhesion ability of SE but does reduce its invasion and intracellular survival capabilities.

Fig. 4.

Fig. 4

(A) Adhesion and invasion of bacteria in Caco-2 cells. (B) Intracellular survival in RAW264.7 cells. The results of the adhesion and invasion assays are presented as a ratio to the C50336 (The results of C50336 were considered as 100%). The data represents the average of 3 replicates (***p < 0.001, ns means not significant)

Deletion of the cheV gene attenuates the virulence of SE

Mice were infected with C50336 and ΔcheV via the i.p. route. Both groups began to exhibit mortality on the 3rd dpi, showing typical symptoms such as trembling, arched backs, crusted eyes and disheveled fur. In contrast, the control group mice had smooth fur and good mental state. The LD50 calculation results (Table 5) showed that the LD50 for C50336 and ΔcheV were 6.3 × 105 CFU/mouse and 1.25 × 107 CFU/mouse, respectively. This indicates that the LD50 of ΔcheV is approximately 20 times higher than that of C50336 (1.25 × 107/6.3 × 105 ≈ 20), suggesting that the deletion of the cheV gene reduces the virulence of SE.

Table 5.

LD50 of C50336 and ΔcheV in KM mice

Strain Inoculation dose (CFU/mouse) No. of deaths / total no. of mice LD50 (CFU)
C50336 2 × 107 5 / 5 6.3 × 105
2 × 106 3 / 5
2 × 105 2 / 5
2 × 104 0 / 5
2 × 103 0 / 5
ΔcheV 2.5 × 109 5 / 5 1.25 × 107
2.5 × 108 5 / 5
2.5 × 107 4 / 5
2.5 × 106 0 / 5
2.5 × 105 0 / 5

Reduced expression levels of virulence genes in cheV gene deletion strain

To further investigate the impact of the cheV gene on the virulence of SE, the expression levels of various virulence genes following the deletion of the cheV gene were examined using the qPCR method. The results (Fig. 5) showed significant reductions in the expression levels of fimD, flgG, csgA, csgD, hflK,lrp, sipA, sipB, pipB, invH, mgtC, sodC, rfbH, xthA, and mrr1. This indicates that the deletion of the cheV gene leads to reduced expression of multiple virulence genes in SE.

Fig. 5.

Fig. 5

The expression levels of virulence genes in C50336, ΔcheV and ΔcheV + cheV were detected by using qPCR, with 16 S rRNA as the housekeeping gene. The data represents the average of 3 replicates (*p < 0.05, **p < 0.01, ***p < 0.001, ns means not significant)

The cheV gene deletion strain provides good immune protection in mice

14 days after the final immunization, mice in Group A and Group B were simultaneously infected with C50336 through the i.p. route, while Group C was again injected with PBS. The results (Fig. 6) showed that both Group A and Group C mice demonstrated a 100% survival rate over 14 days, with none of the mice exhibiting typical clinical symptoms of SE infection. In contrast, the mortality rate in Group B was 90% within the same period, and typical symptoms of SE infection, such as trembling, arched backs, crusted eyes and disheveled fur, were observed in these mice. According to the formula for calculating immune protection rate, the immune protection rate of ΔcheV is 100%. This indicates that ΔcheV provided 100% protection in mice against SE infection.

Fig. 6.

Fig. 6

Survival rate of immunized mice against SE infection. (A) Female KM mice (n = 10 per group) aged 6–8 weeks were i.p. injected with the ΔcheV and i.p. injected with a lethal dose of C50336 (2 × 107 CFU/mouse) at 28 dpi. The survival rate of mice was monitored daily. (B) Survival curve (****p < 0.0001)

Discussion

In the process of developing genetically engineered attenuated live vaccines, selecting suitable candidate genes for attenuation is crucial. Chemotaxis affects the survival and colonization abilities of Salmonella within the host, which in turn impacts the bacterium’s virulence [31, 33]. The CheV, as a coupling protein in the chemotaxis system, might influence the virulence of SE. To confirm this hypothesis, we constructed a cheV gene deletion strain. Both in vivo and in vitro assays, it was found that compared to the C50336, the cheV gene deletion strain exhibited significantly reduced virulence, indicating that the cheV gene plays an important role in the virulence of SE.

In the process of pathogenesis, SE must contend with many adverse environmental conditions, including antimicrobial peptides, changes in temperature and pH, and limited availability of nutrients [34]. Additionally, the host’s inflammatory response, which recruits phagocytic cells, exposes Salmonella to other unfavorable conditions such as oxidative and nitrosative stress [35]. The ability to survive under different environmental stress conditions is a fundamental characteristic of SE’s pathogenicity [36]. In this study, we found that the ΔcheV, compared to the wild type, showed a significant decrease in survival rate under acid, alkaline, and thermal stress. This suggests that the deletion of the cheV gene weakens SE’s perception of acid, alkaline, and thermal environments, preventing it from making appropriate responses to avoid and endure stressful conditions, thereby reducing its survival rate and affecting its pathogenic process.

Moreover, biofilm formation is one of Salmonella’s adaptive mechanisms for surviving in adverse conditions. It protects the bacteria from harsh external environments, enhancing SE’s resistance to conditions such as dryness, extreme temperatures, antibiotics and preservatives [34, 37]. In this study, the biofilm formation ability of SE after the deletion of the cheV gene was investigated. It was found that there was no significant difference in the biofilm formation of ΔcheV compared to C50336, and the production of curli and cellulose was consistent with that of C50336 and ΔcheV + cheV. qPCR analysis revealed that the expression levels of the biofilm formation-related genes csgA and csgD were significantly reduced. A possible explanation is that, although the deletion of the cheV gene led to a decrease in the expression levels of some genes related to biofilm formation, biofilm formation is regulated by multiple factors, and overall, the deletion of the cheV gene does not significantly affect the biofilm formation capability. Biofilm formation ability is often closely related to bacterial drug resistance [38]. The drug resistance testing of the ΔcheV indicated that, compared to C50336, there was no significant change in its sensitivity to most antibiotics, which aligns with expectations. However, it is important to note that the parental strain C50336 is not highly resistant to antibiotics, which might mislead us to believe that the deletion of the cheV gene does not affect the bacterial drug resistance.

In the host body, the strength of motility plays a crucial role in whether Salmonella can reach specific sites. After entering the small intestine, Salmonella must traverse the mucosal layer and then adhere to the intestinal epithelial cells. Therefore, motility is a prerequisite for Salmonella to increase its chances of contact with intestinal epithelial cells [39]. Research on different bacteria has found that the impact of cheV on motility is inconsistent. In this study, we found that the motility of the ΔcheV on semi-solid agar did not change significantly. qPCR analysis showed a decrease in the expression levels of Salmonella motility-related genes flgG and fimD, while the expression level of prot6E did not change. Although there is a decrease in the expression levels of genes related to motility, other compensatory mechanisms may exist, leading to the deletion of cheV not significantly affecting the motility of SE.

To further investigate the impact of the cheV gene on the virulence of SE, we used both cellular and animal models for evaluating virulence. The pathogenesis of Salmonella primarily involves adhesion to epithelial cells, invasion, and survival within macrophages. In this study, we found that deletion of the cheV gene did not significantly change the adhesion capability of SE to epithelial cells, possibly because the formation of SE biofilms and motility were not significantly affected, resulting in no significant difference in the amount of adhesion to epithelial cells. However, the ability to invade and the intracellular survival rate in macrophages significantly decreased. Moreover, qPCR analysis revealed that the expression levels of genes related to invasion ability (invH) and genes related to intracellular survival in macrophages (sipA, pipB, mgtC and sodC) were significantly reduced. These results suggest that deletion of the cheV gene reduces the invasion and intracellular survival abilities of SE, leading to attenuated virulence. LD50 measurements in mice models for C50336 and ΔcheV showed that the LD50 of ΔcheV increased by about 20 times, indicating that the cheV gene influences the virulence of SE. To further investigate the role of the cheV gene in SE virulence, qPCR was used to detect the expression of various virulence genes after cheV gene deletion. It was found that the expression levels of genes involved in metabolism (rfbH), genes related to exonuclease/endonuclease activity (xthA and mrr1), genes associated with cell membrane and cell wall integrity (hflK and lrp), and genes related to type III secretion system (T3SS) (sipB, including sipA, pipB) were significantly reduced. This suggests that the deletion of cheV can downregulate the expression of various virulence genes, thereby reducing the virulence of SE consistent with the LD50 test results. To determine the immune protection rate, mice were immunized twice with ΔcheV, and it was found that this method of immunization could 100% resist the infection by the wild-type strain. This result indicates that the cheV gene deletion strain has a good immune protective effect on mice and has the potential to be a candidate for developing genetically engineered attenuated live vaccines.

Developing attenuated Salmonella live vaccines requires skillfully balancing attenuation with immunogenicity. It’s essential to ensure that the bacterial virulence is appropriately reduced, while also stimulating immunity without causing disease [40]. Therefore, we will next examine the distribution of bacteria in various organs to further assess the virulence level of the ΔcheV. Additionally, after immunizing mice, we will measure immune indicators such as IgG, IgA and cytokines to further analyze the immune protection of the mutant.

In conclusion, this study demonstrates that the deletion of the cheV gene reduces the virulence of SE. and the cheV gene deletion strain can provide effective immune protection in mice. These findings lay the groundwork for subsequent research and development of related genetically engineered attenuated live vaccines.

Electronic supplementary material

Below is the link to the electronic supplementary material.

12917_2024_3951_MOESM1_ESM.tif (300.1KB, tif)

Supplementary Material 1: Figure 1A-S1—The original electrophoretic image of Figure 1 (A)

12917_2024_3951_MOESM2_ESM.tif (282.6KB, tif)

Supplementary Material 2: Figure 1B-S2—The original electrophoretic image of Figure 1 (B)

Author contributions

L.Z., T.W. and F.W. contributed equally to this paper. Conceptualization, L.Z. and F.W.; Methodology, L.Z. and G.Z.; Formal analysis, L.Z. and W.L.; Investigation, L.Z. and Z.Z.; Writing—original draft, L.Z. and Y.Z.; Writing—review & editing, T.W.; Supervision, T.W.; Project administration, T.W. and Q.S., Funding acquisition, Q.S. and Y.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Hebei Agriculture Research System (HBCT2024240201), the Central Government Guides Local Projects, Hebei Province, Department of Science and Technology (grant no. 23626604G), and Hebei Province Key Research and Development Program Project, Hebei Province, Department of Science and Technology (grant no. 19226628D).

Data availability

The datasets supporting the conclusions of this article are included within the article.

Declarations

Ethics approval and consent to participate

The mice were handled in strict accordance with international ethical guidelines and the Experimental Animal Regulation Ordinances (HPDST 2020-17) defined by Hebei Provincial Department of Science and Technology, and approved by the Animal Care and Use Committee, Hebei Normal University of Science and Technology.

Consent for publication

No applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Tonglei Wu, Email: 532966952@163.com.

Qiumei Shi, Email: shiqiumei@126.com.

References

  • 1.Ferrari RG, Rosario DKA, Cunha-Neto A, Mano SB, Figueiredo EES, Conte-Junior CA. Worldwide Epidemiology of Salmonella Serovars in Animal-Based foods: a Meta-analysis. Appl Environ Microbiol. 2019;85(14):e00591–19. doi: 10.1128/AEM.00591-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Liu B, Zhang X, Ding X, Bin P, Zhu G. The vertical transmission of Salmonella Enteritidis in a one-health context. One Health. 2023;16:100469. doi: 10.1016/j.onehlt.2022.100469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ruvalcaba-Gómez JM, Villagrán Z, Valdez-Alarcón JJ, Martínez-Núñez M, Gomez-Godínez LJ, Ruesga-Gutiérrez E, Anaya-Esparza LM, Arteaga-Garibay RI. Villarruel-López A. Non-antibiotics strategies to Control Salmonella Infection in Poultry. Animals. 2022;12(1):102. doi: 10.3390/ani12010102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Li S, He Y, Mann DA, Deng X. Global spread of Salmonella Enteritidis via centralized sourcing and international trade of poultry breeding stocks. Nat Commun. 2021;12(1):5109. doi: 10.1038/s41467-021-25319-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Jiang X, Chu C, Wang Z, Gu J, Hong Y, Li Q, Jiao X. Preclinical evaluation of OMVs as potential vaccine candidates against Salmonella enterica Serovar Enteritidis infection. Front Cell Infect Microbiol. 2022;12:1037607. [DOI] [PMC free article] [PubMed]
  • 6.Kang X, Huang T, Shen H, Meng C, Jiao X, Pan Z. Salmonella Enteritidis subunit vaccine candidate based on SseB protein co-delivered with simvastatin as adjuvant. Pathogens. 2022;11(4):443. doi: 10.3390/pathogens11040443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Yamawaki RA, Rubio MDS, Alves LBR, De Almeida AM, Ferreira TS, Berchieri Junior A, Penha Filho RAC. Evaluation of transfer of maternal immunity to the offspring of broiler breeders vaccinated with a candidate recombinant vaccine against. Salmonella Enteritidis Vaccine. 2021;39(17):2408–15. doi: 10.1016/j.vaccine.2021.03.050. [DOI] [PubMed] [Google Scholar]
  • 8.Lin Z, Tang P, Jiao Y, Kang X, Li Q, Xu X, Sun J, Pan Z, Jiao X. Immunogenicity and protective efficacy of a Salmonella Enteritidis sptP mutant as a live attenuated vaccine candidate. BMC Vet Res. 2017;13(1):194. doi: 10.1186/s12917-017-1115-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Park S, Jung B, Kim E, Hong S-T, Yoon H, Hahn T-W. Salmonella Typhimurium lacking YjeK as a candidate live attenuated vaccine against invasive Salmonella infection. Front Immunol. 2020;11:1277. doi: 10.3389/fimmu.2020.01277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Zabalza-Baranguá A, Poveda-Urkixo I, Mena-Bueno S, Ramírez GA, De Bolle X, Grilló MJ. Vaccine properties of Brucella melitensis 16 M∆wzm and reactivation of placental infection in pregnant sheep. Vaccine. 2023;41(9):1554–66. doi: 10.1016/j.vaccine.2023.01.017. [DOI] [PubMed] [Google Scholar]
  • 11.Cote CK, Biryukov SS, Klimko CP, Shoe JL, Hunter M, Rosario-Acevedo R, Fetterer DP, Moody KL, Meyer JR, Rill NO, Dankmeyer JL, Worsham PL, Bozue JA, Welkos SL. Protection elicited by attenuated live Yersinia pestis Vaccine strains against Lethal Infection with virulent Y. Pestis. Vaccines. 2021;9(2):161. doi: 10.3390/vaccines9020161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Liu X, Jiao C, Ma Y, Wang Q, Zhang Y. A live attenuated Vibrio anguillarum vaccine induces efficient immunoprotection in Tiger puffer (Takifugu rubripes) Vaccine. 2018;36(11):1460–6. doi: 10.1016/j.vaccine.2018.01.067. [DOI] [PubMed] [Google Scholar]
  • 13.Yang W, Wang L, Zhang L, Qu J, Wang Q, Zhang Y. An invasive and low virulent Edwardsiella tarda esrB mutant promising as live attenuated vaccine in aquaculture. Appl Microbiol Biotechnol. 2015;99(4):1765–77. doi: 10.1007/s00253-014-6214-5. [DOI] [PubMed] [Google Scholar]
  • 14.Srikumar S, Kröger C, Hébrard M, Colgan A, Owen SV, Sivasankaran SK, Cameron ADS, Hokamp K, Hinton JCD. RNA-seq brings New insights to the Intra-macrophage Transcriptome of Salmonella Typhimurium. PLoS Pathog. 2015;11(11):e1005262. doi: 10.1371/journal.ppat.1005262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Cooper KG, Chong A, Kari L, Jeffrey B, Starr T, Martens C, McClurg M, Posada VR, Laughlin RC, Whitfield-Cargile C, Garry Adams L, Bryan LK, Little SV, Krath M, Lawhon SD, Steele-Mortimer O. Regulatory protein HilD stimulates Salmonella Typhimurium invasiveness by promoting smooth swimming via the methyl-accepting chemotaxis protein McpC. Nat Commun. 2021;12(1):348. doi: 10.1038/s41467-020-20558-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.De Pina LC, Da Silva FSH, Galvão TC, Pauer H, Ferreira RBR, Antunes LCM. The role of two-component regulatory systems in environmental sensing and virulence in Salmonella. Crit Rev Microbiol. 2021;47(4):397–434. doi: 10.1080/1040841X.2021.1895067. [DOI] [PubMed] [Google Scholar]
  • 17.Dawan J, Ahn J. Bacterial stress responses as potential targets in overcoming Antibiotic Resistance. Microorganisms. 2022;10(7):1385. doi: 10.3390/microorganisms10071385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Pasqua M, Coluccia M, Eguchi Y, Okajima T, Grossi M, Prosseda G, Utsumi R, Colonna B. Roles of Two-Component Signal Transduction Systems in Shigella Virulence. Biomolecules. 2022;12(9):1321. doi: 10.3390/biom12091321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lowenthal AC, Simon C, Fair AS, Mehmood K, Terry K, Anastasia S, Ottemann KM. A fixed-time diffusion analysis method determines that the three cheV genes of Helicobacter pylori differentially affect motility. Microbiology. 2009;155(4):1181–91. doi: 10.1099/mic.0.021857-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Reuter M, Ultee E, Toseafa Y, Tan A, van Vliet AHM. Inactivation of the core cheVAWY chemotaxis genes disrupts chemotactic motility and organised biofilm formation in Campylobacter jejuni. FEMS Microbiol Lett. 2021;367(24):fnaa198. doi: 10.1093/femsle/fnaa198. [DOI] [PubMed] [Google Scholar]
  • 21.Xu X, Li H, Qi X, Chen Y, Qin Y, Zheng J, Jiang X. cheA, cheB, cheR, cheV, and cheY are involved in regulating the adhesion of Vibrio harveyi. Front Cell Infect Microbiol. 2021;10:591751. doi: 10.3389/fcimb.2020.591751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Huang L, Wang L, Lin X, Su Y, Qin Y, Kong W, Zhao L, Xu X, Yan Q. Mcp, aer, cheB, and cheV contribute to the regulation of Vibrio alginolyticus (ND -01) adhesion under gradients of environmental factors. MicrobiologyOpen. 2017;6(6):e00517. doi: 10.1002/mbo3.517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Liu Y, Zhang Q, Hu M, Yu K, Fu J, Zhou F, Liu X. Proteomic analyses of Intracellular Salmonella enterica Serovar Typhimurium reveal extensive bacterial adaptations to infected host epithelial cells. Infect Immun. 2015;83(7):2897–906. doi: 10.1128/IAI.02882-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA. 2000;97(12):6640–5. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zhang Z, Du W, Wang M, Li Y, Su S, Wu T, Kang Y, Shan X, Shi Q, Zhu G. Contribution of the colicin receptor CirA to biofilm formation, antibotic resistance, and pathogenicity of Salmonella Enteritidis. J Basic Microbiol. 2020;60(1):72–81. doi: 10.1002/jobm.201900418. [DOI] [PubMed] [Google Scholar]
  • 26.Dong H, Peng D, Jiao X, Zhang X, Geng S, Liu X. Roles of the spiA gene from Salmonella enteritidis in biofilm formation and virulence. Microbiology. 2011;157(6):1798–805. doi: 10.1099/mic.0.046185-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Rashid MH, Kornberg A. Inorganic polyphosphate is needed for swimming, swarming, and twitching motilities of Pseudomonas aeruginosa. Proc Natl Acad Sci USA. 2000;97(9):4885–90. doi: 10.1073/pnas.060030097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Nikhil KC, Noatia L, Priyadarsini S, Pashupathi M, Gali JM, Ali MA, Behera SK, Sharma B, Roychoudhury P, Kumar A, Behera P. Recoding anaerobic regulator fnr of Salmonella Typhimurium attenuates it’s pathogenicity. Microb Pathog. 2022;168:105591. doi: 10.1016/j.micpath.2022.105591. [DOI] [PubMed] [Google Scholar]
  • 29.Jung B, Park S, Kim E, Yoon H, Hahn T-W. Salmonella Typhimurium lacking phoBR as a live vaccine candidate against poultry infection. Vet Microbiol. 2022;266:109342. doi: 10.1016/j.vetmic.2022.109342. [DOI] [PubMed] [Google Scholar]
  • 30.Park S, Jung B, Kim E, Yoon H, Hahn T-W. Evaluation of Salmonella Typhimurium Lacking fruR, ssrAB, or hfq as a prophylactic vaccine against Salmonella Lethal infection. Vaccines. 2022;10(9):1413. doi: 10.3390/vaccines10091413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Frye J, Karlinsey JE, Felise HR, Marzolf B, Dowidar N, McClelland M, Hughes KT. Identification of New Flagellar genes of Salmonella enterica Serovar Typhimurium. J Bacteriol. 2006;188(6):2233–43. doi: 10.1128/JB.188.6.2233-2243.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Upadhyaya I, Upadhyay A, Kollanoor-Johny A, Darre M, Venkitanarayanan K. Effect of Plant Derived antimicrobials on Salmonella Enteritidis Adhesion to and Invasion of primary chicken oviduct epithelial cells in vitro and virulence gene expression. IJMS. 2013;14(5):10608–25. doi: 10.3390/ijms140510608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Alexander RP, Lowenthal AC, Harshey RM, Ottemann KM. CheV: CheW-like coupling proteins at the core of the chemotaxis signaling network. Trends Microbiol. 2010;18(11):494–503. doi: 10.1016/j.tim.2010.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Rana K, Nayak SR, Bihary A, Sahoo AKu, Mohanty KC, Palo SKu, Sahoo D, Pati S, Dash P. Association of quorum sensing and biofilm formation with Salmonella virulence: story beyond gathering and cross-talk. Arch Microbiol. 2021;203(10):5887–97. doi: 10.1007/s00203-021-02594-y. [DOI] [PubMed] [Google Scholar]
  • 35.Alam A, Bröms JE, Kumar R, Sjöstedt A. The role of ClpB in bacterial stress responses and virulence. Front Mol Biosci. 2021;8:668910. doi: 10.3389/fmolb.2021.668910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Arunima A, Swain SK, Patra SD, Das S, Mohakud NK, Misra N, Suar M. Role of OB-Fold protein YdeI in stress response and virulence of Salmonella enterica Serovar Enteritidis. J Bacteriol 2020; 203(1). [DOI] [PMC free article] [PubMed]
  • 37.Marin C, Hernandiz A, Lainez M. Biofilm development capacity of Salmonella strains isolated in poultry risk factors and their resistance against disinfectants. Poult Sci. 2009;88(2):424–31. doi: 10.3382/ps.2008-00241. [DOI] [PubMed] [Google Scholar]
  • 38.Algburi A, Comito N, Kashtanov D, Dicks LMT, Chikindas ML. Control of Biofilm formation: antibiotics and Beyond. Appl Environ Microbiol. 2017;83(3):e02508–16. doi: 10.1128/AEM.02508-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Fàbrega A, Vila J. Salmonella enterica Serovar Typhimurium skills to succeed in the host: virulence and regulation. Clin Microbiol Rev. 2013;26(2):308–41. doi: 10.1128/CMR.00066-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Ji HJ, Jang A-Y, Song JY, Ahn KB, Han SH, Bang SJ, Jung HK, Hur J, Seo HS. Development of live attenuated Salmonella Typhimurium vaccine strain using Radiation Mutation Enhancement Technology (R-MET) Front Immunol. 2022;13:931052. doi: 10.3389/fimmu.2022.931052. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

12917_2024_3951_MOESM1_ESM.tif (300.1KB, tif)

Supplementary Material 1: Figure 1A-S1—The original electrophoretic image of Figure 1 (A)

12917_2024_3951_MOESM2_ESM.tif (282.6KB, tif)

Supplementary Material 2: Figure 1B-S2—The original electrophoretic image of Figure 1 (B)

Data Availability Statement

The datasets supporting the conclusions of this article are included within the article.


Articles from BMC Veterinary Research are provided here courtesy of BMC

RESOURCES