Table 1.
Assembly pipeline and software used.
| Software and options | Version | |
|---|---|---|
| Assembly | ||
| Filtering PacBio HiFi adapters | cutadapt -j=32 -b ATCTCTCTCAACAACAACAACGGAGGAGGAGG AAAAGAGAGAGAT -b ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTG TTGAGAGAGAT --output=out1.fq.gz --error rate=0.1 --times=1 --overlap=3 --action=trim --revcomp --discard-trimmed |
4.0+galaxy0 |
| K-mer counting | Meryl (k = 21) | 1.3+galaxy4 |
| Estimation of genome size and heterozygosity | GenomeScope | 2.0+galaxy1 |
| De novo assembly (contiging) | hifiasm in HiC mode: hifiasm -t 32 -o output -f 37 -l 3 -s 0.75 -O 1 --l-msjoin 500000 --primary |
0.16.1+galaxy3 |
| Omni-C scaffolding | yahs --no-mem-check | 1.2a.2+galaxy0 |
| Omni-C contact map generation | ||
| Short-read alignment | BWA-MEM2 | 2.2.1+galaxy0 |
| SAM/BAM processing and filtering | Arima mapping pipeline (implemented as bellerophon) | 1.0+galaxy0 |
| Contact map visualization | PretextMap | 1.0+galaxy0 |
| PretextSnapshot | 0.0.3 | |
| Organelle assembly | ||
| Mitogenome assembly | mitohifi.py -f AY075116.1.fasta -g AY075116.1.gb -p 70 -t 32 -o 2 | 2 |
| Genome quality assessment | ||
| Basic assembly metrics | gfastats | 1.3.0+galaxy0 |
| Assembly completeness | BUSCO (-m geno, -l vertebrata/mammalia) | 5.3.2+galaxy0 |
| Merqury | 1.3+galaxy2 | |
| Contamination screening | ||
| Local alignment tool | Blast+ | 2.14.0 |
| General contamination screening | BlobToolKit | 4.1.7 |
| Comparison to E. maximus | ||
| Sequence alignment | nucmer (mummer) | 3.9.4alpha |
| Diversity and demographic history | ||
| Runs of homozygosity detection | ROHan | |
| Effective population size fluctuations | PSMC -N25 -t15 -r5 -p 4 + 25*2 + 4+6 | 0.6.5-r67 |
Software citations are listed in the text.