Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) |
K15-CrePR1 | The Jackson Laboratory | Cat.# 005249; RRID:IMSRJAX:005249 |
RU 486-inducible Cre recombinase driven by the mouse keratin complex 1, acidic, gene 15 promoter. When induced, Cre activity is observed in epithelial stem cells in the bulge region of the hair follicle |
| Strain, strain background (Mus musculus) |
TLR2-GFP | The Jackson Laboratory | Cat.# 031822; RRID:IMSR_JAX:031822 |
Tlr2KI knock-in mice have an HA tag and an IRES-EGFP sequence placed at the 3’ end of the Toll-like receptor 2 (Tlr2) gene |
| Strain, strain background (Mus musculus) |
TLR2KO | The Jackson Laboratory | Cat.# 004650; RRID:IMSR_JAX:004650 |
Global Tlr2 KO |
| Strain, strain background (Mus musculus) |
Tlr2flox/flox | Taconic Laboratory | c57BL/6NTacTlr2^tm3243Arte | loxP sites on either side of exon 3 of the targeted TLR2 gene |
| Strain, strain background (Mus musculus) |
TLR2HFSC-KO | Described previously; Xiong et al., 2022b | c57BL/6NTacTlr2^tm3243Arte -B6;SJL-Tg(Krt1-15-cre/PGR)22Cot/J |
RU 486-inducible hair follicle stem cells-specific Tlr2 KO |
| Strain, strain background (Mus musculus) |
C57BL/6J | The Jackson Laboratory | Cat.# 000664 RRID:IMSR_JAX:000664 |
|
| Cell line (Mus musculus) | Skin keratinocytes | Described previously; Xiong et al., 2022b | Freshly isolated from the mouse dorsal skin of WT and TLR2KO mice | |
| Cell line (Mus musculus) | Hair follicle stem cells | Described previously; Xiong et al., 2022b | Freshly isolated from the mouse dorsal skin of WT and TLR2HFSC-KO mice | |
| Cell line (human) | Hair follicle dermal papilla cells | Cell Applications, Inc | Cat.# 602-05a | Normal human scalp hair follicle papilla cells |
| Cell line (human) | Hair follicle stem cells | Celprogen | Cat.# 36007-08 | Human frontal region scalp extracted from hair follicle bulge |
| Cell line (human) | Epidermal keratinocytes, neonatal, pooled | Lonza Reagents | Cat.# 192906 | Cryopreserved normal human epidermal keratinocytes from pooled donors |
| Antibody | Mouse monoclonal anti-keratin 17 | Santa Cruz Biotechnology | Cat.# sc-393002- AF647; RRID:AB_2893006 |
IF 1:200 |
| Antibody | Rabbit polyclonal anti-keratin 15 | Abclonal | Cat.# A2660; RRID:AB_2764526 |
IF 1:100 |
| Antibody | Mouse monoclonal anti-myeloperoxidase | Santa Cruz Biotechnology | Cat.# sc-390109; RRID:AB_2892996 |
IF 1:100 |
| Antibody | Mouse monoclonal anti-TLR2 | Santa Cruz Biotechnology | Cat.# sc-21759 RRID:AB_628363 |
IF 1:100 |
| Antibody | Rabbit polyclonal anti-GFP | Thermo Fisher Scientific | Cat.# sc-390109; RRID:AB_10709851 |
IF 1:100 |
| Antibody | Rabbit monoclonal anti-Ki67 | Abcam | Cat.# ab16667; RRID:AB_302459 |
IF 1:250 |
| Antibody | Goat polyclonal anti-P-cadherin | R&D Systems | Cat.# AF761-SP; RRID:AB_355581 |
IF 1:50 |
| Antibody | Rabbit polyclonal anti-CEP | Pacific Immunology | Custom | IF 1:200 |
| Antibody | Rabbit polyclonal anti-β-catenin | Cell Signaling Technology | Cat.# 8480; RRID:AB_11127855 |
IF 1:80 |
| Antibody | Rat monoclonal anti-CD34 | eBioscience | Cat.# 11-0341-82; RRID:AB_465021 |
IF 1:200 FACS 1 µg/test |
| Antibody | Rat monoclonal anti-CD49f | BD Biosciences | Cat.# 562473; RRID:AB_11153684 |
IF 1:100 FACS 5 µl/test |
| Antibody | Rabbit monoclonal anti-Sox9 | Cell Signaling Technology | Cat.# 82,630T; RRID:AB_2665492 |
IF 1:200 |
| Antibody | Chicken polyclonal anti-keratin 5 | BioLegend | Cat.# 905903; RRID:AB_2721742 |
IF 1:200 |
| Antibody | Rabbit polyclonal anti-BMP7 | Proteintech | Cat.# 12221-1-AP; RRID:AB_2063960 |
IF 1:200 |
| Antibody | Rabbit monoclonal anti-pSmad1/5/9 | Cell Signaling Technology | Cat.# 13,820P; RRID:AB_2493181 |
IF 1:200 WB 1:1000 |
| Antibody | Anti-murine TLR2 (clone T2.5) Detection and Neutralizing mouse monoclonal | Invivogen | Cat.# mab2-mtlr2 RRID N/A |
Blocking experiment 0.66 µg/ml |
| Antibody | Smad1 (D59D7) XP Rabbit monoclonal |
Cell Signaling Technology | Cat.# 6944 | WB 1:1000 |
| Antibody | NF-κB p65 (D14E12) XP Rabbit monoclonal |
Cell Signaling Technology | Cat.# 8242 | WB 1:1000 |
| Antibody | Phospho-NF-κB p65 (Ser536) (93H1) Rabbit monoclonal | Cell Signaling Technology | Cat.# 3033 | WB 1:1000 |
| Antibody | Anti-GAPDH antibody EPR16884 Loading Control Rabbit monoclonal |
Abcam | Cat.# 181603 | WB 1:6000 |
| Antibody | Anti-rabbit IgG, HRP-linked Antibody goat anti-rabbit IgG Polyclonal |
Cell Signaling Technology | Cat.# 7074S | WB 1:3000 |
| Antibody | Normal mouse IgG2b-PE isotype control | Santa Cruz Biotechnology | Cat.# sc-2868 RRID:AB_737259 |
According to immune antibody concentration |
| Antibody | Normal goat IgG isotype control | R&D | Cat.# AB-108-C RRID:AB_354267 |
According to immune antibody concentration |
| Antibody | Normal mouse IgG isotype control | Santa Cruz Biotechnology | Cat.# sc-2025 RRID:AB_737182 |
According to immune antibody concentration |
| Antibody | Normal rabbit IgG isotype control | Cell Signaling Technology | Cat.# 2729S RRID:AB_1031062 |
According to immune antibody concentration |
| Antibody | Normal rat IgG isotype control | Santa Cruz Biotechnology | Cat.# sc-2026 RRID:AB_737202 |
According to immune antibody concentration |
| Antibody | Chicken IgY Isotype Control | Novus Biologicals | Cat.# AB-101-C RRID:AB_354263 |
According to immune antibody concentration |
| Antibody | Goat anti-Rat IgG Polyclonal (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | Invitrogen | Cat.# A-11007 RRID:AB_10561522 |
IF 1:300 |
| Antibody | Goat anti-Rabbit IgG Polyclonal (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Cat.# A-11008 RRID:AB_143165 |
IF 1:300 |
| Antibody | Goat anti-Rat IgG Polyclonal (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Invitrogen | Cat.# A-11006 RRID:AB_2534074 |
IF 1:300 |
| Antibody | Alexa Fluor Plus 594 Goat anti-rabbit Polyclonal Secondary Antibody | Thermo Fisher Scientific | Cat.# A-32740 RRID:AB_2762824 |
IF 1:300 |
| Antibody | Goat anti-Mouse IgG (H+L) Cross-Adsorbed Polyclonal Secondary Antibody, Alexa Fluor 568 | Thermo Fisher Scientific | Cat. # A-11004 RRID:AB_2534072 |
IF 1:300 |
| Antibody | Goat anti-Mouse IgG (H+L) Cross-Adsorbed Polyclonal Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Cat.# A-11001 RRID:AB_2534069 |
IF 1:300 |
| Antibody | Donkey anti-Goat IgG (H+L) Cross-Adsorbed Polyclonal Secondary Antibody, Alexa Fluor 594 | Thermo Fisher Scientific | Cat.# A-11058 RRID:AB_142540 |
IF 1:300 |
| Antibody | Goat anti-Chicken IgY (H+L) Secondary Antibody, Polyclonal Alexa Fluor 488 | Invitrogen | Cat.# A-11039 RRID:AB_2534096 |
IF 1:300 |
| Other | DAPI Solution | BD Biosciences | Cat#564907 RRID:AB_2869624 |
Fluorescent stain IF 1:300 |
| Other | Nile Red | ATT BioQuest | Cat.# 22190 | Lipophilic stain IF 10 µM |
| Other | 7-AAD | BD Biosciences | Cat.# 559925 RRID:AB_2869266 |
Membrane impermeant dye 0.25 µg/test |
| Sequence-based reagent | TLR2_F | This paper | PCR primers | TCTAAAGTCGATCCGCGACAT |
| Sequence-based reagent | TLR2_R | This paper | PCR primers | CTACGGGCAGTGGTGAAAACT |
| Sequence-based reagent | BMP7_F | This paper | PCR primers | ACGGACAGGGCTTCTCCTAC |
| Sequence-based reagent | BMP7_R | This paper | PCR primers | ATGGTGGTATCGAGGGTGGAA |
| Sequence-based reagent | BMP2_F | This paper | PCR primers | GGGACCCGCTGTCTTCTAGT |
| Sequence-based reagent | BMP2_R | This paper | PCR primers | TCAACTCAAATTCGCTGAGGAC |
| Sequence-based reagent | BMPr1A_F | This paper | PCR primers | AACAGCGATGAATGTCTTCGAG |
| Sequence-based reagent | BMPr1A_R | This paper | PCR primers | GTCTGGAGGCTGGATTATGGG |
| Sequence-based reagent | NFkB2_F | This paper | PCR primers | GGCCGGAAGACCTATCCTACT |
| Sequence-based reagent | NFkB2_R | This paper | PCR primers | CTACAGACACAGCGCACACT |
| Sequence-based reagent | IL1b_F | This paper | PCR primers | GCAACTGTTCCTGAACTCAACT |
| Sequence-based reagent | IL1b_R | This paper | PCR primers | ATCTTTTGGGGTCCGTCAACT |
| Sequence-based reagent | IL6_F | This paper | PCR primers | TAGTCCTTCCTACCCCAATTTCC |
| Sequence-based reagent | IL6_R | This paper | PCR primers | TTGGTCCTTAGCCACTCCTTC |
| Chemical compound, drug | Pam3CSK4 | Invivogen | Cat.# tlrl-pms | 10 µg/ml |
| Chemical compound, drug | Recombinant Human BMP-4 Animal-Free Protein | R&D Systems | Cat.# AFL314E-010 | 20 ng/ml |
| Chemical compound, drug | CEP (carboxyethylpyrrole) | Custom | Custom | Cell experiments 2.5–5 µM Skin treatment 5 µg/ml |
| Software, algorithm | Imaris V9.7.2 | Bitplane | ||
| Software, algorithm | ImageJ, Fiji V1.53t | National Institutes of Health | ||
| Software, algorithm | GraphPad Prism 9 | GraphPad by Dotmatics | ||
| Software, algorithm | Flow Jo | Becton, Dickinson & Company |